CN104561308A - lncRNA and AR3 combined detection kit for circulating tumor cell and application of lncRNA and AR3 combined detection kit - Google Patents

Abstract

The invention relates to an lncRNA and AR3 combined diagnosis kit for a circulating tumor cell and application of the lncRNA and AR3 combined detection kit. The combined diagnosis kit detects lncRNA PCGEM1 and an androgen receptor isomer AR-V7 (AR3) in a combined manner by a real-time quantitative PCR technology; the lncRNA is specific lncRNA PCGEM1 in the circulating tumor cell. The kit disclosed by the invention has the advantages of high specificity, high sensitivity, high accuracy and high efficiency. Compared with a currently common conventional method, the kit has the advantage that through combined detection of lncRNA PCGEM1 and AR-V7 (AR3), the problems of effective prognosis evaluation and detection on clinical frequent diseases are solved and obvious clinical, economic and social values are achieved.

Description

A kind of lncRNA and AR3 combined detection kit for circulating tumor cell and application thereof

Technical field

The present invention relates to technical field of molecular biology, specifically, be a kind of lncRNA and AR3 combined detection kit for circulating tumor cell and for diagnose AR related neoplasms castration opposing and recurrence.

Background technology

Cancer accounts for nearly 1/4 of human death's cause of disease.In the past few decades, tumor recurrence and transfer are still the major obstacle improving overall survival, and this mainly may still lack comprehensive understanding owing to people for carcinobiology.Such as, the latest developments of functional genomics research show, the overwhelming majority that participant's genoid is transcribed is non-coding RNA.But, [1] is still known little for lncRNAs mankind in the expression of regulation and control cancer gene and mechanism etc.

To the research of tumour epigenetic mechanism, we are by finding that lncRNAs can by the progress of number of mechanisms modulate tumor in the recent period.Recently there are some researches show lncRNA PCGEM1 can with androgen receptor AR keying action [2].PCGEM1 raises [3] in prostate cancer, cell proliferation [4] can be promoted, we are then found by clinical samples research, the genetic expression of PCGEM1 and prostatic cancer malignancy degree and transfer and relapse are high correlation, PCGEM1 not only can by with AR direct effect, the expression that the more important thing is PCGEM1 and AR isomer (as AR3) is high-positive correlation, and we further demonstrate PCGEM1 and have modified the isomer of AR as the expression of AR3 by alternative transcription.Find that lncRNAs such as PCGEM1 can drive by the propagation of the epigenetic mechanism participation AR related neoplasms of regulation and control AR genetic transcription, malignant invasion recurrence and transfer thus.Because be because isomer such as the AR-V7 (AR3) of AR has mediated the hormone castration opposing of such tumour to a certain extent, and not wild type full-length AR.And research shown AR-V7 to a great extent induced synthesis related neoplasms such as the hormone castration of prostate cancer resist [5].

The expression of the height correlation AR isomer (as AR3) that the specificity for above-mentioned AR related neoplasms regulates lncRNAs to resist with the hormone castration of such tumour as PCGEM1 is high correlation, by the These parameters of fluorescence in situ hybridization and immunohistochemistry technology's joint-detection clinical tissue sample, can the hormone castration opposing of highly effective Evaluation and Prediction diagnosis AR related neoplasms and relapse and metastasis, and make diagnosis in early days in the opposing of hormone castration and relapse and metastasis.Technology and the test kit of this application set up based on current up-to-date result of study.This is a kind of all irreplaceable detection method of additive method at present, there is not yet relevant report up to now.

On the one hand, circulating tumor cell (circulating tumor cells, CTCs), namely comes off and enters blood circulation, being formed with sanguimotor tumour cell from noumenal tumour.These cells are considered to there is significant relationship with problems such as the far-end transfers of tumour, the more ripe immune labeled method of the many employings of detection technique carries out separation detection analysis at present, there are proven technique means for the separation andpreconcentration of circulating tumor cell at present, as the CellSearch system of Veridex company research and development under Johnson Co., this system has good specificity, sensitivity, accuracy and repeatability, be the technology uniquely obtaining FDA, SFDA certification at present, be widely applied to clinical diagnosis in the U.S..

