CN104569388B - A kind of preparation method of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide - Google Patents
A kind of preparation method of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide Download PDFInfo
- Publication number
- CN104569388B CN104569388B CN201510016199.1A CN201510016199A CN104569388B CN 104569388 B CN104569388 B CN 104569388B CN 201510016199 A CN201510016199 A CN 201510016199A CN 104569388 B CN104569388 B CN 104569388B
- Authority
- CN
- China
- Prior art keywords
- cell
- pp65nls
- antigenemia
- positive control
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
- G01N33/56994—Herpetoviridae, e.g. cytomegalovirus, Epstein-Barr virus
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Virology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of preparation method of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide.Do you relate to stable transfection HCMV? the cell line of pp65 encoding gene builds, and for HCMV? pp65 antigenemia immuno-fluorescence assay kit.Does described method comprise employing gene engineering method to HCMV? TR strain pp65 encoding gene is transformed, and adds three nuclear localization signals at its 3 ' end, improved pp65 encoding gene is connected to eukaryotic expression vector pcDNA3.1 A, recombinant expression carrier is proceeded to HEK293(human embryo kidney (HEK)) cell and screen stable transfected cells, by this stable transfected cells be mixed for by a certain percentage preparing positive control slide for transfected HEK 293.
Description
Technical field
The present invention relates to technique for gene engineering, diagnostic reagent field, particularly relate to a kind of preparation method of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide.
Background technology
Human cytomegalovirus (humancytomegalovirus, HCMV) belong to nerpes vinrus hominis β subfamily virus, the infection in crowd is very general, in worldwide distribution, seroepidemiological survey shows, 40% ~ 100% adult HCMV antibody positive.Research shows, HCMV is that human congenital infects one of modal pathogen, and the HCMV primary infection harm in pregnancy period is comparatively large, and 2/3 congenital infection is caused by pregnancy period primary infection.In congenital infection, the infant of 90% does not show clinical symptoms, about has 5% ~ 10% infected pregnant woman can cause the consequences such as miscarriage, stillborn foetus, fetal anomaly, hypoevolutism and Delayed onset central nervous system deficit.In addition, HCMV Active infection is also one of organ transplant failure and AIDS patient's scabies secondary infection main causes of death.
Be badly in need of the method diagnosing and monitor HCMV Infection Status rapidly and accurately clinically at present, particularly outstanding in some specific crowds, the donor in such as organ transfer operation and the selection of acceptor; The examination of the women of child-bearing age and the crowd accepting immunosuppressant treatment etc. or monitoring.HCMV usually in subclinical infection, though virus replication is suppressed, has intermittent toxin expelling phenomenon to exist in immunity normal population.And in HCMV Active infection, viral massive duplication, can at blood, urine, detects live virus in the body fluid such as cerebrospinal fluid.Virus purification is one of most important index of diagnosis HCMV Active infection.But due to virus self copy feature, virus purification is longer for experimental period, about needs 2 ~ 4 time-of-weeks.And the complex operation of virus purification own, to experiment condition, equipment and technology, all there is higher requirement, be not suitable for the clinical timely monitoring to this virus and diagnosis.The existing ELISA reagent for detecting HCMV specific IgM antibodies in market reduces because of immunosuppressed patient antibody response ability or antibody postpones to occur, often causes recall rate to reduce, occur false negative.
Antigenemia refers to detect the specific antigen of pathogenic microorganism in blood, and conventional method has immunofluorescence technique and sends out method based on the chemiluminescence of magnetic bead.HCMVpp65 antigenemia refers to HCMVpp65 antigen be detected in peripheral blood lymphocytes or neutrophil leucocyte.The method within 1988, is set up by WIMVanderBIJ etc., CMV-10 and CMV-11 two strain monoclonal antibody is also prepared by this laboratory.HCMVpp65 is a kind of envelope protein, and in virus, content is higher, accounts for 15% of complete virion, up to 90% in dense body.The envelope protein pp65 that dense body wraps up primarily of peplos is formed.Having protein synthesis inhibitor as under cycloheximide exists, after peplos and cell membrane fusion, after virus this albumen self-contained enters cell, namely the method for available immunofluorescence detects HCMVpp65 antigen.There are some researches show, detect that HCMV antigen and sexy dye of viral activity have good consistance in blood.Therefore HCMVpp65 antigenemia has become a kind of and has detected HCMV Active infection new " goldstandard ".At present, the global " CMVBrite only having Dutch IQProducts to produce
tMturboKit " obtain the approval of U.S. FDA, for clinical detection, but also do not enter China market.
Two large technological cores of HCMVpp65 antigenemia immuno-fluorescence assay kit are preparation pp65 monoclonal antibody and positive reference substance (slide).Because the method preparing pp65 positive reference substance (slide) has no report, the present invention is intended to solve this core technology difficult problem.Have and found by the research of EGFP tracer technique, the completely different phenomenon of this gene Subcellular Localization when its Subcellular Localization during independent transfection pp65 gene and virus infections: during transfection, pp65 is mainly positioned at tenuigenin separately, and when HCMV infects, pp65 is mainly positioned at nucleus.This adopts the cell of the independent stable transfection pp65 of technique for gene engineering to be not suitable for doing positive reference substance (slide) with regard to causing.Therefore we transform pp65 encoding gene, add three nuclear localization signals, and before nuclear localization signal, add that a proline (Pro) is used for stopping its αhelix that may exist by three-wheel PCR at its 3 ' end.Find when improved pp65 encoding gene is imported eukaryotic, it is positioned nucleus completely.Positive product (slide) identification made of this improved cell line is higher, meets actual conditions during virus infections.In addition, HCMV type strain AD169 is in the Long Term Passages process of laboratory, and its genome can morph.By after the comparison to AD169 strain pp65 encoding gene and street strain pp65 encoding gene, we find, there is the base mutation (replacement) of many places, these sudden changes are distributed in whole coded sequence.If this sudden change occurs in antibody in conjunction with epi-position, the corresponding specific antibody prepared will be caused can not to react to each other with it.Therefore, we adopt clinical separation strain (TR strain) as transformation masterplate, avoid antigen that gene mutation causes and antibody can not in conjunction with result, reliability when ensure that for detecting and resolution.
