CN104593357B

CN104593357B - For detecting nucleic acid and its application of enterovirus

Info

Publication number: CN104593357B
Application number: CN201410251945.0A
Authority: CN
Inventors: 于浩洋; 陈勉乔; 邵曼
Original assignee: SHENZHEN GENEBIOHEALTH Co Ltd
Current assignee: SHENZHEN GENEBIOHEALTH Co Ltd
Priority date: 2014-06-03
Filing date: 2014-06-03
Publication date: 2018-05-08
Anticipated expiration: 2034-06-03
Also published as: CN108753768B; CN104593357A; CN108753768A

Abstract

The present invention relates to the application of the nucleic acid for detecting enterovirus, especially CoxA16 types/EV71 types/universal EV, the kit comprising the nucleic acid and the nucleic acid.

Description

For detecting nucleic acid and its application of enterovirus

Technical field

The present invention relates to for detect enterovirus, especially CoxA16 types/EV71 types/universal EV nucleic acid and its should With.

Background technology

Hand-foot-and-mouth disease children's common acute infectious disease as caused by human enterovirus.Clinically with fever and hand, foot, oral cavity It is main feature Deng position fash or bleb.Coxsackie virus (Coxsackie virus) A groups 16 of enterovirus genus, 4,5, 7th, 9,10 type, B groups 2,5 types；Echovirus (ECHO viruses) and enterovirns type 71 (EV71) etc. are responsible for brothers mouthful Disease, wherein play a major role for enterovirns type 71 (EV71), Coxsack A16 (CA16).Hand-foot-and-mouth disease is by human enterovirus Caused children's common acute infectious disease, most of infant symptoms are slight, a small number of infants can concurrently aseptic meningitis, encephalitis, AFP Cases, respiratory tract infection and myocarditis etc., indivedual children with serious disease disease progressions are fast.Effectively to prevent hand-foot-and-mouth disease Epidemic situation is spread, and related provinces and cities health authorities also start epidemic prevention and control emergency preplan, is striven epidemic situation control to minimum zone, Mitigate epidemic situation harm.Therefore, it is necessary to develop effectively monitor the detection kit of hand-foot-and-mouth disease.

In addition, the specificity diagnostic method of enterovirus infection has three kinds, i.e., Virus Isolation, Serologic detection and point Sub- biology techniques, it is cumbersome, time-consuming, sensitiveness is low, poor specificity, it is not suitable for the early diagnosis as virus.Need out Sending out a kind of effectively save testing cost and time but also can effectively monitor the detection kit of hand-foot-and-mouth disease.

The content of the invention

On the one hand, the present invention is provided to detect the core of enterovirus (especially CoxA16 types/EV71 types/EV is universal) Acid.

Nucleic acid (such as primer or probe) for detecting CoxA16 types, which includes, to be derived from or for expanding or detecting The nucleotide sequence of CoxA16 type A sequences or B sequences.The A sequences correspond in GenBank accession number KC117318 sequences 61-254 positions, are preferably：

CGGAGTGTTTCGCTCAGCACTTCCCCCGTGTAGATCAGGTCGATGAGTCACTGTAAACCCCACGGGCGACCGTGACA GTGGCTGCGTTGGCGGCCTGCCCATGGGGTAACCCATGGGACGCTCTAATACAGACATGGTGTGAAGAGTCTATTGA GCTAGTTAGTAGTCCTCCGGCCCCTGAATG(SEQ ID NO：1).

The B sequences correspond to GenBank accession number gb | KF055245.1 | the 4365-4460 positions in the sequence in sequence Put, be preferably：

AAGGATGAACAACTACATGCAGTTCAAGAGCAAACACCGTATTGAACCTGTATGTTTAATCATTAGAGGCTCCCCAG GAACAGGTAA(SEQ ID NO：2).

Nucleic acid (such as primer or probe) for detecting EV71 types, which includes, to be derived from or for expanding or detecting EV71 types A And/or the nucleotide sequence of B sequences.The A sequences correspond to the 5678- in GenBank accession number FJ606449.1 sequences 5783 positions, are preferably：

AGTGATGCCACCCTAGTGATCAACACGGAGCACATGCCATCAATGTTTGTCCCGGTGGGTGACGTTGTGCAGTATGG CTTCTTGAATCTCAGTGGTAAGCCTACCC(SEQ ID NO：3).

