CN104561055A - Tetranychus cinnabarinus cytochrome p450 gene and application thereof - Google Patents
Tetranychus cinnabarinus cytochrome p450 gene and application thereof Download PDFInfo
- Publication number
- CN104561055A CN104561055A CN201510014116.5A CN201510014116A CN104561055A CN 104561055 A CN104561055 A CN 104561055A CN 201510014116 A CN201510014116 A CN 201510014116A CN 104561055 A CN104561055 A CN 104561055A
- Authority
- CN
- China
- Prior art keywords
- gene
- spider mite
- carmine spider
- cotton
- cytopigment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a tetranychus cinnabarinus cytochrome p450 gene. The cDNA base sequence of the tetranychus cinnabarinus cytochrome p450 gene comprises the sequence shown in SEQ ID NO. 1. The invention also provides an amino acid sequence and a dsRNA sequences corresponding to the cDNA base sequence, as well as a recombinant expression vector, a transgenic cell line, a recombinant strain and an expression kit associated with the gene. The tetranychus cinnabarinus cytochrome p450 gene is used for cultivating transgenic cotton or can be used for preparing products for prevention and treatment of tetranychus cinnabarinus. After the tetranychus cinnabarinus eats the transgenic cotton, the expression amount of the in-vivo gene is significantly decreased, the egg laying amount is also significantly reduced which shows that more serious fitness cost exists. The tetranychus cinnabarinus cytochrome p450 gene provides novel genetic resource for the development on anti-mite transgenic plants and provides a new way for scientific and effective prevention of tetranychus cinnabarinus.
Description
Technical field
The present invention relates to insect physiology and biological technical field, particularly relate to a carmine spider mite cytochrome P450 gene and the application for the initiative of transgenosis anti-mite cotton thereof.
Background technology
Carmine spider mite another name two-spotted spider mite, cotton spider mites, tetranychus telarius, all have distribution all over the world, all have generation in areas such as China North China, East China, Central China, south China, northeast.This mite is the various crop such as a kind of polyphagous Agricultural Mites, main harm cotton, beans, Solanaceae class and corn.Carmine spider mite individuality is very little, and naked eyes are difficult to find; Have extremely strong fecundity, under suitable growing environment, egg laying amount is many; Generation cycle is short, just can form rapidly the population of some amount at short notice.Carmine spider mite is mainly assembled at plant blade back and vein both sides, inhales plant juice, and forms silk screen, make blade chlorisis gradually of being injured, form numerous white spot, cause serious injury plant tissue with lancet thorn.In field, plant leaf can be caused when cowpea seedlings is serious to dry up completely and to come off, dead even in flakes, cause serious financial loss.For many years exactly chemical agent is used to the most effectively preventing method of carmine spider mite.To late nineteen eighties in last century, carmine spider mite at least creates resistance to 25 kinds of Insecticidal and acaricidal agents (Multiple Pesticides of organochlorine, organophosphorus, organic nitrogen and pyrethroid).The generation of carmine spider mite resistance makes to become more difficult to its control.
Cotton is most important natural fiber crop, and China is Raw cotton production maximum in the world and country of consumption.Insect pest is one of key factor affecting cotton good quality and high output.The output of cotton loss that China causes because of insect pest is every year about 10%-15%, and the whole nation accounts for 2/3 of sterilant use total amount for the sterilant consumption of cotton-plant pest-insects control every year.1997, the transgenic pest-resistant Bt cotton from the U.S. started at China's popularizing planting, and Bt cotton controls the harm of bollworm well, made the Pesticide use amount of cotton reduce about 65%.Wu Kongming etc. (2008) analyze the population situation of bollworm between north of China six province 1992 to 2007, find the plantation along with Bt cotton, and the population quantity of bollworm has to show and reduces.Along with Bt is cotton at the large-area popularizing planting of China, the insect of some natural disposition is as cotton spider mites, and the population quantities such as cotten aphid rise year by year, progressively become the important pests in cotton planting process.