Summary of the invention
The object of the invention is to the blockade of deficiency for existing detection technique and foreign technology data, research and development construct a kind of cell line of stably express HCMVpp65 antigen, as the positive reference substance (slide) of HCMVpp65 antigenemia immuno-fluorescence assay kit voluntarily.
The object of the invention is to be realized by following scheme:
A kind of preparation method of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide, it is characterized in that: the pp65 encoding gene of HCMVTR strain is transformed, built up to eukaryotic expression vector pcDNA3.1, transfection is to HEK293 cell again, and screens stable transfected cells strain for making pp65 antigenemia detection kit positive control slide.
The preparation method of described a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide, is characterized in that: realize by the following method the pp65 encoding gene transformation of HCMVTR strain:
(1) first with HCMVTR strain pp65 gene order for masterplate, with pp65NLS-F and pp65NLS-R1 for primer carries out first round PCR;
(2) again with first round PCR primer for template takes turns PCR with pp65NLS-F and pp65NLS-R2 for primer carries out second;
(3) after with second take turns PCR primer for template with pp65NLS-F and pp65NLS-R3 for primer carries out third round PCR;
(4) third round PCR primer is connected to eukaryotic expression vector pcDNA3.1 A by Kpn I and Xho I restriction enzyme site;
Three-wheel PCR circulation primer is as follows:
pp65NLS-F：CTCGAGATGGAGTCGCGCGGT
pp65NLS-R1：TGGATCTACCTTTCTCTTCTTTTTTGGATCACCTCGGTGCTTTTTG
pp65NLS-R2：TGGATCTACCTTTCTCTTCTTTTTTGGATCTGGATCTACCTTTC
pp65NLS-R3：GGTACCTCTAGATCCGGTGGATCCTACCTTTCTCTTTGGATCTACCTTTCTC。
The preparation method of described a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide, is characterized in that: comprise the following steps:
The transformation of A, HCMVpp65 encoding gene
--------------------------------------------------------
(1) according to the HCMVTR strain pp65 coding gene sequence announced in Genebank, design three-wheel PCR primer, the 3 ' end being circulated in pp65 encoding gene by three-wheel PCR adds three sections of nuclear localization signals and a proline;
Three-wheel PCR circulation primer is as follows:
pp65NLS-F：CTCGAGATGGAGTCGCGCGGT
pp65NLS-R1：TGGATCTACCTTTCTCTTCTTTTTTGGATCACCTCGGTGCTTTTTG
pp65NLS-R2：TGGATCTACCTTTCTCTTCTTTTTTGGATCTGGATCTACCTTTC
pp65NLS-R3：GGTACCTCTAGATCCGGTGGATCCTACCTTTCTCTTTGGATCTACCTTTCTC
Three-wheel PCR circulation refers to: first with HCMVTR strain DNA for masterplate, with pp65NLS-F and pp65NLS-R1 for primer carries out first round PCR.Again with first round PCR primer for template takes turns PCR with pp65NLS-F and pp65NLS-R2 for primer carries out second.Finally with second take turns PCR primer for template with pp65NLS-F and pp65NLS-R3 for primer carries out third round PCR;
(2) third round PCR primer is connected to eukaryotic expression vector pcDNA3.1 A by Kpn I and Xho I restriction enzyme site, the recombinant vector called after pcDNA3.1A-pp65NLS of structure;
The structure of B, pp65 stable cell strain
(1) transfection
Day before transfection is by HEK293 cell 1 X 10
5individual/ml is laid in six orifice plates, every hole 2ml; In eppendorf pipe, 150 μ lDMEM nutrient solutions are added during transfection, add recombinant plasmid 2 μ g to mix, add Promega company transfection reagent FuGENEHDTransfectionReagent4 μ l again to mix, room temperature adds in a hole of six orifice plates after placing 15min, rock six orifice plates gently, make that compound is dispersed to come, then as 37 DEG C, 5%CO
248h is cultivated in incubator;
(2) screen
After the cultivation of step (1) terminates, discard nutrient solution in six orifice plates, PBS washs 2 times, change the DMEM complete medium containing G-418400ng/ml into, old nutrient culture media and dead cell is discarded every 3 days, the DMEM complete medium containing G-418400ng/ml renewed, continues to carry out said medicine screening and culturing 2-3 week until significantly cell colony is formed;
(3) cultivation is expanded
Cell colony in six orifice plates is digested, transfers to 25cm
2tissue Culture Flask in, continue to use and cultivate containing the DMEM complete medium of G-418400ng/ml, after cell covers with, be passaged to more large-area Tissue Culture Flask, reduce G4-18 concentration to 200ng/ml simultaneously;
(4) cell cryopreservation
Expand frozen a quantity of seeds cell after cultivating, the cell namely obtaining stable transfection is for subsequent use;
The qualification of C, stable transfected cells strain
(1) immunofluorescence technique qualification
Be laid on by the cell of stable transfection in six orifice plates, after it covers with, first wash 2 times with PBS, 4% paraformaldehyde fixes 15min, and 1% song draws logical 37 DEG C to penetrate 15min, and 20% calf serum closes 30min; Primary antibodie is that abcam company pp65 monoclonal antibody 1:20 dilutes, and hatch 2h for 37 DEG C, PBS washs three times, each 5min; Two resist for Life company AlexaFluor488conjugated sheep anti-mouse igg 1:1000 doubly dilutes, incubated at room 30min, adopt DAPI lining dye simultaneously;
(2) Westernblot qualification
The cell of stable transfection is laid in six orifice plates, after it covers with, first washs 2 times with PBS, RIPA lysate 150 μ l containing 1mMPMSF is added dropwise to a hole of six orifice plates, rock six orifice plates, make protein lysate uniform fold cell, cracking 30min on ice, period rocks six orifice plates once every 5min, make protein lysate uniform fold cell, collect lysate in eppendorf pipe, add isopyknic 2 X SDS-PAGE albumen sample-loading buffer mixings, 5min is boiled in boiling water, obtain the protein sample for preparing with 15% SDS-PAGE carry out electrophoretic separation, then be transferred on pvdf membrane, after skimmed milk power with 5% is closed, primary antibodie is that abcam company pp65 mono-gram of antibody 1:1000 dilutes, 4 DEG C of overnight incubation, TPST washs three times, each 5min, two resist the sheep anti-mouse igg 1:5000 marked for Zhong Shan Golden Bridge HRP to dilute, incubated at room 1h, last TPST washs three times, each 5min, ECL method exposes,