On the other hand, intuitively gene is detected quickly; In addition, can detect this specific targets efficiently, accurately and detect gene, and amplify this signal, more conventional staining examine is more sensitive and accurate.The present invention is the tumour epigenetic regulation mechanism participated in based on up-to-date long-chain non-coding RNA (lncRNA).The most important thing is joint-detection PCGEM1 and androgen receptor isomer AR-V7 (AR3), is be based upon on the basis of the epigenetic regulation mechanism that lncRNAsPCGEM1 is proved by the present invention.Namely lncRNA PCGEM1 is by regulating and controlling the post transcriptional modificaiton of AR-V7 (AR3) pre-mRNA and common location, directly determines tumour such as the castration after the hormone castration of prostate cancer, lung cancer and mammary cancer etc. expressing androgen receptor and resists or relapse and metastasis.Especially the lncRNA PCGEM1 that the present invention is based on institute's discovery controls the new theory of the generation of androgen receptor (AR) isomer (AR-V7 (AR3)) by the post transcriptional modificaiton that regulation and control pre-mRNA shears.Castration opposing or relapse and metastasis after the hormone castration of the androgen receptor (AR) that the new theory of this lncRNA PCGEM1--AR-V7 (AR3) regulation mechanism mediates.The PCGEM1 of joint-detection circulating tumor cell and the expression of androgen receptor isomer AR-V7 (AR3) can castration opposing or relapse and metastasis situations after the hormone castration of effective Forecast and evaluation androgen receptor (AR).

Reference: 1.Xie C, Yuan J, Li H, Li M, Zhao G, Bu D, et al.NONCODEv4:exploring the world of long non-coding RNA genes.Nucleic acids research.2013; Doi:10.1093/nar/gkt1222.

2.Yang L,Lin C,Jin C,Yang JC,Tanasa B,Li W,et al.lncRNA-dependentmechanisms of androgen-receptor-regulated gene activation programs.Nature.2013；29:598-602.

3.Srikantan V,Zou Z,Petrovics G,Xu L,Augustus M,Davis L,et al.PCGEM1,a prostate-specific gene,is overexpressed in prostate cancer.Proceedings of theNationalAcademy ofSciences ofthe United States ofAmerica.2000；97:12216-21.

4.Petrovics G,Zhang W,Makarem M,Street JP,Connelly R,Sun L,et al.Elevated expression of PCGEM1,a prostate-specific gene with cellgrowth-promoting function,is associated with high-risk prostate cancer patients.Oncogene.2004；23:605-11.

5.Antonarakis ES,et al.AR-V7and resistance to enzalutamide and abirateronein prostate cancer.The New Englandjournal ofmedicine.2014；371,1028-1038.

Summary of the invention

The object of the invention is, for deficiency of the prior art, to provide the purposes of long-chain non-coding RNA (lncRNA).

Of the present invention again one object be, be provided for detect lncRNA and detect androgen receptor isomer AR-V7 (AR3) nucleic acid primer.

Another object of the present invention provides a kind of lncRNA and AR3 united diagnostic reagent box for circulating tumor cell.

4th object of the present invention provides the purposes of mentioned reagent box

For achieving the above object, the technical scheme that the present invention takes is:

Long-chain non-coding RNA controls the aborning application of androgen receptor isomer AR-V7 (AR3) at the post transcriptional modificaiton that regulation and control pre-mRNA shears, and described long-chain non-coding RNA is lncRNA PCGEM1.