Carmine spider mite, as the important pests of cotton, seems very to the control of its scientific and efficient important.There is many problems, as agricultural chemicals " 3R " problem in the traditional chemical prevention and control method of carmine spider mite.For the control of carmine spider mite in the urgent need to new control strategy, such as excavate and identify the gene of anti-mite and carry out the initiative of plant novel material and carmine spider mite biological control by the RNA perturbation technique of mediated plant.The RNA perturbation technique of mediated plant is as one of the engineering focus of farm crop anti insect gene, by expressing the double-stranded RNA (dsRNA) of target pest specific gene in host plant, after pests plant its correspondence reticent important gene thus reach the object of Control pests harm.
Cytochrome P450 reductase is as the important superfamily metabolic detoxification enzyme of the class in tetranychid body, and in such gene pairs carmine spider mite body, the metabolic detoxification of toxic substance plays very large effect.Gossypol is the important secondary metabolite that cotton produces, and on the one hand, is the poisonous allogenic material of a class for gossypol tetranychid or insect, tetranychid or insect's food-taking gossypol take food ability later, viability and reproductivity reduce, and growth is suppressed, and serious is even dead; On the other hand, tetranychid and insect can rely on the metabolic detoxification enzyme system of self to be non-toxic substance by gossypol metabolism, thus cotton of successfully causing harm.
Summary of the invention
The object of this invention is to provide a kind of carmine spider mite cytopigment p450 gene, its cDNA base sequence comprises the sequence shown in SEQID NO.1, and described sequence is amino acid whose nucleotide sequence shown in coding SEQ ID NO.2.
The present invention also protects the recombinant expression vector with this gene-correlation, transgenic cell line, recombinant bacterium and expression cassette.Recombinant expression vector, transgenic cell line, recombinant bacterium and expression cassette can be used for the application in carmine spider mite control: 1, prevent and treat tetranychid, 2, the relevant product of tetranychid is prevented and treated, 3, the egg laying amount of carmine spider mite is suppressed, 4, the development duration of carmine spider mite is disturbed, 5, suppress the expression of carmine spider mite cells in vivo cytochrome p 450 gene.
The present invention is by taking food the order-checking of cowpea seedling host plants different from cotton seedling laggard line number word gene expression profile to carmine spider mite, according to meeting simultaneously, differential expression multiple is greater than 6 times, gene expression abundance is more than 15 and have removing toxic substances and the standard of digestive function is screened, and obtains one and adapts to the important cells cytochrome p 450 gene (tcCYP1) that carmine spider mite takes food cotton.After carmine spider mite takes food cotton seedling, this gene (tcCYP1) raises multiple more than 8 times, and gene expression abundance (RPKM) is more than 16.Obtained the overexpression of tcCYP1 gene by express spectra order-checking, illustrate that this gene takes food adaptation cotton plants for carmine spider mite very important.
The present invention obtains the full length sequence of cytochrome P450 gene (tcCYP1) by cloning and sequencing, and utilizes mediated plant RNAi technology cotton by cultivating anti-mite in the dsRNA of this gene importing cotton plants body.
The dsRNA sequence that the present invention protects described cytochrome P450 gene corresponding, it comprises the sequence shown in SEQ ID NO.3 or fragment sequence.
The present invention also protects aminoacid sequence and the application of dsRNA sequence in preventing and treating at carmine spider mite thereof of described cytochrome P450 gene, its correspondence.Can be used for the cultivation of transfer-gen plant, or for the preparation of control carmine spider mite product.Wherein, described transfer-gen plant is preferably transgenic cotton.
Described dsRNA is directly by feed or other modes import in carmine spider mite body, and its egg laying amount is declined, and development duration is affected, and reproduction is unfavorable.
By finding the entry evaluation of transgenic cotton, after carmine spider mite takes food transgenic cotton, in its body, the expression amount of this gene significantly reduces, and egg laying amount also significantly declines, the normal development duration of interference carmine spider mite, make its reproductive growth unfavorable, show to there is more serious fitness cost.The suppressed rear impact on carmine spider mite vital movement of this gene of explanation carmine spider mite that the present invention is dry straight, also illustrates that this gene takes food the importance adapting to cotton for carmine spider mite simultaneously.