The preparation of D, positive slide
Prepare two bottles of cells, one bottle is stable transfection pp65, and one bottle be normal HEK293 cell; After the cell dissociation of stable transfection, and resuspended with PBS, regulate cell concentration to be 5000/ml after cell count; By also resuspended with PBS after normal HEK293 cell dissociation, cell concentration after cell count, is regulated to be 5 X 10
7individual/ml; The cell getting 1ml stable transfection mixes with 4ml normal cell, the diameter that slide scribbles hydrophobic material formation is about even spread 50 μ l cell mixing in the aperture of 1cm, under slide is placed in blower fan, moisture evaporates the paraformaldehyde that 100 μ l4% are added in every hole when dry, fixing 15min, be stored in-80 DEG C after drying, this slide is the positive slide of HCMVpp65 antigenemia.
The preparation method of described a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide, is characterized in that: described in a kind of claim 2, improved HCMVpp65 amino acid sequence is as shown in SEQNo.1.
The preparation method of described a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide, is characterized in that: described improved HCMVpp65 nucleotide coding sequence is as shown in SEQNo.2.
The preparation method of described a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide, is characterized in that: HCMVpp65 antigenemia inspection immunofluorescence technique test agent box positive control slide pp65 used positive cell is the improved HCMVpp65 carrier for expression of eukaryon of the described expression of transfection.
The preparation method of described a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide, is characterized in that: the Genebank number of logging in of described HCMVTR strain pp65 gene order is: KJ743149.
Beneficial effect: positive cell of the present invention is uniformly dispersed, bright, bright, high to comparison;
Two large technological cores of HCMVpp65 antigenemia immuno-fluorescence assay kit are preparation pp65 monoclonal antibody and positive reference substance (slide).We transform pp65 encoding gene, add three nuclear localization signals, and before nuclear localization signal, add that a proline (Pro) is used for stopping its αhelix that may exist by three-wheel PCR at its 3 ' end.Find when improved pp65 encoding gene is imported eukaryotic, it is positioned nucleus completely.Positive product (slide) identification made of this improved cell line is higher, meets actual conditions during virus infections.In addition, HCMV type strain AD169 is in the Long Term Passages process of laboratory, and its genome can morph.By after the comparison to AD169 strain pp65 encoding gene and street strain pp65 encoding gene, we find, there is the base mutation (replacement) of many places, these sudden changes are distributed in whole coded sequence.If this sudden change occurs in antibody in conjunction with epi-position, the corresponding specific antibody prepared will be caused can not to react to each other with it.Therefore, we adopt clinical separation strain (TR strain) as transformation masterplate, avoid antigen that gene mutation causes and antibody can not in conjunction with result, reliability when ensure that for detecting and resolution.
Accompanying drawing explanation
Fig. 1 is for carry out transformation result by PCR method to HCMVTR strain pp65 encoding gene, and wherein swimming lane 1 is first round PCR result, and swimming lane 2 is second take turns PCR result, and swimming lane 3 is third round PCR result;
Fig. 2 is that improved pp65 encoding gene is connected to eukaryotic expression vector pcDNA3.1 A enzyme and cuts result, wherein swimming lane 1 for enzyme cut before result, swimming lane 2 is Xho I single endonuclease digestion result, and swimming lane 3 is Kpn I single endonuclease digestion result, and swimming lane 4 is Xho I and Kpn I double digestion result;
Fig. 3 is that improved HCMVpp65 encoding gene is connected to eukaryotic expression vector pcDNA3.1 A recombinant plasmid sequencing result;
Fig. 4 is the HEK293 cellular immunofluorescence qualification result of pp65 encoding gene after transfection transformation, wherein A is the HEK293 cell of pp65 encoding gene after transfection transformation, visible its expresses destination protein, and the pp65 monoclonal antibody identification that can become commercialized, B is normal HEK293 cell, does not express destination protein;
Fig. 5 is the HEK293 cell Westernblot qualification result of pp65 encoding gene after transfection transformation.The wherein HEK293 cell of pp65 encoding gene after swimming lane 1 transformation that has been transfection, it expresses destination protein as seen, and the pp65 monoclonal antibody identification that can become commercialized, and stripe size is consistent with prediction.Swimming lane 2 is normal HEK293 cell, does not express destination protein;
Fig. 6 is that the present invention prepares the real work effect of the positive slide of pp65 antigenemia and the contrast of external certain company pp65 antigenemia positive control slide.Wherein A is positive control slide prepared by the present invention, and B is external certain company pp65 antigenemia positive control slide.
