CN104561273B - Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker - Google Patents

Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker Download PDF

Info

Publication number
CN104561273B
CN104561273B CN201410779917.6A CN201410779917A CN104561273B CN 104561273 B CN104561273 B CN 104561273B CN 201410779917 A CN201410779917 A CN 201410779917A CN 104561273 B CN104561273 B CN 104561273B
Authority
CN
China
Prior art keywords
tobacco product
ilp
lycopene
supernatant
cyclase gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410779917.6A
Other languages
Chinese (zh)
Other versions
CN104561273A (en
Inventor
刘楠
张威
罗安娜
何声宝
王英元
冯晓民
胡清源
邢军
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Tobacco Quality Supervision and Inspection Center
Original Assignee
National Tobacco Quality Supervision and Inspection Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Tobacco Quality Supervision and Inspection Center filed Critical National Tobacco Quality Supervision and Inspection Center
Priority to CN201410779917.6A priority Critical patent/CN104561273B/en
Publication of CN104561273A publication Critical patent/CN104561273A/en
Application granted granted Critical
Publication of CN104561273B publication Critical patent/CN104561273B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the field of research of molecular biology, and in particular relates to a method for identifying a tobacco product by using a lycopene epsilon cyclase gene ILP marker. The method disclosed by the invention comprises the following steps: extracting DNA (Deoxyribonucleic Acid) of a sample to be detected by using a cetyl trimethyl ammonium bromide (CTAB) method; and carrying out PCR (Polymerase Chain Reaction) amplified reaction by taking CTGATGTGTTGCTGTGCTAGG and AATGCACTTCGCAAGCTCTA as upstream and downstream primers respectively, detecting an amplified product through gel electrophoresis after reaction, and judging that the sample is the tobacco product if electrophoretic bands exist at the positions of 450bp and 550bp. Compared with the traditional identification method, the method disclosed by the invention has the advantages of being more objective, more accurate, more reliable and the like.