For realizing above-mentioned second object, the technical scheme that the present invention takes is:

For detecting the nucleic acid primer of long-chain non-coding RNA and detection androgen receptor isomer AR-V7 (AR3), described lncRNA is the specificity lncRNA PCGEM1 in circulating tumor cell; The nucleic acid primer sequence of described detection long-chain non-coding RNA is

PCGEM1-5.1(SEQ ID NO.1)：TTTTTGCCCTATGCCGTAAC，

PCGEM1-3.1 (SEQ ID NO.2): GGAGACTCCCAACCTGATGA; Or be

PCGEM1-5.2(SEQ ID NO.3)：GGTAGGCACGTGGAGGACTA，

PCGEM1-3.2(SEQ ID NO.4)：TGCTTTTGTGGGTTTGTTCA；

The nucleic acid primer sequence of described detection androgen receptor isomer AR-V7 (AR3) is

AR3-5.1(SEQ ID NO.5)：GCAATTGCAAGCATCTCAAA，

AR3-3.1(SEQ ID NO.6)：GGAGGGAGTCAGCAATCAAG。

For realizing above-mentioned 3rd object, the technical scheme that the present invention takes is:

For a lncRNA and AR3 united diagnostic reagent box for circulating tumor cell, described united diagnostic reagent box is by Real-time quantitative PCR joint-detection lncRNA and androgen receptor isomer AR-V7 (AR3); Described long-chain non-coding RNA is the specificity lncRNAPCGEM1 in circulating tumor cell.

The nucleic acid primer sequence of described detection lncRNA PCGEM1 is:

PCGEM1-5.1(SEQ ID NO.1)：TTTTTGCCCTATGCCGTAAC，

PCGEM1-3.1 (SEQ ID NO.2): GGAGACTCCCAACCTGATGA; Or be

PCGEM1-5.2(SEQ ID NO.3)：GGTAGGCACGTGGAGGACTA，

PCGEM1-3.2(SEQ ID NO.4)：TGCTTTTGTGGGTTTGTTCA。

Two nucleic acid primer sequences of described detection androgen receptor isomer AR-V7 (AR3) are:

AR3-5.1(SEQ ID NO.5)：GCAATTGCAAGCATCTCAAA；

AR3-3.1(SEQ ID NO.6)：GGAGGGAGTCAGCAATCAAG。

The present invention seeks to be to provide a kind of efficient, high degree of specificity, susceptibility and high confidence level, simultaneously very directly perceived again and there is the diagnostic kit for the opposing of androgen receptor related neoplasms hormone castration and recurrence of Clinical practicability and using value.

Based on the tumour epigenetic regulation mechanism that lncRNA participates in, especially lncRNA PCGEM1 controls the generation of androgen receptor (AR) isomer (AR-V7 (AR3)) by the post transcriptional modificaiton that regulation and control pre-mRNA shears.The present invention is based on lncRNA PCGEM1 illustrated by previous work and regulate and control the new theory that AR-V7 (AR3) expresses, and castration opposing or relapse and metastasis after the hormone castration of androgen receptor (AR) that mediates of this aspect new theory.

Joint-detection PCGEM1 and androgen receptor isomer AR-V7 (AR3) can castration opposing or relapse and metastasis situation after the hormone castration of effective Forecast and evaluation androgen receptor (AR).

For circulating tumor cell, there are proven technique means at present for the separation andpreconcentration of circulating tumor cell.And adopt the expression of real-time quantitative PCR detection target gene to have good specificity, sensitivity, accuracy and repeatability, be applicable to be used widely clinical.

The present invention can by the expression level of PCGEM1 and androgen receptor isomer AR-V7 (AR3) in clear and definite circulating tumor cell, evaluate the good grade malignancy of tumour, understand and assess the potentiality of the opposing of its tumour hormone castration and recurrence and possible degree.

Associating aforesaid method has directly perceived, accurate, efficient and sensitive and high specificity, has practical Clinical practice and is worth.Therefore lncRNAs PCGEM1 and AR-V7 (AR3) real-time quantitative PCR joint-detection is used for the united diagnostic reagent box of the opposing of androgen receptor related neoplasms hormone castration and recurrence.

