CN104560991B

CN104560991B - Micro RNA for preventing and treating human papilloma virus infection and cervical cancer

Info

Publication number: CN104560991B
Application number: CN201310470087.4A
Authority: CN
Inventors: 李燕云; 徐丛剑; 林琳; 黄泓; 蔡青青; 张宏伟
Original assignee: Obstetrics and Gynecology Hospital of Fudan University
Current assignee: Obstetrics and Gynecology Hospital of Fudan University
Priority date: 2013-10-10
Filing date: 2013-10-10
Publication date: 2021-02-26
Anticipated expiration: 2033-10-10
Also published as: CN104560991A

Abstract

The invention belongs to the technical field of biomedicine. Relates to a micro RNA, in particular to a micro RNA for preventing and treating human papilloma virus infection and human cervical carcinoma. Experiments prove that the micro RNA can directly target the human papilloma virus E6 gene in cells, reduce the expression of the human papilloma virus E6 gene, finally inhibit the proliferation of tumor cells and induce the apoptosis of the tumor cells. Furthermore, the micro RNA can be used for preparing a medicine for preventing and treating human papilloma virus infection and cervical cancer caused by the virus.

Description

Micro RNA for preventing and treating human papilloma virus infection and cervical cancer

The technical field is as follows:

the invention belongs to the technical field of biomedicine. Relates to a micro RNA for preventing and treating human papilloma virus infection and human cervical cancer.

Background art:

cervical cancer is the most common malignancy of the female reproductive tract worldwide. Statistically, there are approximately 50 million new cases of cervical cancer worldwide each year, with over 27 million women dying from the disease. In recent years, the morbidity of the traditional Chinese medicine is increasing, the traditional Chinese medicine is younger, and the mortality is also rising. Therefore, the development of new safe and effective therapeutic targets is not slow.

Human Papilloma Virus (HPV) is a non-enveloped double-stranded circular DNA virus with a genome of about 7200-8000bp in length, encodes 6 early proteins (E1, E2, E4, E5, E6, E7) and two late proteins (L1 and L2). According to the carcinogenic risk, the HPV is divided into high-risk type HPV and low-risk type HPV, wherein the high-risk type HPV is related to cervical cancer and severe precancerous lesion, and the low-risk type HPV causes benign lesions such as genital warts. It is now clear that high-risk HPV infection is the direct and primary cause of cervical cancer. Long-term and large-scale clinical epidemiological investigation at home and abroad discovers that over 99 percent of cervical cancer samples have HPV virus infection, wherein HPV16 is the main infection type. After the cervical tissue is infected by the HPV virus, the tissue usually undergoes a long-term and slow process, generally more than ten years or even decades, and then becomes cancerous. Therefore, in the long-term persistent HPV infection process, the search for targets of resisting HPV infection and virus oncogenes thereof can block the persistent HPV infection and tissue canceration, and is the key for preventing and treating cervical cancer.

microRNA (microRNA, miRNA) is a single-stranded small non-coding RNA with the length of about 19-25 nt, is usually combined with a3 'untranslated region of a target gene, and can also be combined with a 5' untranslated region or a coding region in some cases to degrade mRNA of the target gene or inhibit the translation of the mRNA, so that the gene expression is negatively regulated and controlled at the post-transcriptional level. mirnas are widely present in cells from plants, nematodes to humans, and are involved in regulating a range of vital activities. Up to now, a total of 21264 mature miRNAs found in various species are included in the miRBase database, of which 2042 are found in humans and have been experimentally confirmed (Release19: August 2012). Recent studies show that mirnas are closely related to various malignant tumors, can play the role of oncogenes or cancer suppressor genes, and play an important role in the processes of tumor angiogenesis, tumor cell proliferation, apoptosis, infiltration, metastasis and the like.

In recent years, there is increasing evidence that mirnas have direct antiviral effects. From 2005 to date, multiple human cell mirnas have been reported to directly target and attack exogenous pathogenic viruses, regulating viral gene expression, such as: miR-196 and miR-448 are resistant to HCV virus; miR-199a, miR-210 and miR-125a resist HBV virus; and a series of miRNAs resisting HIV, H5N1, H1N1 virus and the like. This mode of action has been shown to play an important role in the immunity of the body against viral infections. Due to the endogenous and relative safety of miRNA, the characteristic of targeting attack on exogenous virus is utilized to develop corresponding medicine or method, so that the antiviral immunity of an organism can be simulated, and a new opportunity is brought for preventing and/or treating malignant diseases (such as hepatitis C, hepatitis B, AIDS and the like) induced by virus infection.

However, cervical cancer is one of malignant tumors clearly related to viral infection, and no document reports that a certain miRNA can directly target HPV virus and regulate the expression of HPV virus genes so far. No human miRNA is applied to resisting HPV virus. The blockage of HPV persistent infection is the key to the prevention and treatment of cervical cancer.

The invention content is as follows:

in view of the above technical background, the present invention aims to provide a novel therapeutic target and method for treating HPV infection and cervical cancer.

The invention provides a micro RNA nucleic acid sequence for preventing and treating human papilloma virus infection and cervical cancer caused by the virus, which comprises the following specific steps: 5 'UAUACCUCAGUUUUAUCAGGUG 3'. In one embodiment of the present invention, the microRNA can target the 209 th 231nt of the human papillomavirus E6 gene, and the sequence of the 209 th 231nt is: 5 'CAGTTACTGCGACGTGAGGTATA 3'.

The invention also relates to application of the micro RNA, various carriers and pharmaceutical compositions thereof in medicaments for preventing and treating HPV virus infection and cervical cancer caused by the virus.

The pharmaceutical composition contains an effective amount of the nucleic acid sequence and a pharmaceutically acceptable excipient.

In the invention, the human papilloma virus can cause high-risk subtypes of human cervical cancer, including: HPV16, HPV18HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, HPV 82.

In addition, the invention also relates to the use of the nucleic acid sequence, the vector or the pharmaceutical composition provided by the invention for regulating the expression of the HPV E6 gene.

In the invention, the micro RNA can reduce the expression of human papilloma virus E6 gene, and finally inhibit the proliferation of tumor cells and induce the apoptosis of the tumor cells.

The invention predicts the nucleic acid sequence of the micro RNA by a bioinformatics method. Furthermore, the micro RNA and the predicted target sequence thereof are respectively cloned in a dual-luciferase reporter gene vector, and the result shows that the activity of the reporter gene is obviously inhibited, thereby proving that the micro RNA can directly act with the target. In order to evaluate the influence of the microRNA on the growth of the HPV 16-infected cervical cancer cells, the microRNA expression plasmid is transfected into an HPV 16-positive cervical cancer SiHa cell strain, and the results of a flow cytometry detection method, a Hoechst staining method and a Roche cell analyzer detection method show that the exogenous up-regulation of the expression of the microRNA in cells can obviously slow down the cell proliferation and increase the cell apoptosis, so that the microRNA-mediated silencing effect on HPV virus can interfere the growth fate of tumor cells. Meanwhile, the result of the RT-PCR method shows that the mRNA expression of the E6 oncogene is obviously reduced. Therefore, the invention proves that the micro RNA can directly target and attack the HPV16 virus by targeting the HPV16-E6 gene to influence the carcinogenic capacity of the virus, thereby effectively inhibiting the growth of cervical cancer cells and inducing the apoptosis of the cervical cancer cells. In view of the endogenesis and relative safety of miRNA, if the miRNA is applied to medicines, the miRNA simulates the antiviral immune response generated by the immune system after human cells are infected by HPV, and is expected to become a novel method and element for preventing and treating HPV infection and cervical cancer caused by HPV infection.

Description of the drawings:

FIG. 1: the micro RNA sequence is cloned in a pSilencerr4.1-CMV vector, the predicted target sequence is cloned in a psiCheck-2 vector, and the two recombinant plasmids are co-transfected in HPV negative cervical carcinoma C33A cells to form an experimental group; the blank plasmid and the target fluorescent reporter gene plasmid were cotransfected with C-33A cells as a control group. FIG. 1 shows luciferase activity detected 48 hours after transfection: the fluorescence activity of the experimental group is reduced by 50.918 percent compared with that of the control group, the expression of the reporter gene is obviously inhibited, and the data have statistical significance (P < 0.001)

FIG. 2: transfecting the micro RNA expression plasmid (pSilencer4.1-miRNA-CMV) into an HPV16 positive cervical cancer SiHa cell strain to form an experimental group; SiHa cells transfected with untransfected plasmid and blank plasmid are used as a normal control group and a negative control group. FIG. 2 shows the results of flow cytometry for apoptosis rate: the early apoptosis rate of the experimental group is respectively 4.9 times and 4.2 times of that of the normal control group and the negative control group, the late apoptosis rate is respectively 19.5 times and 21.3 times, the total apoptosis rate is respectively 11.0 times and 10.3 times, and the difference has statistical significance (P is less than 0.05).

FIG. 3: shows the results of detecting SiHa apoptotic cells by Hoechst staining method: the cell fluorescent staining positive rate of the experimental group transfected with the micro RNA expression plasmid is 65.5 times and 36.2 times of that of the normal control group and that of the negative control group respectively. The difference was statistically significant (P < 0.001).

FIG. 4: cell growth curves plotted against SiHa cell proliferation index monitored by Roche xcellife RTCA DP cytoanalyzer are shown: the cell proliferation indexes of the experimental group transfected with the micro RNA expression plasmid are obviously reduced compared with those of a normal control group and a negative control group, and the difference has statistical significance (P is less than 0.05); the cell growth curve shows that the cell proliferation and expansion capability of the experimental group is obviously inhibited.

FIG. 5: and detecting the mRNA expression level of HPV16 virus E6 oncogene in SiHa cells by using an RT-PCR method. FIG. 5 shows the result of electrophoresis bands detected by RT-PCR: after the cells of the experimental group are transfected with the micro RNA expression plasmid, the expression quantity of E6mRNA is obviously reduced.

FIG. 6: the results of grey value analysis of the RT-PCR electrophoretic bands are shown: the expression level of E6mRNA of the experimental group transfected with the micro RNA expression plasmid is reduced by 26.08 percent and 26.60 percent compared with that of the normal control group and the negative control group, and the data are statistically different (P is less than 0.05); the expression level of the control GAPDH has no obvious change and no statistical difference with the control group.

The specific implementation mode is as follows:

example 1

1. Plasmid construction:

designing an amplification primer according to a pri-hsa-miRNA precursor sequence, obtaining a first strand DNA by a DNA synthesis technology, obtaining a double-strand DNA by PCR amplification, and connecting the double-strand DNA into a pSilencer4.1-CMV vector; BamHI and HindIII are used for double enzyme digestion of the miRNA amplified fragment and the psilene 4.1-CMV vector respectively to construct the micro RNA expression plasmid. Oligo primers were designed based on the corresponding target site information and fragments containing the microRNA target sequence were ligated into the psi-check2 vector. XhoI and NotI are used for respectively carrying out double enzyme digestion on the amplified fragment of the target sequence and a psi-check2 luciferase double-reporter gene vector to construct a micro RNA target sequence expression fluorescent reporter gene plasmid. And then transforming E.coli DH5 alpha host bacteria, and performing sequencing identification and concentration determination on the extracted plasmid. The bioinformatics method is adopted to predict that the micro RNA can target a segment of sequence in the E6 gene region in HPV16, wherein the specific position is 209-231nt, and the sequence is as follows: 5 'CAGTTACTGCGACGTGAGGTATA 3'

2. Cell culture and transfection:

the C-33A cells and SiHa cells were cultured in MEM containing 10% by volume fetal bovine serum and cultured in a 5% CO2 incubator at 37 ℃. On the day before transfection, cells were trypsinized and plated in 24-well plates. Preparing a mixed solution of the micro RNA expression plasmid and the corresponding target luciferase reporter gene plasmid, and mixing the mixed solution with Lipofectamine^TM2000 dilutions were mixed and added to a 24-well plate inoculated with C-33A cells, and after 6 hours, the plate was replaced with MEM containing 10% fetal bovine serum to prepare an experimental group. The blank vector plasmid and the target luciferase reporter gene plasmid were co-transfected into C-33A cells according to the same method as a negative control. Mixing Lipofectamine^TM2000 dilution and micro RNA plasmid dilution were mixed, added to SiHa cell inoculated plate wells, and changed to 10% fetal bovine serum MEM after 6 hours, to obtain experimental groups. The blank plasmid was transfected into SiHa cells as a negative control, and SiHa cells without plasmid transfection were a normal control. After 24 hours, cell culture supernatants were collected for testing. The above steps are repeated for three times.

3. Luciferase dual reporter system detection luciferase activity:

the transfected C-33A cells were cultured for 24 hours and then lysed. Adding 100 mul of luciferase test reagent II and 20 mul of cell lysate into a detection tube of a chemiluminescence analyzer, uniformly mixing, placing into the chemiluminescence analyzer, detecting the expression quantity of internal reference reporter gene luciferase (namely firefly luciferase), reading the numerical value and recording as F1. Then 100. mu.l of Stop & Glo working solution is added, the solution is evenly blown and stirred, the expression level of the main reporter gene luciferase (namely renilla luciferase) is detected, and the value is read and recorded as F2. The F2/F1 ratio is the luciferase activity obtained. The statistical software SPSS Statistics V20.0 is used to perform normality and homogeneity of variance tests on all data, and variance analysis is used to compare differences among groups.

Detecting SiHa apoptosis rate by an Annexin V-FITC/PI double-staining flow cytometer:

SiHa cells 24 hours after transfection were trypsinized and cells were harvested. The cells were resuspended in 100. mu.l of binding buffer after washing once with ice-cold Phosphate Buffer (PBS). Mu. lAF488-annexin-V and 1. mu.l PI working solution were added to each 100. mu.l of cell suspension, incubated at room temperature for 15 minutes, centrifuged and the supernatant discarded. Adding 400 mul of binding buffer solution, and placing the mixture in a flow cytometer to detect the apoptosis rate.

Hoechst staining to detect SiHa apoptotic cells:

SiHa cells were washed three times with PBS 24hr after transfection. 0.5ml of 4% paraformaldehyde was fixed and 0.5ml of Hoechst33258 working solution (10. mu.g/ml) was stained. And (5) sealing the chip by using the anti-fluorescence quenching sealing liquid. The excitation wavelength is 350nm and the emission wavelength is 460nm when observed under a fluorescence microscope.

Detecting SiHa cell proliferation by a Roche cell analyzer:

after SiHa cells were transfected with miRNA plasmid from the beginning of plating, the xcelligene E plate was placed in the xcelligene RTCA DP cell analyzer plate slot every 4hr to detect the cell proliferation index. The cell proliferation index depends on the value of (Rn-Rb)/15 (Rn is the resistance of the bottom electrode of the plate on which cells grow; Rb is the resistance of the bottom electrode of the background plate containing only culture solution). Monitoring for 120hr, and plotting cell proliferation curve. And (4) performing normality and homogeneity of variance tests on each group of data, and comparing differences among the groups by using variance analysis.

RT-PCR method for detecting E6mRNA expression:

and extracting total RNA of the transfected cells to perform reverse transcription polymerase chain reaction. E6 has upstream primer sequence of 5'AGCGACCCAGAAAGTTACCA3' and downstream primer sequence of 5'GCATAAATCCCGAAAAGCAA3' and amplification length of 134 bp. GAPDH was used as an internal reference. The PCR reaction conditions are pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 40s, extension at 72 ℃ for 1min, and final extension at 72 ℃ for 10min after 30 cycles. The product was subjected to agarose gel electrophoresis. The TotalLab100 software analyzed the strip.

SEQUENCE LISTING

<110> affiliated obstetrical and gynecological hospital of double-denier university

<120> microRNA for preventing and treating human papilloma virus infection and cervical cancer

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 22

<212> RNA

<213> Artificial

<400> 1

uauaccucag uuuuaucagg ug 22

<210> 2

<211> 23

<212> DNA

<213> Artificial

<400> 2

cagttactgc gacgtgaggt ata 23

Claims

1. The use of a microRNA in the preparation of a medicament for preventing and treating human papillomavirus HPV16 type infection and cervical cancer caused by the virus, wherein the nucleic acid sequence of the microRNA is as follows:

5’UAUACCUCAGUUUUAUCAGGUG 3’；

the micro RNA targets the HPV16 type E6 gene, the specific position of the binding site is 209-231nt, and the sequence is as follows: 5 'CAGTTACTGCGACGTGAGGTATA 3'.

2. The use according to claim 1, wherein said microRNA down-regulates the expression of human papillomavirus HPV16 type E6 oncogene and eventually inhibits the proliferation of cervical cancer cells, inducing apoptosis of tumor cells.