CN104561385A - PCR kit for detecting papilloma virus HPV6 - Google Patents

PCR kit for detecting papilloma virus HPV6 Download PDF

Info

Publication number
CN104561385A
CN104561385A CN201510036404.0A CN201510036404A CN104561385A CN 104561385 A CN104561385 A CN 104561385A CN 201510036404 A CN201510036404 A CN 201510036404A CN 104561385 A CN104561385 A CN 104561385A
Authority
CN
China
Prior art keywords
hpv6
seq
recurrent respiratory
teenager
pcr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510036404.0A
Other languages
Chinese (zh)
Inventor
郑海学
曹伟军
杨帆
朱紫祥
郭建宏
靳野
李丹
刘湘涛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Lanzhou Veterinary Research Institute of CAAS
Original Assignee
Lanzhou Veterinary Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lanzhou Veterinary Research Institute of CAAS filed Critical Lanzhou Veterinary Research Institute of CAAS
Priority to CN201510036404.0A priority Critical patent/CN104561385A/en
Publication of CN104561385A publication Critical patent/CN104561385A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/708—Specific hybridization probes for papilloma
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a high-specificity primer pair for detecting recurrent respiratory papilloma HPV6 subtype of teenagers, and a one-step TapMan fluorescent quantization PCR detection kit for the recurrent respiratory papilloma HPV6 subtype of the teenagers. Sequences of the high-specificity primer pair for detecting recurrent respiratory papilloma viruses of the teenagers are SEQ ID No.1 and SEQ ID No.2. The detection kit also comprises a probe of which the sequence is SEQ ID No.3. According to the PCR kit, quantitative amplification and detection of the recurrent respiratory papilloma HPV6 subtype of the teenagers can be carried out; the pollution can be reduced; the detection accuracy is improved; and the operation is simple and fast; the PCR kit is very applicable in evaluation of the development tendency of clinical preparation of the recurrent respiratory papilloma viruses of the teenagers and epidemiological investigation.