The invention provides a kind of by real-time quantitative PCR joint-detection lncRNA PCGEM1 and AR-V7 (AR3) for the diagnostic techniques of the opposing of androgen receptor related neoplasms hormone castration and recurrence and test kit, its technical scheme comprises the steps:

A.lncRNA PCGEM1 primer synthesizes, and primer sequence is as shown in SEQ ID NO.1-4.

B.AR-V7 (AR3) primer synthesizes, and primer sequence is as shown in SEQ ID NO.5-6.

C. circulating tumor cell is separated (the unmarked sorting detection method of circulating tumor cell (CTCs))

ScreenCell company of France adopts filter film technology (circulating tumor cell (CTCs) unmarked sorting detection method) different from Normocellular in form, size and other physical properties according to tumour cell, carries out fast, efficiently, highly sensitive, to be separated with no damage it.Or adopt immune labeled method to carry out separation detection analysis, as the CellSearch system of Veridex company research and development under Johnson Co., this system has good specificity, sensitivity, accuracy and repeatability, be the technology uniquely obtaining FDA, SFDA certification at present, be widely applied to clinical diagnosis in the U.S..

D. above-mentioned primer is applied and circulating tumor cell carries out real-time quantitative PCR detection:

Circulating tumor cell carries out real-time quantitative PCR and detects sample needs separation preparation, mRNA extraction, the conventional processing such as reverse transcription.The present invention combines lncRNA PCGEM1 and AR-V7 (AR3) two target genes and detects.

The invention provides a kind of by associating lncRNA PCGEM1 and AR-V7 (AR3) two target gene detection methods, the diagnostic techniques of resisting for androgen receptor related neoplasms hormone castration and recur and test kit, this test kit includes above-mentioned Auele Specific Primer and real-time quantitative PCR reagent.

The invention has the advantages that:

1, the present invention seeks to be to provide a kind of efficient, high degree of specificity, susceptibility and high confidence level, simultaneously very directly perceived again and there is the diagnostic kit for the opposing of androgen receptor related neoplasms hormone castration and recurrence of Clinical practicability and using value.

2, the present invention has significant specificity, and object is the good grade malignancy of clearly this pathology or tissue, and assesses potentiality and the possibility of the opposing of its tumour hormone castration and recurrence.

3, combine aforesaid method and there is accuracy, high efficiency.

4, the present invention has high specificity, has practical Clinical practice and is worth.LncRNA PCGEM1 and AR-V7 (AR3) dual combination detects the feasibility and the confidence level that add clinical application, can directly apply to clinical, and this is the feature that other molecular biology for detections current can not be compared.

5, because designed nucleic acid primer is special for the detection of target gene, and signal is through amplifying, so more conventional dyeing process detects more sensitive, has higher discrimination and accuracy.

6, lncRNA PCGEM1 and AR-V7 (AR3) dual combination detects the effective prognosis evaluation and the detection that effectively solve common clinical, has significant clinical economy and social value.

7, increased by RT-PCR method in patient blood sample, the identification for positive findings is more accurate, also more quick and convenient, but need combine other marks and jointly detect, and just can reach higher detection efficiency.As the tumor markers of early diagnosis, compared with ordinary method general at present, there is higher sensitivity and specificity, greatly will shift to an earlier date Diagnostic Time simultaneously, really accomplish early to find, early diagnose.

Accompanying drawing explanation

Accompanying drawing 1 is quantitative PCR detection result.Show that the high expression level of AR-V7 in circulating tumor cell (AR3) becomes remarkable negative correlation with the lifetime of tumour patient.(Antonarakis ES,et al.AR-V7and resistanceto enzalutamide and abiraterone in prostate cancer.The New England journal ofmedicine.2014；371,1028-1038.)