The B sequences correspond to GenBank accession number gb | KC436271.1 | the 4288-4430 positions in sequence, preferably For：

TGAAGTCATGTTTGGGAATGTGTCGTACCTAGCCCACTTCTGTCGCAAGTTCCAACCGCTATACGCCACGGAAGCTA AAAGAGTCTATGCCCTGGAGAAGAGAATGAATAATTATATGCAGTTCAAGAGCAAACACCG(SEQ ID NO：4).

For detect the universal nucleic acid of EV (such as primer or probe) include derive from or for expanding or detecting GenBank accession number gb | KF312457.1 | the nucleotide sequence of the 442-566 positions in sequence, is preferably derived from or for expanding Increase or detect following sequence：CCCCTGAATGCGGCTAATCCCAACTGCGGAGCACACGCCCACAAGCCAGCGGGTAGTGTG TCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCCTT(SEQ ID NO：5).For detecting Nucleic acid universal EV can detect 16,4,5,7,9,10 type of Coxsackie virus (Coxsackie virus) A groups, B groups 2,5 types； And the enterovirus such as enterovirns type 71 (Enterovirus71, EV71).

In certain embodiments of the invention, the nucleic acid is the primer for detecting enterovirus.

Primer for detecting CoxA16 type virus A sequences preferably comprise sense primer CoxA16A-F5 '- CGGAGTGTTTCGCTCAGCAC-3’(SEQ ID NO：And anti-sense primer CoxA16A-R5 '-CATTCAGGGGCCGGAGG- 6) 3’(SEQ ID NO：7) primer pair of composition.

For detect the preferred sense primer CoxA16B-F sequences of primer of CoxA16 type virus B sequences for 5 '- AAGGATGAACAACTACATGCAGTTC-3’(SEQ ID NO：8) and anti-sense primer CoxA16B-R sequences for 5 '- TTACCTGTTCCTGGAGAGCCTCT-3’(SEQ ID NO：9) primer pair of composition.

For detect the preferred sense primer EV71A-F sequences 5 ' of primer of enterovirus EV 71 type A sequences- AAGTGATGCCACCCTAGTGATCAA-3’(SEQ ID NO：And anti-sense primer EV71A-R sequences 5 ' 10)- GGGTAGGCTTACCACTGAGATTCA-3’(SEQ ID NO：11) primer pair of composition.

For detect the preferred sense primer EV71B-F sequences 5 ' of primer of enterovirus EV 71 type B sequences-

TGAAGTCATGTTTGGGAATGTGTC-3’(SEQ ID NO：And anti-sense primer EV71B-R sequences 5 ' 12)- CGGTGTTTGCTCTTGAACTGC-3’(SEQ ID NO：13) primer pair of composition.

The preferred sense primer EV-F sequences 5-CCCCTGAATGCGGCTAAT of primer for detecting enterovirus universal C-3(SEQ ID NO：And anti-sense primer EV-R sequences ' 5-GGAAACACGGACACCCAAAGTA-3 ' (SEQ ID NO 14)：15) The primer pair of composition.

In a further embodiment, the nucleic acid is the probe for detecting enterovirus.For detecting CoxA16 types A The probe of sequence is preferably 5 '-CTCATCGACCTGATCTACACGGGG-3 ' (SEQ ID NO：16).For detecting CoxA16 types The probe of B sequences is preferably 5 '-AGCAAACACCGTATTGAACC-3 ' (SEQ ID NO：17)

Probe for detecting EV71 type A sequences is preferably 5 '-ATACTGCACAACGTCACCCACCGG-3 ' (SEQ ID NO：18).B sequences for detecting EV71 types are 5 '-TTCTGTCGCAAGTTCCAACCGCTATA-3 ' (SEQ ID NO：19).

It is 5-AACTCTGCAGCGGAACC-3 (SEQ ID for detecting the universal probe EV-B sequences of enterovirus EV NO：20).

Present invention additionally comprises above-mentioned primer sequence and the equivalent sequence of probe sequence, such as from the gene or position And comprising 12 in the primer or probe sequence, 13,14,15,16,17,18,19,20,21,22,23,24,25 or 26 it is continuous The primer or probe of nucleotide.

On the other hand, the present invention also provides for detecting, enterovirus Cox A 16 in sample, EV71, EV be universal and its group The detection kit of conjunction.The kit includes at least one nucleic acid as described above.

The kit of the present invention can include one or more primers or primer pair.

The kit of the present invention can include probe.The probe can be the probe of mark.For example, the probe is used Enzyme, radio isotope, chemiluminescent molecule, fluorescence etc. mark.Such as the probe can be with being marked with fluorescent quenching group Mark, the fluorescent quenching group mark for example, FAM, VIC, CY5 and ROX.

The kit of the present invention can be RT-PCR detection kit.

In one embodiment, kit of the invention is the bigeminy kit for detecting CoxA16 and EV71.Institute Kit is stated to preferably comprise by SEQ ID NO：6 and 7 composition primer pairs and by SEQ ID NO：The primer of 10 and 12 combinations It is right.In a further embodiment, the kit includes SEQ ID NO：16 and 18 probe.

In another embodiment, kit of the invention is for detecting CoxA16, EV71 and general enterovirus Three kits.The kit is preferably comprised by SEQ ID NO：8 and 9 composition primer pairs, by SEQ ID NO：12 Hes 13 combination primer pairs and by SEQ ID NO：The primer pair of 14 and 15 compositions.In a further embodiment, the reagent Box includes SEQ ID NO：17th, 19 and 20 probe.

The kit of the present invention is preferably real-time fluorescence quantitative RT-PCR detection reagent kit, its middle probe quenching group mark Note, such as 3 ' ends of the probe are marked with fluorescent quenching group, and the fluorescent quenching group is selected from BHQ1, TAMRA, preferably BHQ1；5 ' ends of the probe are marked with fluorescent reporter group, and the fluorescent reporter group is selected from FAM, VIC, CY5, ROX.

RT-PCR is generally well-known in the art.Its reaction condition is, for example,：

45 DEG C 25 minutes；Followed by：95 DEG C 3 minutes, 1 circulation；95 DEG C 5 seconds, 60 DEG C 45 seconds, 40 circulation.

Provided herein is the sample that can detect of kit be the brush,throat from enterovirus patient suspected, cloaca Swab, human faecal mass, tissue samples, serum or blood plasma, bleb liquid, cerebrospinal fluid or virus purification culture sample etc..

The testing principle of fluorescence RT-PCR kit is, using specific primer and specificity fluorescent probe, comprising anti- In the RT-PCR reaction buffers such as transcriptase, hot resistant DNA polymerase, deoxyribonucleoside triphosphate and magnesium ion, amplification is treated The enterovirus in sample is detected, the cyclic amplification of target nucleotide is realized by a variety of Commercial optical PCR amplification instruments, so that soon Speed, the delicately enterovirus in detection sample.

The invention further relates to the nucleic acid to prepare the application in being used to detect the kit of enterovirus infection, the examination Agent box is preferred for detecting CoxA16 types, enterovirns type 71 and/or general enterovirus.

The present invention also relates to the method for detection enterovirus infection, passes through the described method includes the nucleic acid using the present invention It whether there is enterovirus, such as CoxA16 types, enterovirns type 71 and/or general enterovirus in PCR detection biological samples.

Brief description of the drawings

Fig. 1-5 is the primer utilized for enterovirus Cox A 16 type A and B sequence/EV71 type A and B sequence/EV universal Pair and probe, by real-time fluorescence quantitative RT-PCR detect enterovirus positive simply connected sensitivity fluorescence RT-PCR expand Increase figure.

Fig. 6-9 be utilize for enterovirus Cox A 16 type A and B sequence/EV71 type A and B sequences primer pair and probe, The fluorescence RT-PCR that the bigeminy sensitivity and specificity of enterovirus positive are detected by real-time fluorescence quantitative RT-PCR expands Increase figure.

Figure 10-13 is the primer pair using enterovirus Cox A 16 type A and B sequence/EV71 type A and B sequence/EV universal The fluorescence of three sensitivity and specificity of enterovirus positive is detected with probe, by real-time fluorescence quantitative RT-PCR RT-PCR amplification figures.

Fig. 6-13 shows the fluorescence RT-PCR amplification of the positive sample using kit of the present invention detection in embodiment 3 Figure.

Fig. 1 is CoxA16-A simply connected sensitivity technique result figures.

Fig. 2 CoxA16-B simply connected sensitivity technique result figures.

Fig. 3 EV71-A simply connected sensitivity technique result figures.

Fig. 4 EV71-B simply connected sensitivity technique result figures.

The universal simply connected sensitivity technique result figures of Fig. 5 EV.

Fig. 6 CoxA16-A and EV71-A bigeminy sensitivity technique result figures.

Fig. 7 CoxA16-A and EV71-A bigeminy specific detection result figures.

Fig. 8 CoxA16-B and EV71-B bigeminy sensitivity technique result figures.

Fig. 9 CoxA16-B and EV71-B bigeminy specific detection result figures.

Figure 10 CoxA16-A, EV71-A and the universal three sensitivity techniques result figures of EV.

Figure 11 CoxA16-A, EV71-A and the universal three specific detections result figures of EV.

Figure 12 CoxA16-B, EV71-B and the universal three sensitivity techniques result figures of EV.

Figure 13 CoxA16-B, EV71-B and the universal three specific detections result figures of EV.

Embodiment

Illustrate the present invention referring to specific embodiment.Experimental method in following embodiments, unless otherwise specified, It is conventional method.Medicinal raw material and reagent material used etc., are commercially available purchase unless otherwise specified in following embodiments Product.

1 primer and probe of embodiment designs and the foundation and optimization of reaction system：

1. primer and probe designs：

By being compared respectively to all known CoxA16 types, EV71 types and other enterovirus gene orders point Analysis, selects no secondary structure and highly conserved section, different primers that polymerisation will not occur between visiting, for different intestines Road viral design specific primer and probe, primer length are generally 20 bases or so, and between primer and primer is interior without complementary sequence Row.Optimal primer, probe sequence combination are as follows：

The primer and probe of enterovirus Cox A 16 type A sequences：

Sense primer CoxA16A-F sequences are 5 '-CGGAGTGTTTCGCTCAGCAC-3 '

Anti-sense primer CoxA16A-R sequences are 5 '-CATTCAGGGGCCGGAGG-3 '

Probe CoxA16A-B sequences are FAM5 '-CTCATCGACCTGATCTACACGGGG-3 ' BHQ1.

The primer and probe of enterovirus Cox A 16 type B sequences：

Sense primer CoxA16B-F sequences are 5 '-AAGGATGAACAACTACATGCAGTTC-3 '

Anti-sense primer CoxA16B-R sequences are 5 '-TTACCTGTTCCTGGAGAGCCTCT-3 '

Probe CoxA16B-B sequences are FAM5 '-AGCAAACACCGTATTGAACC-3 ' MGB.

The primer and probe of enterovirus EV 71 type A sequences：

Sense primer EV71A-F sequences are 5 '-A AGTGATGCCACCCTAGTGATCAA-3 '

Anti-sense primer EV71A-R sequences are 5 '-GGGTAGGCTTACCACTGAGATTCA-3 '

Probe EV71A-B sequences are VIC5 '-ATACTGCACAACGTCACCCACCGG-3 '.

The primer and probe of enterovirus EV 71 type B sequences：

Sense primer EV71B-F sequences are 5 '-TGAAGTCATGTTTGGGAATGTGTC-3 '

Anti-sense primer EV71B-R sequences are 5 '-CGGTGTTTGCTCTTGAACTGC-3 '

Probe EV71B-B sequences are VIC5 '-TTCTGTCGCAAGTTCCAACCGCTATA-3 '.