Description

A kind of with lycopene ε cyclase gene ilp mark, tobacco product is identified Method
Technical field
The invention belongs to molecular biology research field is and in particular to one kind is marked with lycopene ε cyclase gene ilp The method that tobacco product is identified, its using the specificity of tobacco species dna as appraisal basis, with conventional identification method phase Ratio has more objective, more accurate, relatively reliable advantage.
Background technology
Pipe tobacco is difficult to from carrying out diagnostic test in appearance, and with the detection of the chemical compositions such as tobacco specific nitrosamines, nicotine Pipe tobacco to be tested and has following limitation: first, nicotine non-tobacco institute is exclusive, also very normal in other plants of Solanaceae See；Second, the means such as illegal charging easily taken by lawless person are disturbed.In addition, above-mentioned laws and regulations requirement identifier Member not only needs to be grasped the property of raw material of correlation, chemical composition analysis method, sensory evaluating smoking's technology, also need to possess leaf tobacco production and Classification technical ability, the training difficulty of reviewer is big；In addition, the hands such as the dyeing taken with lawless person that go mouldy of pipe tobacco itself Section, also increases the difficulty that reviewer carries out precise Identification.Therefore, rely on the existing method of inspection that pipe tobacco is differentiated, Easily cause erroneous judgement, the generation of misjudgement.
Dna molecular marking technique belongs to molecular biology research category, is even same from dna level differentiation different plant species Selected marker technology between one species Different Individual.Since the eighties in last century, with PCR (pcr) The appearance of technology, the development of dna molecular biology research is swift and violent, as many as existing tens of kinds of current dna molecular marking technique, such as limits Property fragment length polymorphism mark (restriction fragment length polymorphism, rflp) processed, random expansion Increase polymorphism mark (random amplified polymorphic dna, rapd), sequence specific amplification zone marker (sequence characterized amplified regions, scar), Intron Length Polymorphism mark (intron- Length polymorphism, ilp), SNP (single nucleotide polymorphism, snp), Simple sequence repeats mark (simple sequence repeats, ssr) etc..Species mirror is carried out with dna molecular marking technique Fixed, it is based on the tight causality between the dna polymorphism of species and its proterties, can inherence, directly reflection The characteristic planted, carries out species discriminating with it, is not subject to external environment, reviewer's subjective feeling difference, processing conditions and species originally The impact of the factors such as body organ-tissue change.Numerous studies practice it has been shown that in dna molecular level, between different plant species even It is can be distinguished well between same species Different Individual.Dna molecular marking technique identify as species taxonomy one Kind of means, have been widely used between genus, in inter-species, interracial taxonomic identification and affiliation research, almost can be right All of biological species carry out taxonomic identification, with fastest developing speed in current species identification technology, also popular.Table 1 lists Application in all kinds of identifications for the dna molecular marking technique, is not yet had at present and using dna molecular marking technique, tobacco product is carried out The relevant report of identification.
.
Content of the invention
Present invention aim to overcome that prior art defect, there is provided one kind is with lycopene ε cyclase gene ilp mark The method that tobacco product is identified, its using the specificity of tobacco species dna as appraisal basis, with conventional identification method phase Ratio has more objective, more accurate, relatively reliable advantage.
For achieving the above object, the present invention adopts the following technical scheme that
A kind of method tobacco product identified with lycopene ε cyclase gene ilp mark, it includes walking as follows Rapid: to extract the dna of testing sample；Respectively using ctgatgtgttgctgtgctagg, aatgcacttcgcaagctcta as upper and lower Trip primer carries out pcr amplified reaction, and reaction terminates rear detected through gel electrophoresis amplified production, equal at 450 bp, 550 bp positions Electrophoretic band occurs, then judges sample as tobacco product.
Specifically, the dna extraction of described testing sample is specific as follows:
1) take testing sample to be milled into fine powder, put in 2 ml centrifuge tubes；
2) add 600 ~ 800 μ l, the ctab Extraction buffer of 60 ± 5 DEG C of temperature, mix, every 3 ~ 5min gently shakes 2 ~ 5 Secondary, after 20min, 12000 r/min are centrifuged 10 ~ 15 min；
3) Aspirate supernatant, is separately added into and supernatant volume identical phenol, chloroform, mixes, 4 DEG C, 12000 r/min Centrifugation 10 ~ 15 min；
4) Aspirate supernatant, adds isopyknic chloroform, mixes, 4 DEG C, 12000 r/min centrifugation 10 ~ 15 min, repeats Many (typically about 2 ~ 3 times) are secondary occur without to albumin layer；
5) supernatant, -20 DEG C of precipitation 1 ~ 2h, 4 DEG C, 12000 r/min centrifugation 10 ~ 15 min are taken；
6) abandoning supernatant, is washed with 50 ~ 70% ethanol and precipitates 2 times；After (10 ~ 15 mins are typically dried) is dried under room temperature, Save backup in -20 DEG C or -70 DEG C.
Described pcr amplification reaction condition is: 95 DEG C of melting temperature, 30 seconds；55 DEG C of annealing temperature, 30 seconds；Elongating temperature 68 DEG C, 30 seconds；Repeat 35 circulations.