Accompanying drawing 2 is immunohistochemical assay results.Show that PCGEM1 is in tumour, especially express significantly rise in high malignancy and metastatic prostate cancer.

Accompanying drawing 3 is that circulating tumor cell is separated, fluorescence in situ hybridization (PCGEM1) and fluorescence immunocytochemica AR-V7 (AR3).

Accompanying drawing 4 is expression that real-time quantitative PCR detects PCGEM1 and AR-V7 (AR3), and PCGEM1 and AR-V7 (AR3) expression has high correlation.Compare with low-grade malignant tumor, in the tumour of high malignancy, PCGEM1 and AR-V7 (AR3) is induced remarkable rise.

Accompanying drawing 5 is expression that real-time quantitative PCR detects PCGEM1 and AR-V7 (AR3), and PCGEM1 and AR-V7 (AR3) expression has high-positive correlation.

Embodiment

Below in conjunction with accompanying drawing, embodiment provided by the invention is elaborated.

The synthesis of embodiment 1 Auele Specific Primer

Two pairs of nucleic acid primers of two lncRNA PCGEM1 of the present invention, its sequence is as follows:

PCGEM1-5.1(SEQ ID NO.1)：TTTTTGCCCTATGCCGTAAC；

PCGEM1-3.1 (SEQ ID NO.2): GGAGACTCCCAACCTGATGA; Or be

PCGEM1-5.2(SEQ ID NO.3)：GGTAGGCACGTGGAGGACTA；

PCGEM1-3.2(SEQ ID NO.4)：TGCTTTTGTGGGTTTGTTCA。

AR-V7 of the present invention (AR3) two nucleic acid primers, its sequence is as follows:

AR3-5.1(SEQ ID NO.5)：GCAATTGCAAGCATCTCAAA；

AR3-3.1(SEQ ID NO.6)：GGAGGGAGTCAGCAATCAAG。

Embodiment 2

Quantitative PCR detection display (Fig. 1), in circulating tumor cell, the high expression level of AR-V7 (AR3) becomes remarkable negative correlation with the lifetime of tumour patient.(Antonarakis ES,et al.AR-V7 and resistance toenzalutamide and abiraterone in prostate cancer.The New England journal ofmedicine.2014；371,1028-1038.)

Embodiment 3 lncRNA PCGEM1 and AR-V7 detection of expression

Experimental result as shown in Figure 2 and Figure 3.In immunohistochemistry display (Fig. 2) tissue, the high expression level of lncRNAPCGEM1 becomes remarkable positive correlation with malignancy.Immunofluorescence and in situ hybridization detect the expression (Fig. 3) of AR-V7 and lncRNA PCGEM1 in circulating tumor cell.

Experimentation is as follows:

One, immunohistochemistry

(1) sample disposal.

(2) drip the specific antibody of suitably dilution on sample, put in wet box, 37 DEG C are spent the night for 30 ~ 60 minutes or 4 DEG C.

(3) drip the indirect antibody of suitably dilution, put in wet box, 37 DEG C 30 ~ 60 minutes.

(5) PBS washes 2 times, and distilled water washes 1 time.

(6) glycerol buffer mounting, basis of microscopic observation.

(7) contrast dyeing: available blank contrast and negative control etc.

Two, fluorescence in situ hybridization

The pre-treatment such as 1, cell is fixing.

2, hybridize:

1) prepare probe (PCGEM1 probe sequence:

T+T+T+TCCAAAGGG+T+CCGCTGTCCCTG+G+A+G, wherein+be selected from β-D-oxygen-LNA nucleotide analog any one).

2) cell pretreatment;

3) drip 10 μ l probes on the cell of slide, add cover glass;

4) cover wet lid, hatch 12h ~ 16h for 37 DEG C.