Embodiment
The transformation of 1.HCMVpp65 encoding gene
(1) the present inventor is according to the HCMVTR strain pp65 coding gene sequence announced in Genebank (this sequence classify as the inventor of the number of logging in: KJ743149 logged in), design three-wheel PCR primer, the 3 ' end being circulated in pp65 encoding gene by three-wheel PCR adds three sections of nuclear localization signals and a proline.Three-wheel PCR circulation primer is as follows:
pp65NLS-F：CTCGAGATGGAGTCGCGCGGT
pp65NLS-R1：TGGATCTACCTTTCTCTTCTTTTTTGGATCACCTCGGTGCTTTTTG
pp65NLS-R2：TGGATCTACCTTTCTCTTCTTTTTTGGATCTGGATCTACCTTTC
pp65NLS-R3：GGTACCTCTAGATCCGGTGGATCCTACCTTTCTCTTTGGATCTACCTTTCTC
First with HCMVTR strain DNA for masterplate, with pp65NLS-F and pp65NLS-R1 for primer carries out first round PCR.Again with first round PCR primer for template takes turns PCR with pp65NLS-F and pp65NLS-R2 for primer carries out second.Finally with second take turns PCR primer for template with pp65NLS-F and pp65NLS-R3 for primer carries out third round PCR.
(2) third round PCR primer is connected to eukaryotic expression vector pcDNA3.1 A by Kpn I and Xho I restriction enzyme site.The recombinant vector called after pcDNA3.1A-pp65NLS built.
2.pp65 the structure of stable cell strain
(1) transfection
Day before transfection HEK293 cell 1 X 10
5/ ml is laid in six orifice plates, every hole 2ml.In eppendorf pipe, add 150 μ lDMEM nutrient solutions during transfection, add recombinant plasmid 2 μ g and mix, then add Promega company transfection reagent FuGENEHDTransfectionReagent4 μ l and mix.Room temperature adds in a hole of six orifice plates after placing 15min, and rock six orifice plates gently, being that compound is dispersed comes.
Then as 37 DEG C, 5%CO
248h is cultivated in incubator.
(2) screen
After transfection, 48h discards nutrient solution in six orifice plates, and PBS washs 2 times, changes the DMEM complete medium containing G-418400ng/ml into.Old nutrient culture media and dead cell is discarded, the DMEM complete medium containing G-418400ng/ml renewed every 3 days.Drug screening 2-3 week is until significantly cell colony formation.
(3) cultivation is expanded
Cell colony in six orifice plates is digested, transfers to 25cm
2tissue Culture Flask in, continue to use and cultivate containing the DMEM complete medium of G-418400ng/ml.After cell is filled, is passaged to more large-area Tissue Culture Flask, reduces G4-18 concentration to 200ng/ml simultaneously.
(4) cell cryopreservation
Expand frozen a quantity of seeds cell after cultivating.
3. the qualification of stable transfected cells strain
(1) immunofluorescence technique qualification
Be laid on by the cell of stable transfection in six orifice plates, after it covers with, first wash 2 times with PBS, 4% paraformaldehyde fixes 15min, and 1% song draws logical 37 DEG C to penetrate 15min, and 20% calf serum closes 30min.Primary antibodie is that abcam company (ab49214) pp65 monoclonal antibody 1:20 dilutes, and hatches 2h for 37 DEG C.PBS washs three times, each 5min.Two resist for Life company AlexaFluor488conjugated sheep anti-mouse igg 1:1000 doubly dilutes, incubated at room 30min.Adopt DAPI and Evans blue lining dye simultaneously.Result, as Figure of description 4, can see cellular expression pp65 albumen, is apple-green fluorescence signal under fluorescent microscope.And pp65 Subcellular Localization is in nucleus.
(2) Westernblot qualification
The cell of stable transfection is laid in six orifice plates, after it covers with, first washs 2 times with PBS.RIPA lysate 150 μ l containing 1mMPMSF is added dropwise to a hole of six orifice plates, rock six orifice plates, make protein lysate uniform fold cell, on ice cracking 30min, period rocks six orifice plates once every 5min, makes protein lysate uniform fold cell.Collect lysate in eppendorf pipe, add isopyknic 2 X SDS-PAGE albumen sample-loading buffer mixings, in boiling water, boil 5min.The protein sample the prepared SDS-PAGE of 15% carries out electrophoretic separation, is then transferred on pvdf membrane.After the skimmed milk power of 5% is closed, primary antibodie is that abcam company (ab49214) pp65 monoclonal antibody 1:1000 dilutes, 4 DEG C of overnight incubation.TPST washs three times, each 5min.Two resist the sheep anti-mouse igg 1:5000 marked for middle mountain gold bridge HRP to dilute, incubated at room 1h.Last TPST washs three times, and each 5min, ECL method exposes.Result is as Figure of description 5, and the cell line of visible stable transfection pcDNA3.1A-pp65NLS plasmid expresses pp65 albumen, and its molecular size range is about 72KD, and normal HEK293 cell does not express pp65 albumen.