Enterovirus universal primer and probe：

Sense primer EV-F sequences are 5-CCCCTGAATGCGGCTAATC-3

Anti-sense primer EV-R sequences are 5-GGAAACACGGACACCCAAAGTA-3 '

Probe EV-B sequences are CY5 5-AACTCTGCAGCGGAACC-3MGB.

2. the foundation and optimization of enterovirus real-time fluorescence RT-PCR reaction system：

Target region template obtains in the following manner：By the use of the enterovirus strain of inactivation as measuring samples, with phenol chloroform Extracting method extract virus gene genome nucleic acid, be stored in after packing -20 DEG C it is spare.

In the reaction system, enterovirus Cox A 16 type/EV71 types/EV is universal is drawn for the optimization of 2.1 primer concentrations Thing concentration is detected after making multiple proportions serial dilution from 0.1 μm of ol/L to 0.6 μm of ol/L respectively, passes through the analysis ratio of result of the test Compared with determining that the universal optimal primer final concentrations of CoxA16 types/EV71 types/EV are respectively 0.25 μm of ol/L, 0.25 μm of ol/L, 0.2 μ mol/L。

The optimization of 2.2 magnesium ion concentrations is on the premise of other conditions are constant in the reaction system, by the concentration of MgCl2 from 1.5mmol/L to 3.5mmol/L is incremented by with 0.5mmol/L, and selected 2.0mmol/L is tested as kit reaction by being repeated several times Magnesium ion concentration in system.

The optimization of 2.3Taq archaeal dna polymerases (Taq enzyme) dosage is by comparing the excellent of Taq enzyme dosage (in terms of unit Unit) Change experimental result, select dosages of the 3U as Taq enzyme in kit reaction system.

The optimization of 2.4 reverse transcriptase dosages is by comparing the Optimal Experimental knot of reverse transcriptase dosage (in terms of unit Unit) Fruit, selectes dosages of the 4U as reverse transcriptase in kit reaction system.

The optimization of 2.5dNTPs concentration is detected by using the dNTPs of various concentrations, is selected after comprehensive assessment Usage amounts of the 0.2mmol/L as dNTPs in kit reaction system.

The optimization of 2.6 concentration and probe concentrations in the reaction system, by the spy of enterovirus Cox A 16 type/EV71 types/universal EV Pin concentration is detected after making multiple proportions serial dilution from 0.05 μm of ol/L to 0.2 μm of ol/L respectively, passes through the analysis of result of the test Compare, determine the final concentration of 0.12 μm of ol/L of the universal optimal probes of CoxA16 types/EV71 types/EV, 0.12 μm of ol/L, 0.1 μ mol/L。

The foundation of reaction system is carried out using above-mentioned primer and probe, finally determines the fluorescence RT-PCR reaction system used For 25 μ l systems, required each component and respective concentration are shown in Table 1.

RT-PCR reaction systems after the optimization of table 1

Note：A. when fluorescence RT-PCR reaction volume is different, each reagent should be scaled.

B. the instrument used is different, should appropriately adjust response parameter.

3. the selection of instrument sense channel：When carrying out fluorescence RT-PCR reaction, reaction tube fluorescence in instrument is tackled The collection of signal is configured, and the fluorescence detection channel of selection is consistent with the fluorescent reporter group that probe is marked.It is specific to set Method is different because of instrument, should refer to instrument operation instructions.

The selection of 4.RT-PCR conditions is as follows：

45 DEG C of reverse transcriptions 25 minutes；Followed by：95 DEG C 3 minutes, 1 circulation；95 DEG C 10 seconds, 60 DEG C 45 seconds, 40 circulation.

Embodiment 2 detects the sensitivity experiment of CoxA16 types, EV71 types and the copy number of enterovirus

The present embodiment is used to examine CoxA16 types/EV71 type bigeminy kits and CoxA16 types, EV71 types and enterovirus The sensitivity of three kits.CoxA16 types/EV71 type bigeminy kit, which contains, is useful for detection CoxA16 type A sequences and EV71 types The primer and probe of A sequences, that is, contain：Comprising：By SEQ ID NO：6 and 7 combination primer pairs, by SEQ ID NO：10 and 11 The primer pair of composition, by SEQ ID NO：16 composition probes and by SEQ ID NO：The probe of 18 compositions.CoxA16 types, EV71 Type and three kit of enterovirus, which contain, is useful for drawing for detection CoxA16 type B sequences, EV71 type B sequences and general enterovirus Thing and probe, that is, contain：By SEQ ID NO：8 and 9 combination primer pairs, by SEQ ID NO：The primer pair of 12 and 13 compositions, By SEQ ID NO：14 and 15 composition primer pairs, by SEQ ID NO：17 composition probes, by SEQ ID NO：19 compositions Probe and by SEQ ID NO：The probe of 20 compositions.

CoxA16 types, EV71 types and the other intestines that concentration is provided by the Products in China calibrating of 106 copy/ml Road Strain, by 10 times of gradient dilutions to 105 copy/ml, 104 copy/ml, 103 copy/ml, 102 copy/ml, Using the reaction system and instrument, amplification condition of primer, probe and the foundation designed in embodiment 1, fluorescence RT-PCR is carried out Detection.

The result shows that in 103 copy/ml, CT values are 32, all other indexs also comply with testing requirements.Therefore, originally Invention passes through optimizational primer and probe, improves the sensitivity of detection, its sensitivity can reach 103 copy/ml.The result is shown in Fig. 1-5.

Embodiment 3 detects CoxA16 types, EV71 types and the specificity experiments of enterovirus

The primer and probe provided in embodiment 1 that the present embodiment is used to examine detects the specificity of related enterovirus, It also have detected three kit of the CoxA16 types/EV71 type bigeminy kits and CoxA16 types, EV71 types and enterovirus Specificity..

1. sample：

80 person-portion of sample is detected, is suffered from including recommending method to be determined as CoxA16 types through Shenzhen disease prevention and control center Person 20, EV71 types patient 24, other enteroviruses 16, are positive sample；Another 20 are negative sample.This 80 samples For brush,throat.Sample process：500 μ l PBS or physiological saline are added in the centrifuge tube equipped with swab, acutely vibration 35sec.Extrusion liquid moves on to 8000rpm in centrifuge tube and centrifuges 25sec as far as possible, takes supernatant spare.

Negative control：DEPC water；

2. test condition

Reagent：Real-time fluorescence quantitative RT-PCR detection reagent kit enteroviral rna extracting solution used, is Trizol Reagent total RNA extraction reagents (are purchased from Invitrogen).

Instrument：AB7500 fluorescent quantitation instruments, are provided by this laboratory.

3. the extraction of template ribonucleic acid

(1) centrifuge tube of the sterilized no RNase pollutions of 1.5ml is taken, performs mark.600 μ l enteron aisles disease is respectively added first Malicious RNA extracting solutions, are then respectively adding the detection sample and each 200 μ l of positive and negative control through pre-treatment accordingly numbered, inhale Beat and mix；200 μ l chloroforms are added, vibration mixes；Stand 3min, 12,000rpm centrifugation 10min；

(2) upper phase in each pipe is drawn respectively to be transferred in the centrifuge tube that new 1.5ml is polluted without RNase, is added The isopropanol of 400 μ l-20 DEG C precoolings, performs mark, overturns and mixes；Stand 6min, 12,000rpm centrifugation 10min；

(3) supernatant is gently removed, is inverted on blotting paper, is stained with dry liquids；700 μ l75% ethanol are added, overturn washing； 12,000rpm centrifuges 6min；Supernatant is gently removed, is inverted on blotting paper, is stained with dry liquids as far as possible；

(4) 4,000rpm centrifuge 10sec, are as far as possible blotted residual liquid with micro sample adding appliance, drying at room temperature 1-5min；

(5) 15 μ l DEPC water are added, flick mixings, RNA on dissolving tube wall, be stored in less than -18 DEG C it is spare.

4. detect program

Fluorescence RT-PCR reaction system is 25 μ l systems, and required each component and respective concentration are shown in Table 1.

It is detected in AB7500 fluorescent quantitation instruments.RT-PCR conditions are：45 DEG C of reverse transcriptions 25 minutes；Followed by：95 DEG C 3 minutes, 1 circulation；95 DEG C 10 seconds, 60 DEG C 45 seconds (collect fluorescence FAM, VIC, CY5), 40 circulations.

5. testing result

The testing result (recall rate) of 80 parts of sample real-time fluorescent RT-PCR detection reagent boxes see the table below 2.Wherein described two The fluorescence RT-PCR amplification figure of the positive sample of connection and three kits is shown in Fig. 6-13.

Table 2

Annotation："-" represents not to be measured.

" CoxA16-A " is represented using primer pair (the SEQ ID NO for being used to detect CoxA16A sequences：7) and probe 6 and (SEQ ID NO：16).

" CoxA16-B " is represented using primer pair (the SEQ ID NO for being used to detect CoxA16B sequences：9) and probe 8 and (SEQ ID NO：17).

" EV71-A " is represented using primer pair (the SEQ ID NO for being used to detect EV71A sequences：11) and probe (SEQ 10 and ID NO：18).

" EV71-B " is represented using primer pair (the SEQ ID NO for being used to detect EV71B sequences：13) and probe (SEQ 12 and ID NO：19).

" EV is general " represents to use primer pair (SEQ ID NO：15) and probe (SEQ ID NO 14 and：20).

Other enterovirus positives.

Inspection of the detection kit (fluorescence RT-PCR method) provided by the invention in Disease Control and Prevention Center's enterovirus positive Extracting rate：Enterovirus Cox A 16 type 20/20=100%；Enterovirus EV 71 type 24/24=100%；Other enteroviruses 16/ 16=100%；

Inspection of the detection kit (fluorescence RT-PCR method) provided by the invention in Disease Control and Prevention Center's enterovirus negative sample Extracting rate：20/20=100%；

Detection kit (fluorescence RT-PCR method) provided by the invention is in Disease Control and Prevention Center's enterovirus sample detection coincidence rate： (20+24+16)/80=100%.

The testing result of Disease Control and Prevention Center's enterovirus detection sample is shown：The positive mark of 20 parts of enterovirus Cox A 16 types This, in 24 parts of enterovirus EV 71 type positive samples and 16 parts of other enterovirus positive samples, detection examination provided by the invention Agent box (fluorescence RT-PCR method) detects that result is consistent with result above, coincidence rate 100%.Illustrate nucleic acid detection reagent of the present invention Box (fluorescence RT-PCR method) testing result is mutually closed with actual, as a result accurate credible, meets the requirement of clinical detection.

Advantages of the present invention：

(1) detection sensitivity of fluorescence RT-PCR kit provided by the invention illustrates its tool up to 1000 copy/ml There is good sensitivity.

(2) detection sample standard deviation of the primer and probe provided by the invention for not containing enterovirus is said without amplified signal It is bright its with good specificity.

(3) since the present invention is compared analysis to all known enterovirus sequences respectively, no secondary structure is selected And highly conserved section carries out the design of primer and probe, avoids the generation of false negative result.

(4) when using Fluorescence PCR assay as detection method, whole reaction carries out in the reaction tube of closing, keeps away Exempt from other nucleic acid detection methods such as PCR- electrophoresis etc. to be easily formed Aerosol Pollution and cause false positive results；Due to PCR Product is monitored in real time, and monitoring time is greatly saved, and has saved manpower and materials.

Claims

1. a kind of Nucleic acid combinations for being used to detect CoxA16 types, it is used to expand or detects from coxsackie virus A 16-type (CoxA16) and following sequence of nucleotide sequence is corresponded to：61-254 positions in GenBank accession number KC117318 sequences Put, and/or GenBank accession number gb | KF055245.1 | the 4365-4460 positions in sequence, wherein the nucleic acid is primer Or probe, wherein the nucleotide sequence is correspondingly SEQ ID NO:1 and/or 2 nucleotide sequence, the Nucleic acid combinations are SEQ ID NO:Primer and probe combination, and/or SEQ ID NO shown in 6-7 and 16:Primer and probe shown in 8-9 and 17 Combination.

2. the Nucleic acid combinations of claim 1, wherein the Nucleic acid combinations are SEQ ID NO:Primer and probe shown in 6-7 and 16 Combination.