The anti-mite transgenic plant initiative that is found to be of carmine spider mite cytochrome P450 gene (tcCYP1) function provides new genetic resources, for scientific and effective control carmine spider mite provides a new way.For the control of carmine spider mite, the RNAi technology of mediated plant can be utilized to cultivate the transgenic cotton of expression carmine spider mite tcCYP1 gene dsRNA, this transgenic cotton can play good control effects to carmine spider mite the develop of the population, the environmental problem that chemical prevention brings can be reduced, reduce the financial loss because tetranychid harm cotton brings simultaneously.
Accompanying drawing explanation
Fig. 1 is the Total RNAs extraction electrophorogram of carmine spider mite;
Fig. 2 is the expression that carmine spider mite takes food different host's cowpea (V-TC) and cotton (G-TC) tcCYP1 gene afterwards;
Fig. 3 is that expression vector comprises the GUS:NPTII gene of 2X35S startup and the P450RNAi element of 35S startup;
Fig. 4 is transgene cotton and non-transgenic cotton tissue chemical staining; Wherein, A: wild type cotton blade B: transgene cotton blade;
Fig. 5 is the quantitative expression situation that carmine spider mite takes food tcCYP1 gene after the cotton next generation of transgenic cotton and non-transgenic.
Embodiment
Below in conjunction with the embodiment in the present invention and accompanying drawing, be clearly and completely described the technical scheme in the embodiment of the present invention, obviously, described embodiment is only the present invention's part embodiment, instead of whole embodiments.Based on the embodiment in the present invention, those of ordinary skill in the art, not making the every other embodiment obtained under creative work prerequisite, belong to the scope of protection of the invention.
The experimental technique used in following embodiment is ordinary method without specified otherwise.
The experiment consumptive material etc. used in following embodiment all can be bought from commercial use without specified otherwise.
The carmine spider mite used in following embodiment specific to plant protection institute of Southwestern University agricultural chemicals toxicity and science applied research room sensitive strain (indoor cowpea seedling as examination host raise more than 15 years; Rearing conditions is temperature: 26 ± 1 DEG C, relative humidity: 35%-55%, periodicity of illumination 14:10 (L:D)).Take food the carmine spider mite of cotton by the carmine spider mite alternate hose gained taking food cowpea seedling, rearing conditions is consistent.
Embodiment 1:
Utilize express spectra to check order to compare the changing conditions (screening of gene) that carmine spider mite takes food cowpea and takes food gene after cotton
First the carmine spider mite (at laboratory rearing more than 15 years, period does not contact any medicament to this mite) taking food cowpea seedling of indoor feeding is transferred on the cotton seedling of indoor plantation by the present invention.Take food cotton seedling after 50 days, collect the extraction of carmine spider mite for total serum IgE that host is cowpea seedling (V-TC) and cotton seedling (G-TC) respectively.V-TC and the G-TC total serum IgE of then entrusting Hua Da gene pairs to extract carries out express spectra order-checking.Finally by express spectra data analysis, relative to V-TC, in G-TC, find the gene more than 500 differential expressions.The differential gene of acquisition is compared and functional annotation simultaneously, and carry out gene Clustering according to difference in functionality.Then from 500 difference expression genes, according to meeting simultaneously, differential expression multiple is greater than 6 times, gene expression abundance is more than 15 and have removing toxic substances and the standard of digestive function is screened.Obtain a gene met the demands eventually through screening, this gene upregulation multiple more than 8 times, gene expression abundance (RPKM) more than 16, there is the cytochrome P450 gene of detoxification, called after tcCYP1.
Embodiment 2: the total length of clone tcCYP1 gene
The extraction of 1 total serum IgE
Trizol method is adopted to extract the total serum IgE (operation steps is carried out according to the specification sheets of Trizol extraction total serum IgE completely) of carmine spider mite.Extract electrophorogram and the results are shown in Figure 1.
The synthesis of 2cDNA Article 1 chain.
Operation steps is carried out according to TAKARA company PrimeScript II 1st Strand cDNA Synthesis Kit (D6210A) specification sheets completely.
3 full length gene pcr amplifications
Primer5 software design specific primer sequences
TcCYP1-Forward：ATGTTGCTTCTTGATTACTTTAGTG
TcCYP1-Reverse：CGAAAAAATTTCCTTTTAA
The reagent of polymerase chain reaction is composed as follows:
The condition of polymerase chain reaction is as follows:
The purifying of the PCR primer that 4 amplifications obtain
Operation steps reclaims test kit according to TAKARA company glue completely and completes.