4. the preparation of positive slide
Prepare two bottles of cells, one bottle is stable transfection pp65, and one bottle be normal HEK293 cell.After the cell dissociation of stable transfection, and resuspended with PBS, regulate cell concentration to be 5000/ml after cell count.By also resuspended with PBS after normal HEK293 cell dissociation, cell concentration after cell count, is regulated to be 5 X 10
7individual/ml.The cell getting 1ml stable transfection mixes with 4ml normal cell, the diameter that slide scribbles hydrophobic material formation is about even spread 50 μ l cell mixing in the aperture of 1cm, under slide is placed in blower fan, moisture evaporates the paraformaldehyde that 100 μ l4% are added in every hole when dry, fixing 15min.-80 DEG C are stored in after drying.This slide is the positive slide of HCMVpp65 antigenemia.
Fig. 1 is for carry out transformation result by PCR method to HCMVTR strain pp65 encoding gene, and wherein swimming lane 1 is first round PCR result, and swimming lane 2 is second take turns PCR result, and swimming lane 3 is third round PCR result;
Fig. 2 is that improved pp65 encoding gene is connected to eukaryotic expression vector pcDNA3.1 A enzyme and cuts result, wherein swimming lane 1 for enzyme cut before result, swimming lane 2 is Xho I single endonuclease digestion result, and swimming lane 3 is Kpn I single endonuclease digestion result, and swimming lane 4 is Xho I and Kpn I double digestion result;
Fig. 3 is that improved HCMVpp65 encoding gene is connected to eukaryotic expression vector pcDNA3.1 A recombinant plasmid sequencing result;
Fig. 4 is the HEK293 cellular immunofluorescence qualification result of pp65 encoding gene after transfection transformation, wherein A is the HEK293 cell of pp65 encoding gene after transfection transformation, visible its expresses destination protein, and the pp65 monoclonal antibody identification that can become commercialized, B is normal HEK293 cell, does not express destination protein;
Fig. 5 is the HEK293 cell Westernblot qualification result of pp65 encoding gene after transfection transformation.The wherein HEK293 cell of pp65 encoding gene after swimming lane 1 transformation that has been transfection, it expresses destination protein as seen, and the pp65 monoclonal antibody identification that can become commercialized, and stripe size is consistent with prediction.Swimming lane 2 is normal HEK293 cell, does not express destination protein;
Fig. 6 is that the present invention prepares the real work effect of the positive slide of pp65 antigenemia and the contrast of external certain company pp65 antigenemia positive control slide.Wherein A is positive control slide prepared by the present invention, and B is external certain company pp65 antigenemia positive control slide.
The positive slide of HCMVpp65 antigenemia prepared by the present embodiment contrasts slide each ten with Dutch IQ company pp65 antigenemia detection kit is positives, and for often opening, the comparison of item results such as slide total cellular score, positive cell number, smear area are as follows:
The amino acid sequence (SEQNo.1) of improved HCMVpp65 described in the present invention:
MESRGRRCPEMISVLGPISGHVLKAVFSRGDTPVLPHETRLLQTGIHVRVSQPSLILVSQYTPDSTPCHRGDNQLQVQHTYFTGSEVENVSVNVHNPTGRSICPSQEPMSIYVYALPLKMLNIPSINVHHYPSAAERKHRHLPVADAVIHASGKQMWQARLTVSGLAWTRQQNQWKEPDVYYTSAFVFPTKDVALRHVVCAHELVCSMENTRATKMQVIGDQYVKVYLESFCEDVPSGKLFMHVTLGSDVEEDLTMTRNPQPFMRPHERNGFTVLCPKNMIIKPGKISHIMLDVAFTSHEHFGLLCPKSIPGLSISGNLLMNGQQIFLEVQAIRETVELRQYDPVAALFFFDIDLLLQRGPQYSEHPTFTSQYRIQGKLEYRHTWDRHDEGAAQGDDDVWTSGSDSDEELVTTERKTPRVTGGGAMAGASTSAGRKRKSASSATACTSGVMTRGRLKAESTVAPEEDTDEDSDNEIHNPAVFTWPPWQAGILARNLVPMVATVQGQNLKYQEFFWDANDIYRIFAELEGVWQPAAQPKRRRHRQDALPGPCIASTPKKHRGDPKKKRKVDPKKKRKVDPKKKRKVGSTGSR
HCMVpp65 coded sequence (SEQNo.2) after transformation described in the present invention:
ATGGAGTCGCGCGGTCGCCGTTGTCCCGAAATGATATCCGTACTGGGTCCCATTTCGGGGCACGTGCTGAAAGCCGTGTTTAGTCGCGGCGATACGCCGGTGCTGCCGCACGAGACGCGACTCCTGCAGACGGGTATCCACGTACGCGTGAGCCAGCCCTCGCTGATCTTGGTATCGCAGTACACGCCCGACTCGACGCCATGCCACCGCGGCGACAATCAGCTGCAGGTGCAGCACACGTACTTTACGGGCAGCGAGGTGGAGAACGTGTCGGTCAACGTGCACAACCCCACGGGCCGAAGCATCTGCCCCAGCCAGGAGCCCATGTCGATCTATGTGTACGCGCTGCCGCTCAAGATGCTGAACATCCCCAGCATCAACGTGCACCACTACCCGTCGGCGGCCGAGCGCAAACACCGACACCTGCCCGTAGCTGACGCTGTGATTCACGCGTCGGGCAAGCAGATGTGGCAGGCGCGTCTCACGGTCTCGGGACTGGCCTGGACGCGTCAGCAGAACCAGTGGAAAGAGCCCGACGTCTACTACACGTCAGCGTTCGTGTTTCCCACCAAGGACGTGGCACTGCGGCACGTGGTGTGCGCGCACGAGCTGGTTTGCTCCATGGAGAACACGCGCGCAACCAAGATGCAGGTGATAGGTGACCAGTACGTCAAGGTGTACCTGGAGTCCTTCTGCGAGGACGTGCCCTCCGGCAAGCTCTTTATGCACGTCACGCTGGGCTCTGACGTGGAAGAGGACCTGACGATGACCCGCAACCCGCAACCCTTCATGCGCCCCCACGAGCGCAACGGCTTTACGGTGTTGTGTCCCAAAAATATGATAATCAAACCGGGCAAGATCTCGCACATCATGCTGGATGTGGCTTTTACCTCACACGAGCATTTTGGGCTGCTGTGTCCCAAGAGCATCCCGGGCCTGAGCATCTCAGGTAACCTGTTGATGAACGGGCAGCAGATCTTCCTGGAGGTACAAGCCATACGCGAGACCGTGGAACTGCGTCAGTACGATCCCGTGGCTGCGCTCTTCTTTTTCGATATCGACTTGCTGCTGCAGCGCGGGCCTCAGTACAGCGAGCACCCCACCTTCACCAGCCAGTATCGCATCCAGGGCAAGCTTGAGTACCGACACACCTGGGACCGGCACGACGAGGGTGCCGCCCAGGGCGACGACGACGTCTGGACCAGCGGATCGGACTCCGACGAAGAACTCGTAACCACCGAGCGCAAGACGCCCCGCGTCACCGGCGGCGGCGCCATGGCGGGCGCCTCCACTTCCGCGGGCCGCAAACGCAAATCAGCATCCTCGGCGACGGCGTGCACGTCGGGCGTTATGACACGCGGCCGCCTTAAGGCCGAGTCCACCGTCGCGCCCGAAGAGGACACCGACGAGGATTCCGACAACGAAATCCACAATCCGGCCGTGTTCACCTGGCCGCCCTGGCAGGCCGGCATCCTGGCCCGCAACCTGGTGCCCATGGTGGCTACGGTTCAGGGTCAGAATCTGAAGTACCAGGAATTCTTCTGGGACGCCAACGACATCTACCGCATCTTCGCCGAATTGGAAGGCGTATGGCAGCCCGCTGCGCAACCCAAACGTCGCCGCCACCGGCAAGACGCCTTGCCCGGGCCATGCATCGCCTCGACGCCCAAAAAGCACCGAGGTGATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAAAGGTAGGATCCACCGGATCTAGA
Claims (7)
1. the preparation method of a Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide, it is characterized in that: the pp65 encoding gene of HCMVTR strain is added nuclear localization signal sequence, builds up to eukaryotic expression vector pcDNA3.1, transfection is to HEK293 cell again, and screens stable transfected cells strain for making pp65 antigenemia detection kit positive control slide.
2. the preparation method of a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide according to claim 1, is characterized in that: realize by the following method the pp65 encoding gene transformation of HCMVTR strain:
(1) first with HCMVTR strain pp65 gene order for masterplate, with pp65NLS-F and pp65NLS-R1 for primer carries out first round PCR;
(2) again with first round PCR primer for template takes turns PCR with pp65NLS-F and pp65NLS-R2 for primer carries out second;
(3) after with second take turns PCR primer for template with pp65NLS-F and pp65NLS-R3 for primer carries out third round PCR;
(4) third round PCR primer is passed through
kpn Iwith
xho Irestriction enzyme site is connected to eukaryotic expression vector pcDNA3.1 A;
Three-wheel PCR circulation primer is as follows:
pp65NLS-F：CTCGAGATGGAGTCGCGCGGT
pp65NLS-R1：TGGATCTACCTTTCTCTTCTTTTTTGGATCACCTCGGTGCTTTTTG
pp65NLS-R2：TGGATCTACCTTTCTCTTCTTTTTTGGATCTGGATCTACCTTTCpp65NLS-R3：GGTACCTCTAGATCCGGTGGATCCTACCTTTCTCTTTGGATCTACCTTTCTC。
3. the preparation method of a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide according to claim 1, is characterized in that: comprise the following steps:
The transformation of A, HCMVpp65 encoding gene
(1) according to the HCMVTR strain pp65 coding gene sequence announced in Genebank, design three-wheel PCR primer, the 3 ' end being circulated in pp65 encoding gene by three-wheel PCR adds three sections of nuclear localization signals and a proline;
Three-wheel PCR circulation primer is as follows:
pp65NLS-F：CTCGAGATGGAGTCGCGCGGT
pp65NLS-R1：TGGATCTACCTTTCTCTTCTTTTTTGGATCACCTCGGTGCTTTTTG
pp65NLS-R2：TGGATCTACCTTTCTCTTCTTTTTTGGATCTGGATCTACCTTTCpp65NLS-R3：GGTACCTCTAGATCCGGTGGATCCTACCTTTCTCTTTGGATCTACCTTTCTC
Three-wheel PCR circulation refers to: first with HCMVTR strain DNA for masterplate, with pp65NLS-F and pp65NLS-R1 for primer carries out first round PCR;
Again with first round PCR primer for template takes turns PCR with pp65NLS-F and pp65NLS-R2 for primer carries out second;
Finally with second take turns PCR primer for template with pp65NLS-F and pp65NLS-R3 for primer carries out third round PCR;
(2) third round PCR primer is passed through
kpn Iwith
xho Irestriction enzyme site is connected to eukaryotic expression vector pcDNA3.1 A, the recombinant vector called after pcDNA3.1A-pp65NLS of structure;
The structure of B, pp65 stable cell strain
(1) transfection
Day before transfection is by HEK293 cell 1 X 10
5individual/ml is laid in six orifice plates, every hole 2ml; In eppendorf pipe, 150 μ lDMEM nutrient solutions are added during transfection, add recombinant plasmid 2 μ g to mix, add Promega company transfection reagent FuGENEHDTransfectionReagent4 μ l again to mix, room temperature adds in a hole of six orifice plates after placing 15min, rock six orifice plates gently, make that compound is dispersed to come, then as 37 DEG C, 5%CO