3. the Nucleic acid combinations of claim 1, wherein the Nucleic acid combinations are SEQ ID NO:Primer and probe shown in 8-9 and 17 Combination.

4. the Nucleic acid combinations of claim 1, wherein the Nucleic acid combinations are SEQ ID NO:Primer and spy shown in 6-7 and 16 Pin and SEQ ID NO:The combination of primer and probe shown in 8-9 and 17.

5. kit for detecting enterovirus, for detecting CoxA16 types, the kit includes any one of claim 1-4's Nucleic acid combinations.

6. the kit of claim 5, the kit also includes the nucleic acid in following (1) and/or (2)：

(1) it is used for the Nucleic acid combinations for detecting EV71 types, it is used to expand or detects from enterovirns type 71 (EV71 types) simultaneously And correspond to following sequence of nucleotide sequence：5678-5783 positions in GenBank accession number FJ606449.1 sequences and/ Or GenBank accession number gb | KC436271.1 | the 4288-4430 positions in sequence, wherein the nucleic acid is primer or probe, The nucleotide sequence is correspondingly from SEQ ID NO:3 and/or 4 nucleotide sequence, the Nucleic acid combinations are SEQ ID NO:Primer shown in 10-11 and by SEQ ID NO:The probe, and/or SEQ ID NO of 18 nucleotide sequence composition: Primer shown in 12-13 and by SEQ ID NO:The probe of 19 nucleotide sequence composition,

(2) it is used to detect the universal Nucleic acid combinations of EV, it is used to expand or detects from enterovirus EV and correspond to GenBank accession number gb | KF312457.1 | the nucleotide sequence of the 442-566 positions in sequence, wherein the nucleic acid is primer Or probe, the nucleotides sequence are classified as SEQ ID NO:5 nucleotide sequence, the Nucleic acid combinations are SEQ ID NO:14 and 15 Shown primer and SEQ ID NO:Probe shown in 20.

7. the kit of claim 6, the kit includes SEQ ID NO:Primer shown in 10-11 and by SEQ ID NO: The probe, and/or SEQ ID NO of 18 nucleotide sequence composition:Primer shown in 12-13 and by SEQ ID NO:19 nucleosides The probe of acid sequence composition.

8. the kit of claim 6, it includes SEQ ID NO:Primer and SEQ ID NO shown in 14 and 15:Shown in 20 Probe.

9. the kit of claim 6, it includes：By SEQ ID NO:6 and 7 composition primer pairs, by SEQ ID NO:10 Hes 11 composition primer pairs, by SEQ ID NO:16 composition probes and by SEQ ID NO:The probe of 18 compositions.

10. the kit of claim 6, it includes：By SEQ ID NO:8 and 9 composition primer pairs, by SEQ ID NO:12 Hes 13 composition primer pairs, by SEQ ID NO:14 and 15 composition primer pairs, by SEQ ID NO:17 composition probes, by SEQ ID NO:19 composition probes and by SEQ ID NO:The probe of 20 compositions.

11. the kit of any one of claim 5-10, it is RT-PCR detection kit.

12. the kit of claim 11, it is real-time fluorescence quantitative RT-PCR detection reagent kit.

13. the kit of claim 12, it contains probe, and the probe is with mark.

14. the kit of claim 13, wherein the probe enzyme, radio isotope, chemiluminescent molecule or fluorescence mark Note.

15. the kit of claim 13, wherein the mark fluorescent quenching group such as described probe fluorescence marks.

16. the kit of claim 15, wherein the probe is marked with BHQ1, TAMRA, FAM, VIC, CY5 and/or ROX.

17. kit according to claim 15, wherein 3 ' ends of the probe are marked with fluorescent quenching group, the spy 5 ' ends of pin are marked with fluorescent reporter group.

18. kit according to claim 17, wherein the fluorescent quenching group is BHQ1 or TAMRA；The fluorescence Reporter group is FAM, VIC, CY5 or ROX.

19. the Nucleic acid combinations of any one of claim 1-4 answering in the kit for being used for detecting the infection of CoxA16 types is prepared With.