5 Clone and sequences
Be linked to by goal gene on carrier, transform, shake bacterium, be coated with spot, choose spot, bacterium liquid detects, and delivers to Hua Da gene sequencing.(used carrier is the pGEM-T Easy Vector SystemI of promega company, and operates according to test kit specification sheets; Trans1-T1Chemically Competent Cell specification sheets with reference to TransGen Biotech company transforms; Choosing spot is the hickie that picking has goal gene; The reagent proportioning that bacterium liquid detects is cloned the same with reaction conditions with full length gene.)
TcCYP1 gene cDNA total length is as follows, is labeled as SEQ ID NO.1:
ATGTTGCTTCTTGATTACTTTAGTGAACCATCGCCTATCATGTACTTGTTTTTGAGTCTATCTACTATTTGGATCATCAAATATCTTTACCAATCTGTGAAACGCTTATATTCATTACCTCCAGGACCATTTGGAATTCCGATTTTTGGTTACTACCCGTTCTTGAAACATCACAGTTATATACAATTTGATCAACTATCCAAGAAGTATGGACCAGTTTTCAGTCTAAAGTTGGGTCAATTTGATACTTTTGTTGTCTGTGGTTGGGATAACCTTAAAGACGCCTTTGCAAATGATGCTTTATTGGCTCGTCCTGCTAAAGGTTTCATATCAGGAATAGAGAACACGCTTTCAGTTATTTCAATGTCGGGTGATGCTTGGCGTGAACACAGACGCTTATCATTACATGTTTTGCGTAATGTTGGTTTAGGTAAACGAGAAATGGAAACTTTGATCTCGGAAGAAATTCATCAATTTTTGTCTTCACTTGAAACTAATGTAATTGACTTGCCTGAACGTCAAATGCCAAGTGTTTCTAATAACATTTCAGCTCTTTTATTTGGTCACATATTTGATTATAATGATCCAGAAAAAGTATCAACTGGTCAAATTGTTGCGAGACTCTGTAACATTTTCCAATTCACTGGAATAACAAGCTACTTACCATGGTTAACTAAACCTCTAATTTTTTTGGGTAAAGCTAATCTTAAAATTATTCAAAAAGCTCAAATGCATTTAAACGAATTCATTTCGAGAGAGGTGTCGAAACATAAAAATAAAGTGGATTCAACAGAAATTGAAGACTATATTGATGGATACTTAAATGTCCAATCCAAAAGGAAAGATGAAATATTCAATGATAATGTATTGAGAAGAAATGTTATTACTTTCTTTGTTGCTGGATCAGAAACAGTCACTAGTACTCTGACTTGGGCAATTATGTATCTCGTCCAGTATCCTCAATATCAAGAGAAGATTCGCTCAGAGATAAAAGAAGCCATTGGAACTGAAAAGAGACCAGATTTCTCTGATCGTCAAAAGATGCCTTTTACTTTAGCCTTTCTTTATGAAGTCCAGCGTATTGAATCTATCGTCGCTACAAATCTTATACGAAGAGCTTCTCAAGACACAAAGATTGGTCCTTATAATGTTCCAAAAGATAGTCTGGTTCTGTTCAATTTCTGGTCCGTCCATCATGATCCCAAACTGTGGCCTAATCCTGATAAATTTGATCCAAATCGATTCCTTACTGATAATGGTACCAAAGTAGTAAAGCCTCCGTATCTAGTCCCATTTAGTGCTGGTAAAAGAGCTTGTCCAGGCGAAGGCTTAGCTAACGTGGAGCTATTTCTGTACACAGTTGGTATACTTCAACGATTCAAAATCAAATCAGATAAACCTTTATCATTTGAAGCAATCAATGGTCTCACTCGACGTCCAAAATACAAACCAGATTTAATCTTCGAAAAAATTTCCTTTTAA。
The aminoacid sequence of carmine spider mite cytochrome P450 gene (tcCYP1), as shown in SEQ ID NO.2:
MLLLDYFSEPSPIMYLFLSLSTIWIIKYLYQSVKRLYSLPPGPFGIPIFGYYPFLKHHSYIQFDQLSKKYGPVFSLKLGQFDTFVVCGWDNLKDAFANDALLARPAKGFISGIENTLSVISMSGDAWREHRRLSLHVLRNVGLGKREMETLISEEIHQFLSSLETNVIDLPERQMPSVSNNISALLFGHIFDYNDPEKVSTGQIVARLCNIFQFTGITSYLPWLTKPLIFLGKANLKIIQKAQMHLNEFISREVSKHKNKVDSTEIEDYIDGYLNVQSKRKDEIFNDNVLRRNVITFFVAGSETVTSTLTWAIMYLVQYPQYQEKIRSEIKEAIGTEKRPDFSDRQKMPFTLAFLYEVQRIESIVATNLIRRASQDTKIGPYNVPKDSLVLFNFWSVHHDPKLWPNPDKFDPNRFLTDNGTKVVKPPYLVPFSAGKRACPGEGLANVELFLYTVGILQRFKIKSDKPLSFEAINGLTRRPKYKPDLIFEKISF-
6 goal gene annotations
The goal gene sequence of acquisition is carried out blast comparison and phylogenetic analysis at NCBI, and finding that the P450 gene of this gene and different plant species gathers is a class; The base sequence of goal gene obtained according to sequencing result again and aminoacid sequence are analyzed further, find that this gene has the feature tag sequence F**G*R***G of P450 gene, finally determine that the goal gene (tcCYP1) obtained is the P450 gene of in carmine spider mite body.
Embodiment 3: gene differential expression is verified
The extraction of 1 total serum IgE
The specification sheets that operation steps extracts total serum IgE according to Trizol completely carries out.
The synthesis of 2 cDNA templates
Operation steps is completely with reference to TaKaRa PrimeScriptTM RT reagent Kit with gDNA Eraser test kit
3 quantitative fluorescent PCRs
The quantitative primer specific sequence of Primer 3 software design:
F-qtcCYP1:CGCCTTCGCAAATGATGCTT
R-qtcCYP1:TAACCGTCTGTGTTCACGCC
System proportioning is as follows:
Program:
The CT value obtained according to the qPCR result differential expression multiple obtaining gene that carries out converting (uses 2
-△ △ ctmethod calculates), result shows the up-regulated expression that this gene taking food cotton for the carmine spider mite taking food cowpea has more than 6 times, and this result is consistent in expression trend with express spectra result.
Embodiment 4, utilize mediated plant RNAi technology cultivate transgenic cotton
1dsRNA synthesizes
The present invention utilizes kit box to synthesize the complementary RNA of tcCYP1 gene outward.Operation steps completes according to the TranscriptAid T7 High Yield Transcription kit test kit specification sheets of Thermo company completely.
The dsRNA complementary sequence of tcCYP1 gene is as follows, is labeled as SEQ ID NO.3:
TGAACCATCGCCTGTCATTTACTTGTTCTTGAGTCTGTCTACTATTTGGATCATCAAATATCTTTACCAATCTGTGAAACGCTTATATTCATTACCACCAGGACCATTTGGAATTCCAATATTTGGTTATTACCCGTTCTTGAAACATCACAG
2 expression vector establishments
Inside expression vector dsRNA being imported to structure, this expression vector contains 2X35S, the GUS:NPTII gene of startup, the dsRNA complementary sequence of the tcCYP1 gene that 35S starts etc. (Fig. 3).
3 channel genes checkings
After the present invention successfully obtains transgenic cotton, carry out Coloration experiment (Fig. 4) to the transgenic cotton obtained, genetically modified cotton can be dyeed, but not transgenic cotton can not dye.Coloration experiment successfully illustrates that the dsRNA of our goal gene tcCYP1 gene has successfully imported in cotton plants body.
4qPCR verifies genetic expression
Utilize fluorescent quantitative PCR technique to detect expression (reaction conditions, method of calculation etc. are the same with above-mentioned fluorescent quantitation method for the step of operation, reagent proportioning) that carmine spider mite takes food tcCYP1 gene after transgenic cotton.
First, after allowing carmine spider mite take food transgenosis and a not genetically modified cotton leaf generation respectively, mite is carried out collect the extraction being used for total serum IgE, then utilize the expression of fluorescent quantitation method testing goal gene.By final calculating, we find relative to taking food for normal conon, and it is significantly suppressed that carmine spider mite takes food the expression of tcCYP1 gene after a transgenic cotton generation, the down-regulated expression of this gene 30%, and have significant difference (Fig. 5).
5 assessment transgenic cottons are on the impact of carmine spider mite vital movement
Utilize birth and death coefficient to assess carmine spider mite and take food impact on its vital movement after transgenic cotton.
First utilize punch tool to break in the blade of transgenic cotton and non-transgenic cotton circular leaf butterfly that diameter is 2 centimetres, then female for carmine spider mite one-tenth mite is transferred on leaf butterfly, allow after its 24h of laying eggs and female one-tenth mite is chosen away, each leaf butterfly retains an ovum, and then every day, routine observation record took food the vital movement change of transgenosis and the cotton carmine spider mite of non-transgenic.Final result display, after carmine spider mite takes food transgenic cotton blade, its egg laying amount is compared and is taken food non-transgenic cotton and have significant reduction, reduce about 23/female (take food normal conon about 69/female, take food transgenic cotton about 46/female) (table 1).After carmine spider mite takes food the blade turning tcCYP1 gene dsRNA, compare and take food the cotton fitness of non-transgenic and be reduced to 0.73 (table 2), show the reproductive development being unfavorable for carmine spider mite after carmine spider mite takes food transgenic cotton, there is obvious fitness cost.
Table 1: carmine spider mite takes food and turns different development duration and reproductive parameters after transgenic cotton and non-transgenic cotton
| The ovum phase | Children mite | If mite | Preoviposition period | Generation time | Spawning time | Mean lifetime | Eggs on average amount |
| Non-transgenic is cotton | 4.31±0.09a | 2.04±0.13a | 3.73±0.13a | 1.12±0.08a | 11.19±0.18ab | 13.81±1.24a | 25.00±1.21a | 69.38±7.80a |
| Transgenic cotton | 4.21±0.08a | 2.17±0.12a | 3.96±0.11a | 1.13±0.09a | 11.46±0.20b | 12.29±0.83a | 23.75±0.85a | 46.04±5.28b |
Note: after numeral, lowercase identical table is shown in 95% horizontal there was no significant difference.
Table 2: carmine spider mite takes food and turns reproductive parameters after transgenic cotton and non-transgenic cotton
| Rn | T | γ m | λ | Tb | Rf | |
| Non-transgenic is cotton | 56.68 | 15.94 | 0.25 | 1.28 | 2.74 | __ |
| Transgenic cotton | 41.13 | 15.36 | 0.24 | 1.27 | 2.87 | 0.73 |
Wherein, Rn is clean rate of increase, and T is generation cycle number, γ
mfor intrinsic rate of increase, λ is finite rate of increase, and Tb is population doubling time, and Rf is fitness cost.
Above-mentioned embodiment is intended to illustrate that the present invention can be professional and technical personnel in the field and realizes or use; modifying to above-mentioned embodiment will be apparent for those skilled in the art; therefore the present invention includes but be not limited to above-mentioned embodiment; any these claims or specification sheets of meeting describes; meet and principle disclosed herein and novelty, the method for inventive features, technique, product, all fall within protection scope of the present invention.
Claims (10)
1. a carmine spider mite cytopigment p450 gene, is characterized in that, its cDNA base sequence comprises the sequence shown in SEQ ID NO.1.
2. carmine spider mite cytopigment p450 gene according to claim 1, is characterized in that, is amino acid whose nucleotide sequence shown in coding SEQ ID NO.2.
3. the recombinant expression vector containing gene described in claim 1 or 2, transgenic cell line, recombinant bacterium and expression cassette.
4. the application of carmine spider mite cytopigment p450 gene as claimed in claim 1 or 2 in carmine spider mite control.
5. the application of carmine spider mite cytopigment p450 gene according to claim 4 in carmine spider mite control, it is characterized in that, described carmine spider mite cytopigment p450 gene is used for the cultivation of transfer-gen plant, or for the preparation of control carmine spider mite product.
6. the application of carmine spider mite cytopigment p450 gene according to claim 5 in carmine spider mite control, it is characterized in that, described transfer-gen plant is transgenic cotton.
7. the dsRNA sequence that cytochrome P450 gene as claimed in claim 1 is corresponding, is characterized in that, it comprises the sequence shown in SEQ ID NO.3 or fragment sequence.
8. the carmine spider mite cytopigment p450 gene pairs as claimed in claim 7 application of dsRNA sequence in carmine spider mite control of answering.
9. the application of the carmine spider mite cytopigment p450 gene pairs according to claim 8 dsRNA sequence of answering in carmine spider mite control, it is characterized in that, the described carmine spider mite cytopigment p450 gene pairs dsRNA sequence of answering for the cultivation of transfer-gen plant, or for the preparation of control carmine spider mite product; Described transfer-gen plant is transgenic cotton.
10. the application of the carmine spider mite cytopigment p450 gene pairs according to claim 9 dsRNA sequence of answering in carmine spider mite control, it is characterized in that, the control carmine spider mite product containing described dsRNA is directly imported in carmine spider mite body by feed mode.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510014116.5A CN104561055B (en) | 2015-01-12 | 2015-01-12 | A kind of Tetranychus cinnabarinus cytochromes p450 genes and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510014116.5A CN104561055B (en) | 2015-01-12 | 2015-01-12 | A kind of Tetranychus cinnabarinus cytochromes p450 genes and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104561055A true CN104561055A (en) | 2015-04-29 |
| CN104561055B CN104561055B (en) | 2018-03-27 |
Family
ID=53078133
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510014116.5A Expired - Fee Related CN104561055B (en) | 2015-01-12 | 2015-01-12 | A kind of Tetranychus cinnabarinus cytochromes p450 genes and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104561055B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106818851A (en) * | 2017-01-06 | 2017-06-13 | 河南科技学院 | A kind of method of utilization RNA interference prevention red fire ants and the reduction drug-fast application of red fire ant |
| CN107279143A (en) * | 2017-07-12 | 2017-10-24 | 山东棉花研究中心 | A kind of miticide composition containing gossypol |
| CN110066799A (en) * | 2019-04-23 | 2019-07-30 | 西南大学 | Target dsRNA and the application of Tetranychus cinnabarinus molting hormone acceptor gene EcR |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030041346A1 (en) * | 1997-03-07 | 2003-02-27 | Halkier Barbara A. | Cytochrome P450 monooxygenases |
| CN102648283A (en) * | 2009-09-29 | 2012-08-22 | 淡马锡生命科学研究院有限公司 | Control of pests in plants |
| CN102776189A (en) * | 2012-06-18 | 2012-11-14 | 中国农业科学院作物科学研究所 | Cytochrome P450 dsRNA (double-stranded ribonucleic acid) and application to aphid growth inhibition |
| CN104059931A (en) * | 2014-07-03 | 2014-09-24 | 西南大学柑桔研究所 | RNA interference vector of bactrocera dorsalis cytochrome P450 genes and construction method and application thereof |
-
2015
- 2015-01-12 CN CN201510014116.5A patent/CN104561055B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030041346A1 (en) * | 1997-03-07 | 2003-02-27 | Halkier Barbara A. | Cytochrome P450 monooxygenases |
| CN102648283A (en) * | 2009-09-29 | 2012-08-22 | 淡马锡生命科学研究院有限公司 | Control of pests in plants |
| CN102776189A (en) * | 2012-06-18 | 2012-11-14 | 中国农业科学院作物科学研究所 | Cytochrome P450 dsRNA (double-stranded ribonucleic acid) and application to aphid growth inhibition |
| CN104059931A (en) * | 2014-07-03 | 2014-09-24 | 西南大学柑桔研究所 | RNA interference vector of bactrocera dorsalis cytochrome P450 genes and construction method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| SHI,L，ET AL: "Tetranychus cinnabarinus cytochrome P450 mRNA", 《GENBANK》 * |
| ZHIFENG XU ET AL: "ANALYSIS OF INSECTICIDE RESISTANCE-RELATED GENES OF THE CARMINE SPIDER MITE TETRANYCHUS BASED ON A DE NOVO ASSEMBLED TRANSCRIPTOME", 《PLOS ONE》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106818851A (en) * | 2017-01-06 | 2017-06-13 | 河南科技学院 | A kind of method of utilization RNA interference prevention red fire ants and the reduction drug-fast application of red fire ant |