248h is cultivated in incubator;
(2) screen
After the cultivation of step (1) terminates, discard nutrient solution in six orifice plates, PBS washs 2 times, change the DMEM complete medium containing G-418400ng/ml into, old nutrient culture media and dead cell is discarded every 3 days, the DMEM complete medium containing G-418400ng/ml renewed, continues to carry out said medicine screening and culturing 2-3 week until significantly cell colony is formed;
(3) cultivation is expanded
Cell colony in six orifice plates is digested, transfers to 25cm
2tissue Culture Flask in, continue to use and cultivate containing the DMEM complete medium of G-418400ng/ml, after cell covers with, be passaged to more large-area Tissue Culture Flask, reduce G4-18 concentration to 200ng/ml simultaneously;
(4) cell cryopreservation
Expand frozen a quantity of seeds cell after cultivating, the cell namely obtaining stable transfection is for subsequent use;
The qualification of C, stable transfected cells strain
(1) immunofluorescence technique qualification
Be laid on by the cell of stable transfection in six orifice plates, after it covers with, first wash 2 times with PBS, 4% paraformaldehyde fixes 15min, and 1% song draws logical 37 DEG C to penetrate 15min, and 20% calf serum closes 30min; Primary antibodie is that abcam company pp65 monoclonal antibody 1:20 dilutes, and hatch 2h for 37 DEG C, PBS washs three times, each 5min; Two resist for Life company AlexaFluor488conjugated sheep anti-mouse igg 1:1000 doubly dilutes, incubated at room 30min, adopt DAPI lining dye simultaneously;
(2) Westernblot qualification
The cell of stable transfection is laid in six orifice plates, after it covers with, first washs 2 times with PBS, RIPA lysate 150 μ l containing 1mMPMSF is added dropwise to a hole of six orifice plates, rock six orifice plates, make protein lysate uniform fold cell, cracking 30min on ice, period rocks six orifice plates once every 5min, make protein lysate uniform fold cell, collect lysate in eppendorf pipe, add isopyknic 2 X SDS-PAGE albumen sample-loading buffer mixings, 5min is boiled in boiling water, obtain the protein sample for preparing with 15% SDS-PAGE carry out electrophoretic separation, then be transferred on pvdf membrane, after skimmed milk power with 5% is closed, primary antibodie is that abcam company pp65 mono-gram of antibody 1:1000 dilutes, 4 DEG C of overnight incubation, TPST washs three times, each 5min, two resist the sheep anti-mouse igg 1:5000 marked for Zhong Shan Golden Bridge HRP to dilute, incubated at room 1h, last TPST washs three times, each 5min, ECL method exposes,
The preparation of D, positive slide
Prepare two bottles of cells, one bottle is stable transfection pp65, and one bottle be normal HEK293 cell; After the cell dissociation of stable transfection, and resuspended with PBS, regulate cell concentration to be 5000/ml after cell count; By also resuspended with PBS after normal HEK293 cell dissociation, cell concentration after cell count, is regulated to be 5 X 10
7individual/ml; The cell getting 1ml stable transfection mixes with 4ml normal cell, the diameter that slide scribbles hydrophobic material formation is about even spread 50 μ l cell mixing in the aperture of 1cm, under slide is placed in blower fan, moisture evaporates the paraformaldehyde that 100 μ l4% are added in every hole when dry, fixing 15min, be stored in-80 DEG C after drying, this slide is the positive slide of HCMVpp65 antigenemia.
4. the preparation method of a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide according to claim 2, is characterized in that: improved HCMVpp65 amino acid sequence is as shown in SEQNo.1.
5. the preparation method of a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide according to claim 1, is characterized in that: improved HCMVpp65 nucleotide coding sequence is as shown in SEQNo.2.
6. the preparation method of a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide according to claim 1, is characterized in that: HCMVpp65 antigenemia inspection immunofluorescence technique test agent box positive control slide pp65 positive cell used is the HEK293 cell of expressing the rear HCMVpp65 of transformation.