Description

Detect the PCR kit of Papillomavirus HPV6 type
Technical field
The present invention relates to a kind of viral TapMan fluorescence quantitative detection kit, is a kind of for detecting teenager's recurrent respiratory papilloma HPV6 hypotype single stage method TapMan fluorescent quantificationally PCR detecting kit exactly.
Background technology
Teenager's recurrent respiratory papilloma knurl (juvenile-onset recurrent respiratory papilloma, JO-RRP) papillomatosis betiding lower respiratory tract is refered in particular to, a kind of by Papillomavirus (human papillomavirus, what HPV) virus caused has height recurrent and invasive disease, except often accumulating except throat, other positions of respiratory tract and digestive tube can also be invaded.The course of disease performance of RRP is various, and indivedual infant can spontaneous remission, and majority then presents invades profit and grow and need that larynx even appears in Repeated Operation, tracheostenosis blocks death by suffocation, and clinical treatment is very thorny.
HPV is a kind of addicted to the small-sized DNA virus of epithelium, has host and tissue specificity, and only infect skin and the mucous membrane of people, can infect other people through close contact, the position that Subclinical papillomavirus infection infects is relevant with HPV type and antibody factor.More than 100 kinds known HPV genotype are found at present, IARC is divided into amphitypy according to the size of HPV virulence, namely cause the low dangerous type of hyperplasia of prostate (comprise HPV6,11,40,42-45,54,61,70,72,81 types) and with the closely-related high-risk-type of mankind's Various Tissues malignant tumour (comprising HPV16,18,31,33,35,39,45,51,52,56,58,59 etc.), falling ill relevant with JORRP is HPV6 and 11 types.
Research thinks that the hypotype of HPV is relevant with clinical process to coincident with severity degree of condition, and between hypotype, there is virulence and tissue tropism's difference, therefore set up clinically and the method for rapid detection teenager recurrent respiratory Papillomavirus HPV6 hypotype can seem particularly important.But the detection kit that there is no so far for detecting virus, conventional conventional PCR method detection sensitivity is not high, and easily occurs false positive.
Summary of the invention
The invention provides a kind of high degree of specificity primer pair detecting teenager's recurrent respiratory papilloma HPV6 subtype virus, and include this high degree of specificity primer pair and probe can special, responsive, fast with easily for the test kit of detection by quantitative teenager recurrent respiratory papilloma HPV6 hypotype.
The high degree of specificity primer pair gene order of the teenager's of detection recurrent respiratory papilloma HPV6 subtype virus of the present invention is SEQ ID No.1 and SEQ ID No.2.
The test kit detecting teenager's recurrent respiratory papilloma HPV6 subtype virus of the present invention, inside includes the probe primer that high degree of specificity primer pair that gene order is SEQ ID No.1 and SEQ ID No.2 and gene order are SEQ ID No.3.For convenience of using, except containing Auele Specific Primer SEQ ID No.1 in test kit of the present invention, outside SEQ ID No.2 and specific probe SEQ ID No.3, also containing other appurtenant as: 2 × One Step RT-PCR Buffer III is (containing dNTP Mixture, Mg2+) all experiment reagents, required for the amplification such as TaKaRa Ex Taq HS (5U/ μ L), PrimeScript RT Enzyme Mix II, only need add according to explanation during detection and detect sample.And not containing the DNA negative sample of teenager's recurrent respiratory papilloma HPV6 hypotype and the DNA sample containing teenager's recurrent respiratory papilloma HPV6 hypotype as positive control.
SEQ ID No.1 of the present invention and SEQ ID No.2 primer pair amplifies condition is used to be: 95 DEG C of 10sec, 1 circulation → 95 DEG C of 10sec, 55 DEG C of 30sec, 72 DEG C of 30sec, 40 circulations; When carrying out single stage method TapMan fluorescent quantitative PCR, fluorescence signal collection is placed on 72 DEG C of 30sec ends of each circulation.
In the present invention, the extraction of sample DNA is extracted by Omega DNA extraction kit (article No.: D3096), and the DNA sample of getting extraction is got 2 μ L and directly can be added (23 μ L) in the reaction solution be sub-packed in 8 connecting legs, can be directly used in detection by quantitative like this.
Test kit of the present invention is a kind of test kit that can carry out single stage method TapMan fluorescence quantitative PCR detection to teenager's recurrent respiratory papilloma HPV6 subtype virus, its advantage is in relating to two high degree of specificity primers and probe according to the L1 gene of teenager's recurrent respiratory papilloma HPV6 hypotype epidemic strain is conservative, on the basis that this viral DNA extracts, fluorescent quantitative PCR is carried out to tissue sample, realizes the detection by quantitative to teenager's recurrent respiratory papilloma HPV6 hypotype.
Single stage method TapMan fluorescence quantitative PCR detection method uses 5` end band to have fluorescent substance, and 3` end band has the TapMan probe of cancellation material to carry out fluoroscopic examination, and when probe is complete, 5` holds fluorescent substance to be subject to 3` end quenching to go out the restriction of material, can not send fluorescence.And after TapMan probe is decomposed, the fluorescent substance of 5` end just can dissociate out, send fluorescence.React middle probe and template hybridization at PCR, extension is that polymerase activity can decompose the fluorescent probe of hybridizing with template, and free fluorescent substance sends fluorescence.By the fluorescence intensity in detection reaction system, thus the object detecting PCR primer amplification amount can be reached.Use this test kit to carry out Real Time PCR reaction at PCR to carry out continuously in same reaction tubes, simple to operate, and can effective preventing pollution.
The TaqMan probe method that the present invention uses is the probe designed for the nucleotide sequence of teenager's recurrent respiratory Papillomavirus HPV6 subtype sepcific, and probe and template are that high degree of specificity is combined, and specificity and susceptibility are all high.In the development trend of clinical disease course evaluating teenager recurrent respiratory Papillomavirus HPV6 hypotype and rapid detection has been filled up blank
Test kit of the present invention can make detection pcr amplification one step complete, simplify operation steps, decreasing pollution probability, and the precision of detection can be improve, single stage method TapMan fluorescent quantitation directly can carry out the quantitative initial viral copy number of typical curve after amplification completes, simultaneously it is simple and quick, very applicable in the development trend of clinical disease course evaluating teenager's recurrent respiratory Papillomavirus HPV6 hypotype and in epidemiology survey.
Accompanying drawing explanation
Fig. 1: cut qualification electrophorogram containing teenager's recurrent respiratory papilloma HPV6 hypotype L1 gene order recombinant plasmid enzyme,
Wherein: M:2000bp DNA Marker
1: recombinant plasmid pMD-Hpv6-L1 double digestion qualification
2: recombinant plasmid pMD-Hpv6-L1 single endonuclease digestion linearizing
The amplification curve of Fig. 2: HPV6 single stage method TapMan quantitative fluorescent PCR, wherein: ordinate zou represents fluorescence volume, X-coordinate represents cycle number amplification curve and from left to right represents that the copy number of target DNA is respectively 3.11 × 10 8-3.11 × 10 3;
Fig. 3: HPV6 virus single stage method TapMan fluorescence quantitative PCR detection typical curve, wherein: ordinate zou represents Ct value.The copy number of X-coordinate representative sample, coefficient R 2: 0.999, amplification efficiency Eff:98.6%;
Fig. 4: be the specific amplification curve of detection method;
Fig. 5: the amplification curve being detection method susceptibility, wherein: ordinate zou represents fluorescence volume, X-coordinate represents cycle number, and the copy number of amplification curve DNA is from left to right respectively 1 × 10 8-1 × 10 0.
Embodiment
Illustrate that the present invention will be further described below in conjunction with specific examples and accompanying drawing
The Design and synthesis of embodiment 1. teenager recurrent respiratory papilloma HPV6 hypotype fluorescence quantification PCR primer
After utilizing known teenager's recurrent respiratory papilloma HPV6 hypotype L1 gene order comparison, utilize Primer Express3.0 software design primer and probe according to conservative region, send precious biotechnology (Dalian) company limited to synthesize.Upstream and downstream primer and probe are respectively:
SEQ ID No.1：（Hpv6-F）5’- TCCTCCTAACCCTGTATC -3’
SEQ ID No.2：（Hpv6-R）5’- TGCTGGCATGATAAAATATG -3’
SEQ ID No.3：(Hpv6-Probe) 5’- CCACGGATGCTTATGTTACTCGCT -3’（5′FAM, 3′TAMRA）
The preparation of embodiment 2. standard substance
With reference to the sequence that teenager's recurrent respiratory papilloma HPV6 hypotype logs on NCBI, after comparative analysis, design the upstream and downstream primer of the partial sequence of the L1 gene that can increase, send precious biotechnology (Dalian) company limited to synthesize.Upstream and downstream primer is respectively: SEQ ID No.4:(Hpv6-5674-F) 5 '-TGGACGACCAGCTCTTCCTTAAACAC-3 ' SEQ ID No.5:(Hpv6-6807-R) 5 '-AGTGCAAGTCTGGGTTGCAGCCAACA-3 '.
Get respiratory tract papilloma tissues in Biohazard Safety Equipment, after grinding dilution, the vessel that the DNA(extracting tissue according to Omega DNA extraction kit (article No.: D3096) specification sheets crosses and consumptive material need strict sterilization), then use the single stage method PCR kit operation of TaKaRa company as follows:
Carry out pcr amplification with DNA extraction thing for template and prepare 25 μ l systems,
2 × 1 step buffer (containing dNTP) 13 μ L
PrimeScript 1 Step Enzyme Mix 1μL
Upstream primer (Hpv6-5674-F) 0.5 μ L
Downstream primer (Hpv6-6807-R) 0.5 μ L
DNA extraction thing (masterplate) 1 μ L
DNAse Free dH2O 9μL
In mixing, the automatic amplification instrument of the rearmounted PCR of low-speed centrifugal, increase according to following program: 50 DEG C of 30min, 94 DEG C of 2min circulation → 94 DEG C of 30sec, 52 DEG C of 30sec, 72 DEG C of 45sec, 35 circulations.PCR primer purifies recovery with 1% agarose gel electrophoresis, utilizes T4 ligase enzyme and pMD-20-T Vector 16 DEG C to spend the night and is connected, and transforms DH5 α competent cell, chooses mono-clonal spot in LB(Amp +) middle enlarged culturing, with plasmid extraction kit purification plasmid pMD-Hpv6-L1, pass through spei/ ecoRi enzyme cuts qualification, determines positive plasmid, sees accompanying drawing 1.Again by order-checking qualification, the positive plasmid pMD-Hpv6-L1 that success builds is extracted rear use in a large number ecoRi single endonuclease digestion is by its linearizing, and purifying is frozen in-80 DEG C after measuring concentration.Utilize formula: (copies/ μ L)=[(ng number × 10 -9) × (6.02 × 10 23)] ÷ (base number × 340) converses the copy number of target DNA.
The foundation of embodiment 3. typical curve
According to the copy number obtained after quantitatively, the examination criteria product of 6 gradient dilutions such as standard model to be made, for reducing error, improve the repeatability of experiment, each extent of dilution sample is provided with three repeating holes, determine Ct value (Ct and cycle threshold, the fluorescent signal referring in reaction tubes reaches the cycle number the experienced during threshold value of setting), thus determine the typical curve that expanding effect is best.
(1) fluorescent quantitative PCR
Amplification system is 25 μ L, wherein comprises 2 × One Step RT-PCR Buffer III (containing dNTP Mixture, Mg 2+), taKaRa Ex TaqhS (5U/ μ L), PrimeScript RT Enzyme Mix II, DNAse Free dH 2o, upstream primer SEQ1, downstream primer SEQ2
Probe SEQ ID No.3 and the standard substance 2 μ L diluted.
Pcr amplification adopts Agilent Techologies-Mx3005pPCR amplification instrument, and program is: 95 DEG C of 10sec, 1 circulation (reverse transcription)
95 DEG C of 10sec, 55 DEG C of 30sec, 72 DEG C of 30sec, 40 circulations (pcr amplification)
Wherein fluorescence signal collection is arranged on 72 DEG C of 30sec ends of each circulation.
(2) preparation of typical curve
The analysis of PCR fluorescent signal adopts Agilent company MxPro software, and the fluorescent quantitative PCR curve obtained and corresponding typical curve are shown in accompanying drawing 2,3 respectively.
The specific detection of embodiment 4.
By subordinate's common epidemic disease cause of disease: the low dangerous type HPV11 of mucous membrane, mucous membrane high-risk type HPV16, the low dangerous type HPV1 of skin, skin high-risk type HPV5, detect the specificity of establishment method, the fluorescent quantitative PCR result obtained is shown in accompanying drawing 4.Result shows the method specificly can only amplify pig teenager recurrent respiratory papilloma HPV6 hypotype DNA positive control, and specificity is good.
The detection of embodiment 5. susceptibility
Standard model is made 1 × 10 8-1 × 10 1(copies/ μ L) 8 extent of dilution, detect the susceptibility of establishment method, the fluorescent quantitative PCR result obtained is shown in accompanying drawing 5.For guaranteeing the accuracy detected, arranging autoclaving water is background values contrast, by≤34 circulate and curve has the sample of obvious Exponential growth stage to be judged to be the positive, this fluorescence quantitative detecting method accurately can detect about 10 cause of diseases copied, and regular-PCR Intelligent Measurement is to 1 × 10 4individual copy, the detection sensitivity of quantitative fluorescent PCR of the present invention is 10 of regular-PCR as can be seen here 3doubly, susceptibility is good.
<110> Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
<120> detects the real time fluorescent quantitative detection kit of papilloma HPV6 subtype virus
<160> 5
<210> 1
<211> 18
<212> DNA
<213> artificial sequence (forward primer Hpv6-F)
<400>
aaccctgtatc caaagttg 18
<210> 2
<211> 19
<212> DNA
<213> artificial sequence (reverse primer Hpv6-R)
<400>
ccaccttaaa taccctgta 19
<210> 3
<211> 24
<212> DNA
<213> artificial sequence (probe primer Hpv6--Probe)
<400>
ccacggatgc ttatgttact cgct 24
<210> 4
<211> 26
<212> DNA
<213> artificial sequence (the upstream primer Hpv6-5674-F of the partial sequence of amplification L1 gene)
<400>
tggacgacca gctcttcctt aaacac 26
<210> 5
<211> 26
<212> DNA
<213> artificial sequence (the downstream primer Hpv6-6807-R of the partial sequence of amplification L1 gene)
<400>
agtgcaagtc tgggttgcag ccaaca 26

Claims (4)

1. can detect a high degree of specificity primer pair for teenager's recurrent respiratory papilloma HPV6 subtype virus, it is characterized in that primer pair gene order is SEQ ID No.1 and SEQ ID No.2.
2. can detect a test kit for teenager's recurrent respiratory papilloma HPV6 subtype virus, it is characterized in that including in test kit the probe primer that high degree of specificity primer pair that gene order is SEQ ID No.1 and SEQ ID No.2 and gene order are SEQ ID No3.
3. the test kit detecting teenager's recurrent respiratory papilloma HPV6 subtype virus according to claim 2, it is characterized in that in test kit, also having test kit of the present invention to it is characterized in that also containing RT-PCR Buffer III, TaKaRa Ex Taq HS, PrimeScript RT Enzyme Mix II in test kit, and not containing the DNA sample of teenager's recurrent respiratory papilloma HPV6 hypotype and the DNA sample containing teenager's recurrent respiratory papilloma HPV6 hypotype as positive control.
4. use claim 1 or the SEQ ID No.1 described in 2 or 3 and SEQ ID No.2 primer pair amplifies condition to be: 95 DEG C of 10sec, 1 circulation → 95 DEG C of 10sec, 55 DEG C of 30sec, 72 DEG C of 30sec, 40 circulations; When carrying out single stage method TapMan fluorescent quantitative PCR, fluorescence signal collection is placed on 72 DEG C of 30sec ends of each circulation.
CN201510036404.0A 2015-01-24 2015-01-24 PCR kit for detecting papilloma virus HPV6 Pending CN104561385A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510036404.0A CN104561385A (en) 2015-01-24 2015-01-24 PCR kit for detecting papilloma virus HPV6

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510036404.0A CN104561385A (en) 2015-01-24 2015-01-24 PCR kit for detecting papilloma virus HPV6

Publications (1)

Publication Number Publication Date
CN104561385A true CN104561385A (en) 2015-04-29

Family

ID=53078459

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510036404.0A Pending CN104561385A (en) 2015-01-24 2015-01-24 PCR kit for detecting papilloma virus HPV6

Country Status (1)

Country Link
CN (1) CN104561385A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101251469A (en) * 2007-08-24 2008-08-27 港龙生物技术（深圳）有限公司 Fluorescence PCR method for diagnosis of human papilloma viral infection
WO2009020079A1 (en) * 2007-08-03 2009-02-12 Kurashiki Boseki Kabushiki Kaisha Primer set and probe for detection of human papillomavirus
CN101676408A (en) * 2008-09-19 2010-03-24 扬子江药业集团北京海燕药业有限公司 6,11 type human papillomavirus fluorescence quantitative PCR detection method and kit thereof
CN101709335A (en) * 2009-12-10 2010-05-19 浙江大学 Quadruple fluorescence quantitive PCR typing detection method for common human papillomavirus infection

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009020079A1 (en) * 2007-08-03 2009-02-12 Kurashiki Boseki Kabushiki Kaisha Primer set and probe for detection of human papillomavirus
CN101251469A (en) * 2007-08-24 2008-08-27 港龙生物技术（深圳）有限公司 Fluorescence PCR method for diagnosis of human papilloma viral infection
CN101676408A (en) * 2008-09-19 2010-03-24 扬子江药业集团北京海燕药业有限公司 6,11 type human papillomavirus fluorescence quantitative PCR detection method and kit thereof
CN101709335A (en) * 2009-12-10 2010-05-19 浙江大学 Quadruple fluorescence quantitive PCR typing detection method for common human papillomavirus infection

Similar Documents

Publication Publication Date Title
CN107299155B (en) Primer and probe for real-time fluorescence quantitative PCR detection of goose astrovirus
CN106947838B (en) African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method
CN107513584B (en) A kind of five heavy fluorescence quantitative kits detecting enterovirus
CN109735657A (en) A kind of reagent, detection method and application for African swine fever virus detection
CN103045755B (en) A kind of fluorescent quantitative PCR detection method detecting Ebola virus and primer thereof and test kit
CN108384899B (en) Fluorescent quantitative PCR kit for detecting novel goose astrovirus and application thereof
CN104152584B (en) Capripoxvirus virus Taqman-MGB probe multiple real-time fluorescence quantitative PCR detection primer, method and test kit
CN108504778B (en) Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application
CN105603123A (en) Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits
KR102267326B1 (en) Method and kit for detecting coronavirus
CN111321248A (en) African swine fever virus MGF-505R gene fluorescence PCR detection reagent, kit and application thereof
CN106048081A (en) HPV (human papilloma virus) typing detection primers as well as detection method and application thereof
CN103725794A (en) Fluorescent quantitative RT-PCR (reverse transcriptase-polymerase chain reaction) primers, probes and method for detecting PRRSV (porcine reproductive and respiratory syndrome virus)
CN113046484B (en) Primer probe, kit and method for detecting African swine fever virus p72 gene
CN110205405B (en) Kit, primer and probe for detecting and identifying O, A and Asial types of Seneca Valley virus, foot-and-mouth disease virus
CN103820574B (en) Human herpes virus type 6 real-time fluorescence quantitative PCR parting detecting reagent
CN101251469A (en) Fluorescence PCR method for diagnosis of human papilloma viral infection
CN108060265A (en) For detecting the primer sets of the oyster herpetovirus of infection blood clam and probe and its application
CN104450954B (en) Detect the fluorescent PCR kit and its method of 13 kinds of hypotypes of human papilloma virus
CN116411141A (en) RPA-CRISPR/Cas12 a-based visualized detection kit for porcine group A rotavirus and application
CN104561385A (en) PCR kit for detecting papilloma virus HPV6
CN103014180A (en) Detection primer, probe and detection method of human astrovirus nucleotide
CN110157836B (en) Primer, probe and method for detecting IBRV and BVDV
CN107034311A (en) Quick detection duck plague virus LAMP kit
CN104651531B (en) Kit for detecting juvenile recurrent respiratory papilloma virus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20150429