Washing after hybridization:

5) tweezers carefully remove cover glass;

6) 43 DEG C of preheating hybridization after washing solution 40ml wash slide 15min;

7) 2 × SSC (37 DEG C) washes twice, each 10min;

8) to put into 1 × PBS of staining jar to be detected in section, do not make chip drying.

Detect:

9) from 1 × PBS, take out slide, remove too much moisture, avoid sample dry.Slide is put into wet box, processes 4 slides simultaneously.

10) the section use 30 μ l ~ 60 anti-DigiTAb of μ l rhodamine or FITC avidin is often opened, incubated at room temperature 20min.

11) remove plastics epiphragma, the staining jar containing 1 × PBS is put in section.3 times are washed, each 2min under 1 × PBS room temperature.

Amplification:

12) from 1 × PBS, take out slide, tilting slide makes liquid discharge;

13) often open slide and drip the anti-avidin antibody of 30 μ l ~ 60 μ l, add plastics epiphragma, incubated at room 20min;

14) remove plastics epiphragma, slide is put into the staining jar containing 1 × PBS.3 times are washed, each 2min under 1 × PBS room temperature;

15) from 1 × PBS, take out slide, tilting section makes liquid discharge;

16) often open slide and drip the anti-avidin antibody of 30 μ l ~ 60 μ l, add plastics epiphragma, incubated at room 20min;

17) 3 times are washed under 1 × PBS room temperature, each 2min.

3, nuclear targeting:

1) often open slide and add 10 μ l ~ 20 μ l DAPI, cover cover glass and at room temperature hatch 2 ~ 5ml;

2) soon as far as possible in fluorescence microscopy Microscopic observation or enclosure ,-20 DEG C of refrigerators are kept at.Cell can be examined under a microscope in 1h after dyeing.

Three, fluorescent in situ immunocytochemistry

(1) sample disposal.

(2) drip the specific antibody of suitably dilution on sample, put in wet box, 37 DEG C are spent the night for 30 ~ 60 minutes or 4 DEG C.

(3) drip the indirect fluorescent antibody of suitably dilution, put in wet box, 37 DEG C 30 ~ 60 minutes.

(5) PBS washes 2 times, and distilled water washes 1 time.

(6) glycerol buffer mounting, fluorescence microscopy Microscopic observation.

(7) contrast dyeing: available blank contrast and negative control etc.

Separation, the real-time quantitative PCR of embodiment 4 circulating tumor cell detect

The invention provides a kind of by real-time quantitative PCR joint-detection lncRNAs PCGEM1 and AR-V7 (AR3) for the diagnostic techniques of the opposing of androgen receptor related neoplasms hormone castration and recurrence and test kit, its technical scheme comprises the steps:

A.lncRNA PCGEM1 primer synthesizes, and primer sequence is as shown in SEQ ID NO.1-4;

B.AR-V7 (AR3) primer synthesizes, and primer sequence is as SEQ ID NO.5-6.

C. circulating tumor cell is separated (the unmarked sorting detection method of circulating tumor cell).

ScreenCell company of France adopts filter film technology (circulating tumor cell (CTCs) unmarked sorting detection method) different from Normocellular in form, size and other physical properties according to tumour cell, carries out fast, efficiently, highly sensitive, to be separated with no damage it.Or adopt immune labeled method to carry out separation detection analysis, as the CellSearch system of Veridex company research and development under Johnson Co., this system has good specificity, sensitivity, accuracy and repeatability, be the technology uniquely obtaining FDA, SFDA certification at present, be widely applied to clinical diagnosis in the U.S..Circulating tumor cell carries out real-time quantitative PCR and detects sample needs separation preparation, mRNA extraction, the conventional processing such as reverse transcription.The present invention combines lncRNAsPCGEM1 and AR-V7 (AR3) two target genes and detects.

D. above-mentioned primer is applied and circulating tumor cell carries out real-time quantitative PCR detection.

E. the invention provides a kind of by associating lncRNA PCGEM1 and AR-V7 (AR3) two target gene detection methods, the diagnostic techniques of resisting for androgen receptor related neoplasms hormone castration and recur and test kit, this test kit includes above-mentioned Auele Specific Primer and real-time quantitative PCR reagent.