7. the preparation method of a kind of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide according to claim 1, is characterized in that: the Genebank number of logging in of described HCMVTR strain pp65 gene order is: KJ743149.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510016199.1A CN104569388B (en) | 2015-01-13 | 2015-01-13 | A kind of preparation method of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510016199.1A CN104569388B (en) | 2015-01-13 | 2015-01-13 | A kind of preparation method of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104569388A CN104569388A (en) | 2015-04-29 |
| CN104569388B true CN104569388B (en) | 2016-04-20 |
Family
ID=53085942
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510016199.1A Active CN104569388B (en) | 2015-01-13 | 2015-01-13 | A kind of preparation method of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104569388B (en) |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE69232265T2 (en) * | 1992-06-25 | 2002-08-08 | City Of Hope Duarte | INDUCTION OF CYTOLYTIC T-LYMPHOCYTEN WITH POLYPEPTIDES OF THE CYTOMEGALIEVIRUS |
| RU2218408C2 (en) * | 2001-11-05 | 2003-12-10 | Государственный научный центр вирусологии и биотехнологии "Вектор" | RECOMBINANT PLASMID DNA PUL83HCMV PROVIDING EXPRESSION IN BACTERIAL CELLS ESCHERICHIA COLI OF RECOMBINANT PROTEIN COMPRISING IMMUNODOMINANT MOIETY OF PHOSPHOPROTEIN PP5 HCMV AND FRAGMENT OF β-GALACTOSIDASE |
| CN1307423C (en) * | 2005-01-08 | 2007-03-28 | 王明丽 | Method for making recombinant antigen pp 65 envelope enzyme-linked reaction plate and ELISA test kit |
| CN101261272A (en) * | 2007-03-09 | 2008-09-10 | 天津市秀鹏生物技术开发有限公司 | HCMVPP65 antigenemia indirect immunofluorescence method detection reagent kit |
| CN101220085B (en) * | 2007-10-31 | 2010-08-11 | 北京英诺特生物技术有限公司 | Human cytomegalovirus recombinant protein and method for preparing the same |
| CN103276008A (en) * | 2013-04-25 | 2013-09-04 | 湖南师范大学 | HCMV pp65 prokaryotically-expressed recombinant strain and construction method thereof |
-
2015
- 2015-01-13 CN CN201510016199.1A patent/CN104569388B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104569388A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105527442B (en) | A kind of hog cholera antibody detecting system and preparation method thereof | |
| CN102731615B (en) | Detection reagent and detection method for PRRSV | |
| CN107974513A (en) | A kind of bovine viral diarrhea virus detection kit and its application based on RPA | |
| CN103881979B (en) | Anti-hepatitis C virus medicament high flux screening model and application thereof | |
| CN104330561A (en) | Method for detecting bovine viral diarrhea virus by virtue of indirect immunofluorescence | |
| JP2003532429A (en) | Mixed cell line for virus detection | |
| CN104880555B (en) | A kind of high-flux detection method of HPV neutralizing antibody | |
| CN109970851A (en) | The preparation method of monoclonal antibody of CCV virus M protein and preparation method thereof, immunity colloidal gold test paper strip | |
| Brake et al. | Human adenovirus-vectored foot-and-mouth disease vaccines: establishment of a vaccine product profile through in vitro testing. | |
| CN110452921A (en) | The packaging and serum neutralizing antibody detection method of 10 type pseudovirus of Coxsackie virus A | |
| CN104991061B (en) | Peste des petits ruminant virus antibody detection kit based on IPMA | |
| CN107759674A (en) | A kind of Mycoplasma bovis immune-related albumen, the detection kit containing the albumen and its purposes in Mycoplasma bovis antibody test | |
| CN105671004A (en) | Method for cultivating hepatitis E viruses | |
| CN104407145A (en) | Enterovirus 71 type latex agglutination detection kit, preparation and application | |
| CN103333865B (en) | HPV pseudovirus, kit thereof and method for detecting HPV neutralizing antibodies | |
| CN105738629A (en) | Indirect immuno-fluorescence detection method of yellow fever virus IgG antibody | |
| CN104569388B (en) | A kind of preparation method of Human cytomegalovirus pp65 antigenemia immuno-fluorescence assay kit positive control slide | |
| CN115073557A (en) | Recombinant high-purity African swine fever virus pK205R subunit protein and preparation method and application thereof | |
| Hasegawa et al. | An experimental study on the vertical transmission of caprine arthritis-encephalitis virus from naturally infected females to their offspring | |
| Pu et al. | Evaluate severe acute respiratory syndrome coronavirus 2 infectivity by pseudoviral particles | |
| US6472206B1 (en) | In situ growth, freezing and testing of cultured cells | |
| CN104531895B (en) | A kind of method for determining virus titer | |
| Pascual-Sabater et al. | Preclinical testing of oncolytic adenovirus sensitivity in patient-derived tumor organoids | |
| CN110468145A (en) | A kind of EV-D68 type pseudovirus and its packing method | |
| Ramani et al. | CACO-2 cells: A continuous cell line with sensitive and broad-spectrum utility for respiratory virus culture |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20161228 Address after: Hefei City, Anhui province 230032 Wangjiang Road, No. 800 Hefei Innovation Industrial Park building D9 Patentee after: Will Europe Han Biotechnology (Hefei) Co., Ltd. Address before: 230032 Medical University Of Anhui, Hefei, Anhui No. 81 Patentee before: Wang Mingli Patentee before: ANHUI BORUI BIOLOGICAL TECHNOLOGY CO., LTD. |
|
| CP02 | Change in the address of a patent holder | ||
| CP02 | Change in the address of a patent holder |
Address after: 230088 biohan biological industrial park, northeast corner of the intersection of kongtai road and Chang'an Road, high tech Zone, Hefei, Anhui Province Patentee after: BIOHIT BIOTECHNOLOGY (HEFEI) Co.,Ltd. Address before: Block D9, Hefei Innovation Industrial Park, No. 800, Wangjiang West Road, Hefei Patentee before: BIOHIT BIOTECHNOLOGY (HEFEI) Co.,Ltd. |