| CN107279143A (en) * | 2017-07-12 | 2017-10-24 | 山东棉花研究中心 | A kind of miticide composition containing gossypol |
| CN110066799A (en) * | 2019-04-23 | 2019-07-30 | 西南大学 | Target dsRNA and the application of Tetranychus cinnabarinus molting hormone acceptor gene EcR |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104561055B (en) | 2018-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Birnbaum et al. | Transcriptional profile and differential fitness in a specialist milkweed insect across host plants varying in toxicity | |
| CN103201385A (en) | Down-regulating gene expression in insect pests | |
| Chin et al. | Longitudinal transcriptomic, proteomic, and metabolomic analyses of Citrus sinensis (L.) Osbeck graft-inoculated with “Candidatus Liberibacter asiaticus” | |
| Numan et al. | Alternative strategies for multi-stress tolerance and yield improvement in millets | |
| Zhang et al. | Intercropping with aromatic plants increased the soil organic matter content and changed the microbial community in a pear orchard | |
| Zhang et al. | Identification of cytochrome P450 monooxygenase genes and their expression in response to high temperature in the alligatorweed flea beetle Agasicles hygrophila (Coleoptera: Chrysomelidae) | |
| Xu et al. | The effect of D123 wheat as a companion crop on soil enzyme activities, microbial biomass and microbial communities in the rhizosphere of watermelon | |
| Florio et al. | A SmelAAT acyltransferase variant causes a major difference in eggplant (Solanum melongena L.) peel anthocyanin composition | |
| Xu et al. | Silencing of a lipase maturation factor 2‐like gene by wheat‐mediated RNAi reduces the survivability and reproductive capacity of the grain aphid, Sitobion avenae | |
| Markovich et al. | Arabidopsis thaliana plants with different levels of aliphatic-and indolyl-glucosinolates affect host selection and performance of Bemisia tabaci | |
| Hunter et al. | Optimizing efficient RNAi-mediated control of hemipteran pests (Psyllids, leafhoppers, whitefly): modified pyrimidines in dsRNA triggers | |
| Koul et al. | Chickpea (Cicer arietinum L.) biology and biotechnology: from domestication to biofortification and biopharming | |
| CN104561055A (en) | Tetranychus cinnabarinus cytochrome p450 gene and application thereof | |
| Hewavitharana et al. | Analysis of environmental variables and carbon input on soil microbiome, metabolome and disease control efficacy in strawberry attributable to anaerobic soil disinfestation | |
| Nanda et al. | Differential responses of OsMPK s in IR56 rice to two BPH populations of different virulence levels | |
| Li et al. | Hormetic response and co-expression of cytochrome P450 and cuticular protein reveal the tolerance to host-specific terpenoid defences in an emerging insect pest, Pagiophloeus tsushimanus (Coleoptera: Curculionidae) | |
| Fan et al. | Sucrose facilitates rhizome development of perennial rice (Oryza longistaminata) | |
| Lebedev et al. | Assessing impacts of transgenic plants on soil using functional indicators: Twenty years of research and perspectives | |
| Bordoloi et al. | Helopeltis theivora responsive transcriptomic reprogramming uncovers long non-coding RNAs as possible regulators of primary and secondary metabolism in tea plant | |
| Zhu et al. | Comparative transcriptome analysis reveals differential gene expression in resistant and susceptible watermelon varieties in response to Meloidogyne incognita | |
| Pradhan et al. | microRNA390 modulates Nicotiana attenuata's tolerance response to Manduca sexta herbivory | |
| Qu et al. | Evidence of the involvement of a Plus-C odorant-binding protein HparOBP14 in host plant selection and oviposition of the Scarab Beetle Holotrichia parallela | |
| Klumb et al. | Transcriptome profiling of Prunus persica plants under flooding | |
| CN110951730B (en) | dsRNA of cryptopteris viridis V-ATPase-A gene, artificial feed and application thereof | |
| CN103642809B (en) | Beet armyworm microRNA Sex-miR4924 gene and the application in biological control of insect pests thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180327 Termination date: 20190112 |