F. real-time quantitative PCR detects.

One, the extracting of sample RNA

(1) get the cell of frozen cracking, room temperature is placed and is made it dissolve completely in 5 minutes.

(2) two-phase laminated flow: the chloroform adding 0.2ml in the sample of the TRIZOL reagent cracking of every 1ml, covers tightly pipe lid.Manual thermal agitation body, after 15 seconds, hatches 2 to 3 minutes for 15 to 30 DEG C.Centrifugal 15 minutes of 12000rpm at 4 DEG C.Centrifugal rear mixing liquid will be divided into red phenol chloroform phase, middle layer and the colourless aqueous top layer of lower floor.RNA is all distributed in aqueous phase.60% of the TRIZOL reagent that the volume of aqueous top layer adds when being approximately homogenate.

(3) RNA precipitation: aqueous top layer is transferred in a clean centrifuge tube without RNA enzyme.Add the mixing of equal-volume Virahol with precipitation RNA wherein, after mixing 15 to 30 DEG C hatch 10 minutes after, centrifugal 10 minutes of 12000rpm at 4 DEG C.Now centrifugal front sightless RNA precipitation will form gelatinous precipitate block bottom pipe He on sidewall.

(4) RNA cleaning: remove supernatant liquor, add 75% ethanol (75% ethanol DEPCH2O prepares) of at least 1ml in the sample of every 1mlTRIZOL reagent cracking, cleaning RNA precipitation.After mixing, centrifugal 5 minutes of 7000rpm at 4 DEG C.

(5) RNA is dry: carefully suck most of ethanolic soln, make RNA be deposited in dry 5-10 minute in air at room temperature.

(6) dissolve RNA precipitation: when dissolving RNA, the water 40 μ l rifle first added without RNA enzyme is blown and beaten several times repeatedly, makes it dissolve completely, the RNA solution of acquisition be stored in-80 DEG C stand-by.

Two, sample cDNA synthesizes

(1) collecting cell and sample.

(2) total serum IgE in sample is extracted.Adopt the RNA of Ambion company to extract test kit (AM1560), operate according to test kit specification sheets method.

(3) get the total serum IgE of 100ng, carry out reverse transcription.

Three, the testing gene real-time quantitative PCR of testing sample

(1) all cDNA samples configure real-time quantitative PCR reaction system respectively.

System configurations is as follows:

Table 1

Reactant	Metering
		SYBR Green 1 dyestuff	10μl
Upstream primer	1μl
		Downstream primer	1μl
dNTP	1μl
		Taq polysaccharase	2μl
Testing sample cDNA	5μl
		ddH 2O	30μl
Cumulative volume	50μl

Primer in table above:

Two pairs of nucleic acid primers of lncRNA PCGEM1, its sequence is as follows:

PCGEM1-5.1(SEQ ID NO.1)：TTTTTGCCCTATGCCGTAAC；

PCGEM1-3.1(SEQ ID NO.2)：GGAGACTCCCAACCTGATGA；

Or be

PCGEM1-5.2(SEQ ID NO.3)：GGTAGGCACGTGGAGGACTA；

PCGEM1-3.2(SEQ ID NO.4)：TGCTTTTGTGGGTTTGTTCA。

AR-V7 (AR3) two nucleic acid primers, its sequence is as follows:

AR3-5.1(SEQ ID NO.5)：GCAATTGCAAGCATCTCAAA；

AR3-3.1(SEQ ID NO.6)：GGAGGGAGTCAGCAATCAAG。

Flick at the bottom of pipe and mixed by solution, 6000rpm is of short duration centrifugal.

(2) the PCR reaction soln prepared is placed in the enterprising performing PCR amplified reaction of Realtime PCR instrument.Reaction conditions is: 93 DEG C of 2 minutes denaturations, then by 93 DEG C 1 minute, 55 DEG C 1 minute, 72 DEG C 1 minute, totally 40 to do circulation, last 72 DEG C extend 7 minutes.

4 data analyses

Experimental result as shown in Figure 4, Figure 5, as can be seen from the figure PCGEM1 and AR-V7 (AR3) expresses and has high correlation, compare with low-grade malignant tumor, in the tumour of high malignancy, especially, in tumor of prostate, PCGEM1 and AR-V7 (AR3) is induced remarkable rise.PCGEM1 and AR-V7 (AR3) expresses has high-positive correlation.

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the prerequisite not departing from the inventive method; can also make some improvement and supplement, these improve and supplement and also should be considered as protection scope of the present invention.

Claims (8)

1. long-chain non-coding RNA controls the aborning application of androgen receptor isomer AR3 at the post transcriptional modificaiton that regulation and control pre-mRNA shears, and it is characterized in that, described long-chain non-coding RNA is lncRNAPCGEM1.

2., for detecting the nucleic acid primer of long-chain non-coding RNA and detection androgen receptor isomer AR3, it is characterized in that, described long-chain non-coding RNA is the specificity long-chain non-coding lncRNAPCGEM1 in circulating tumor cell; The nucleic acid primer sequence of described detection long-chain non-coding RNA is

PCGEM1-5.1(SEQ ID NO.1)：TTTTTGCCCTATGCCGTAAC，

PCGEM1-3.1 (SEQ ID NO.2): GGAGACTCCCAACCTGATGA; Or be

PCGEM1-5.2(SEQ ID NO.3)：GGTAGGCACGTGGAGGACTA，

PCGEM1-3.2(SEQ ID NO.4)：TGCTTTTGTGGGTTTGTTCA；

The nucleic acid primer sequence of described detection androgen receptor isomer AR3 is

AR3-5.1(SEQ ID NO.5)：GCAATTGCAAGCATCTCAAA，

AR3-3.1(SEQ ID NO.6)：GGAGGGAGTCAGCAATCAAG。

3. for a lncRNA and AR3 united diagnostic reagent box for circulating tumor cell, it is characterized in that, described united diagnostic reagent box is by Real-time quantitative PCR joint-detection long-chain non-coding RNA and androgen receptor isomer AR3; Described long-chain non-coding RNA is the specificity lncRNAPCGEM1 in circulating tumor cell.

4. united diagnostic reagent box according to claim 3, is characterized in that, the nucleic acid primer sequence of described detection long-chain non-coding lncRNAPCGEM1 is:

PCGEM1-5.1(SEQ ID NO.1)：TTTTTGCCCTATGCCGTAAC，

PCGEM1-3.1 (SEQ ID NO.2): GGAGACTCCCAACCTGATGA; Or be

PCGEM1-5.2(SEQ ID NO.3)：GGTAGGCACGTGGAGGACTA，

PCGEM1-3.2(SEQ ID NO.4)：TGCTTTTGTGGGTTTGTTCA。

5. according to united diagnostic reagent box according to claim 3, it is characterized in that, two nucleic acid primer sequences of described detection androgen receptor isomer AR3 are:

AR3-5.1(SEQ ID NO.5)：GCAATTGCAAGCATCTCAAA；

AR3-3.1(SEQ ID NO.6)：GGAGGGAGTCAGCAATCAAG。

6. the application of the arbitrary described united diagnostic reagent box of claim 3-5 in the castration opposing of preparation diagnosis AR related neoplasms and the reagent of recurrence.

7. application according to claim 6, is characterized in that, described AR related neoplasms is prostate cancer, lung cancer, mammary cancer, carcinoma of testis, cervical cancer or colorectal carcinoma.

8. application according to claim 6, is characterized in that, described AR related neoplasms is prostate cancer.