The present invention provides one kind with lycopene ε cyclase gene Intron Length Polymorphism (ilp) mark, to sample is The no method identified for tobacco product；Its with cetyl trimethylammonium bromide (ctab) method first to variant kind After the dna of standard tobacco sample is extracted, pcr amplification is carried out with the primer designed by the present invention, through gel electrophoresis analysis Find: Yunyan201, Yunyan202, cloud and mist 203, Yun yan85, cloud and mist 97, nc297, the big gold dollar of safflower, k326, dark green No. 1, All can specific electrophoretic band (see figure at same position 450 bp, 550 bp in the tobacco sample of multiple kind such as krk26 1)；Illustrate that lycopene ε cyclase gene ilp mark amplification is conservative in tobacco bred, determine that this band is mesh Mark band.Thus, after testing sample being processed using same method, have or not specific electrophoresis depending on it in relevant position Band produces and to judge whether this sample is tobacco product, if that is, testing sample amplifies similar band in same position, Illustrate that this sample is tobacco product；If sample can not amplify similar band in same position, illustrate that this sample is not cigarette Straw-made articles.Additionally, the present invention also adopt same method to green pepper, potato, tomato, oriental plane tree, Korea lawn grass, Euonymus japonicus, Tobacco close relative's species sample such as Chinese rose is processed, and its amplified band all differs (see figure 2) with tobacco product amplified band, enters One step indicates above-mentioned mark and can be used for identifying whether sample is tobacco product.
The present invention adopts lycopene ε cyclase gene sequence information, through this Gene sequence comparison of several species, designs Conservative primer across second introne.Respectively with ctgatgtgttgctgtgctagg and aatgcacttcgcaagctcta As upstream and downstream primer sequence.Ilp mark is emerging molecular labeling, compared with other types of molecular labeling, this category Note has gene specific.Between species, same gene haves the characteristics that structure is similar, and extron is guarded and length of intron and sequence Arrange changeable (Intron Length Polymorphism), the conserved sequence at the larger introne two ends of length change therefore can be selected to be designed with Targetedly primer, avoids the variation zone of gene, and the electrophoretic analysis by pcr product and random sequencing are distinguished from difference The gene of species.After screening through tobacco gene data message, present invention determine that with lycopene ε cyclase gene ilp mark Whether note, be that tobacco product is identified to sample, compared with conventional identification method, it is more objective, accurate, reliable that it has Advantage.
Brief description
Fig. 1 is marked at the pcr amplification electrophoresis result of tobacco species for lycopene ε cyclase gene ilp；
Fig. 2 is marked at the pcr amplification electrophoresis result of tobacco close relative's species for lycopene ε cyclase gene ilp.
Specific embodiment
The present invention is described further by the following examples, but protection scope of the present invention not limited to this.
In following embodiments, the formula of ctab Extraction buffer is: ctab 4g, nacl 16.36 g, 1m tris- hcl 20 ml, 0.5 m edta 8 ml；First with the ddh of 70 ml2O dissolves, then uses ddh2O is settled to 200 ml, sterilizing.
Pcr amplification reaction system is 20 μ l, includes: 10 × buffer 1.6 μ l, mgcl2(25mmol/l) 2 μ l, dntps (2.5 mmol/l each) 1.6 μ l, rtaq enzyme (5 u/ μ l) 0.3 μ l, template dna 0.7 μ l(100 ng/ μ l), upstream and downstream draw Each 1 μ l, the ddh of thing (10 mmol/l)2o 11.8 μl.Pcr amplification reaction condition is: 95 DEG C of melting temperature, 30 seconds；Annealing temperature 55 DEG C of degree, 30 seconds；68 DEG C of elongating temperature, 30 seconds；Repeat 35 circulations.
Embodiment 1
A kind of method tobacco product identified with lycopene ε cyclase gene ilp mark, it includes walking as follows Rapid:
1. ilp design of primers:
Using lycopene ε cyclase gene sequence information, through this Gene sequence comparison of several species, devise across The conservative primer of two intrones.Upstream and downstream primer sequence be respectively ctgatgtgttgctgtgctagg and aatgcacttcgcaagctcta.
2. the dna of extraction testing sample:
1) take testing sample (i.e. case-involving pipe tobacco 1 in Fig. 1) to be milled into fine powder, put in 2 ml centrifuge tubes；
2) add 600 μ l, temperature 60 C ctab Extraction buffer, mix, every 3min gently shakes several times, 20min 12000 r/min centrifugation 10min afterwards；
3) careful Aspirate supernatant, is separately added into and supernatant volume identical phenol, chloroform (each 400 μ l), mixes, 4 DEG C, 12000 r/min be centrifuged 10 min；
4) careful Aspirate supernatant add isopyknic chloroform with supernatant, mixes, 4 DEG C, 12000 r/min centrifugations 10 Min, is repeated 3 times occurring without to albumin layer；
5) supernatant, -20 DEG C of precipitation 1h, 4 DEG C, 12000 r/min centrifugation 10 min are taken；
6) abandoning supernatant, is washed with 50v% ethanol and precipitates 2 times；After 10 min being dried under room temperature, standby in -20 DEG C of preservations With.
3. carried out using ctgatgtgttgctgtgctagg, aatgcacttcgcaagctcta as upstream and downstream primer respectively Pcr amplified reaction, reaction takes the pcr amplified production of 25 μ l to carry out gel electrophoresis analysis, in 450 bp, 550 bp positions after terminating All electrophoretic band (see figure 1) in the place of putting, then judge this sample as tobacco product.
Embodiment 2
A kind of method tobacco product identified with lycopene ε cyclase gene ilp mark, it includes walking as follows Rapid:
1. ilp design of primers:
Using lycopene ε cyclase gene sequence information, through this Gene sequence comparison of several species, devise across The conservative primer of two intrones.Upstream and downstream primer sequence be respectively ctgatgtgttgctgtgctagg and aatgcacttcgcaagctcta.
2. the dna of extraction testing sample:
1) take testing sample (i.e. case-involving pipe tobacco 2 in Fig. 1) to be milled into fine powder, put in 2 ml centrifuge tubes；
2) add 800 μ l, temperature 60 C ctab Extraction buffer, mix, every 5min gently shakes several times, 20min 12000 r/min centrifugation 15min afterwards；
3) careful Aspirate supernatant, is separately added into and supernatant volume identical phenol, chloroform (each 400 μ l), mixes, 4 DEG C, 12000 r/min be centrifuged 15 min；
4) careful Aspirate supernatant, adds isopyknic chloroform, mixes, 4 DEG C, 12000 r/min centrifugation 15 min, repeats 3 times occur without to albumin layer；
5) supernatant, -20 DEG C of precipitation 1h, 4 DEG C, 12000 r/min centrifugation 15 min are taken；
6) abandoning supernatant, is washed with 70v% ethanol and precipitates 2 times；After 15 min being dried under room temperature, standby in -20 DEG C of preservations With.
3. carried out using ctgatgtgttgctgtgctagg, aatgcacttcgcaagctcta as upstream and downstream primer respectively Pcr amplified reaction, reaction takes the pcr amplified production of 25 μ l to carry out gel electrophoresis analysis after terminating, and occurs at 550 bp positions Electrophoretic band, and electrophoretic band (see figure 1) does not occur at 450 bp positions, then judge that this sample is not tobacco product.

Claims (3)

1. a kind of with lycopene ε cyclase gene ilp mark method that tobacco product is identified it is characterised in that carrying Take the dna of testing sample；Drawn using ctgatgtgttgctgtgctagg, aatgcacttcgcaagctcta as upstream and downstream respectively Thing carries out pcr amplified reaction, and reaction terminates rear detected through gel electrophoresis amplified production, all occurs at 450 bp, 550 bp positions Electrophoretic band, then judge sample as tobacco product.
2. the method with lycopene ε cyclase gene ilp mark, tobacco product identified as claimed in claim 1, its It is characterised by, the dna extraction of described testing sample is specific as follows:
1) take testing sample to be milled into fine powder, put in 2 ml centrifuge tubes；
2) add 600 ~ 800 μ l, the ctab Extraction buffer of 60 ± 5 DEG C of temperature, mix, every 3 ~ 5min shakes 2 ~ 5 times, 20min 12000 r/min are centrifuged 10 ~ 15 min afterwards；
3) Aspirate supernatant, is separately added into and supernatant volume identical phenol, chloroform, mixes, 4 DEG C, 12000 r/min centrifugations 10~15 min；
4) Aspirate supernatant, adds isopyknic chloroform, mixes, 4 DEG C, 12000 r/min centrifugation 10 ~ 15 min, repeatedly Occurring without to albumin layer；
5) supernatant, -20 DEG C of precipitation 1 ~ 2h, 4 DEG C, 12000 r/min centrifugation 10 ~ 15 min are taken；
6) abandoning supernatant, is washed with 50 ~ 70% ethanol and precipitates 2 times；After being dried under room temperature, standby in -20 DEG C or -70 DEG C preservations With.
3. the method with lycopene ε cyclase gene ilp mark, tobacco product identified as claimed in claim 1, its It is characterised by, described pcr amplification reaction condition is: 95 DEG C of melting temperature, 30 seconds；55 DEG C of annealing temperature, 30 seconds；Elongating temperature 68 DEG C, 30 seconds；Repeat 35 circulations.
CN201410779917.6A 2014-12-17 2014-12-17 Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker Active CN104561273B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410779917.6A CN104561273B (en) 2014-12-17 2014-12-17 Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410779917.6A CN104561273B (en) 2014-12-17 2014-12-17 Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker

Publications (2)

Publication Number Publication Date
CN104561273A CN104561273A (en) 2015-04-29
CN104561273B true CN104561273B (en) 2017-01-18

Family

ID=53078347

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410779917.6A Active CN104561273B (en) 2014-12-17 2014-12-17 Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker

Country Status (1)

Country Link
CN (1) CN104561273B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113549639B (en) * 2021-07-21 2022-07-29 云南中烟工业有限责任公司 Regulatory gene for reducing contents of total proteins and phenol in flue gas of tobacco leaves

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103160505B (en) * 2013-03-12 2014-09-24 四川农业大学 Corn wrky gene intron length polymorphism molecular marker
CN103695418B (en) * 2013-12-25 2017-04-26 四川农业大学 Maize phosphate starvation responses intron length polymorphism marker for corn
CN104152475B (en) * 2014-08-18 2019-08-16 中国烟草总公司郑州烟草研究院 Tobacco ε-lycopene cyclase gene and its application

Also Published As

Publication number Publication date
CN104561273A (en) 2015-04-29

Similar Documents

Publication Publication Date Title
CN113549704B (en) Tobacco genus specific molecular marker for identifying tobacco and non-tobacco and application thereof
CN107164459B (en) Functional marker for identifying and screening tea trees with high catechin indexes and application of functional marker
CN103451288B (en) Primer and detection kit for detecting seven types of chicken eimeria tenella
CN109468409A (en) A kind of powdery mildew resistance gene in wheat Pm2b high throughput detection label and its application
CN107365845A (en) For detecting the gene marker, kit and lung cancer detection method of lung cancer
CN108588249B (en) Primer pair for detecting sweet potato stem rot bacteria and detection method thereof
CN104073550B (en) A kind of SCAR molecular marker differentiating Fructus Momordicae sex
Rajendrakumar et al. A mitochondrial repeat specific marker for distinguishing wild abortive type cytoplasmic male sterile rice lines from their cognate isogenic maintainer lines
CN103898228B (en) A kind of molecule marker identifying tobacco PVY resistance
CN108018359A (en) A kind of molecular labeling and its application for being used to identify cherry valley duck
CN104561273B (en) Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker
CN102796825B (en) Specificity polymerase chain reaction (PCR) method for detecting heterodera elachista ohshima
CN104673790A (en) Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method
Fu et al. Rapid and quantitative detection of Leifsonia xyli subsp. xyli in sugarcane stalk juice using a real‐time fluorescent (TaqMan) PCR assay
Skolotneva et al. The gene Sr38 for bread wheat breeding in Western Siberia
CN104120124B (en) SCAR marker for specifically detecting wheat stripe rust and detection method
CN105713983B (en) A kind of molecular labeling and its application with rice Jiangnan evening neck blast resistance gene close linkage
CN104480211B (en) Differentiate molecular specificity labeled primers and the method for Taxus mairei seedling
CN104120125B (en) Specific SCAR marker for detecting wheat stripe rust
CN104962646A (en) Method for identifying tobacco raw materials by applying FMYYSSR-5 marker
CN105349550B (en) The molecular labeling Insert144 of Soybean Resistance epidemic disease gene RpsQ and its application
Sae-Eung et al. DNA methylation and genetic diversity analysis of genus Cycas in Thailand
CN109161605A (en) The development and application of the SNP marker of rice blast resistant gene Pi1
CN105063184A (en) Method for identifying tobacco raw materials by adopting FMYYSSR-3 marker
CN105200141B (en) The method for identifying molecules and primer of a kind of cun of three lotus typical case's strains

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant