CN104522090B - The Carbonado Diamond thing and its extracting method of a kind of Aegilops varibilis and application - Google Patents

Abstract

The invention discloses the Carbonado Diamond thing and its extracting method of a kind of Aegilops varibilis and application, belong to bioengineering field.The extracting method of the Carbonado Diamond thing of Aegilops varibilis comprises the following steps that in the present invention：Aegilops varibilis root is taken to be cut into slices after cleaning, drying thoroughly removes moisture removal in 6 hours in 80 DEG C of baking ovens, is then crushed with pulverizer, cross after 60 mesh sieves, the Aegilops varibilis root sample of 10 grams of crushing is put into 50 milliliters of extraction kettle, using absolute ethyl alcohol as entrainer, in CO₂30MPa in extraction apparatus, 60 DEG C of extractions 2h, wherein CO₂Flow control obtains the Carbonado Diamond thing of Aegilops varibilis in 1.5LPM.Present invention research shows that the caffeine of the concentration of ＞ 0.1% has growth to have inhibitory action to plant pathogeny line insect, and the Carbonado Diamond thing for the Aegilops varibilis that the present invention is obtained can be used for the insect resistant agent for preparing cereal cyst nematode and Meloidogyne incognita.

Description

The Carbonado Diamond thing and its extracting method of a kind of Aegilops varibilis and application

Technical field

The invention belongs to bioengineering field, the Carbonado Diamond thing of more particularly to a kind of Aegilops varibilis and its extraction side Method and application.

Background technology

Caffeine (Caffeine, caffeine) be xanthine alkaloid, it is common have aqueous coffee because and two kinds of Caffeine Anhydrous. Caffeine is the stimulant of central nervous system.Caffeine is primarily present in particular kind of plant, is a kind of alkaloid.By In the insect of instruction plant can be benumbed, so serving the effect of insecticide, pest and disease damage is protected the plants from.Originally in the world Upper people mainly obtain caffeine from coffee bean, and its content has according to the species difference and manufacture craft difference of coffee bean Institute is different.Later it is found that also containing caffeine amount contained in caffeine, and tea in tea generally depends on the strong of tea making Degree.Therefore the content of caffeine in green tea, black tea, Pu'er tea is different.Present people be exactly mainly from coffee bean, tealeaves, And caffeine is obtained in cocoa.

The raw material that current caffeine is naturally synthesized is essentially from tealeaves, because content highest of the caffeine in tealeaves, reaches 2%~5%, and tealeaves is extensive in world wide plantation, aboundresources.In tealeaves, the position that caffeine is primarily present be leaf, Seed and fruit, camellia also with the presence of a certain amount of caffeine, and caffeine at young tender position compared with horn of plenty, and in aging portion It there's almost no in position.Research of the caffeine in grass is rarely reported, the table in plant response environment stress Play a part of in reaching be even more it is rare be related to, Aegilops varibilis (2n=4x=28, UUSvSv, Ae.variabilis Syn.Triticumperegrinum (Hack In J.Fraser) Marie＆Hackel) be grass family wheat nearly edge species, Fertile offspring can be produced when carrying out distant hybridization with wheat, is the valuable source of wheat breeding improvement.But due to Aegilops varibilis Genome background not yet illustrate, so associated metabolic research and its resistance mechanism in terms of research be rarely reported.

Cereal cyst nematode (H.avenae) has serious danger to wheat, barley, rye, oat and a variety of graminous pastures Evil property, is the pathogenic nematode being widely present in the world, and the especially production to wheat constitutes serious threat.China from 1987 Since Hubei Tianmen county finds the disease, find in 13 provinces, autonomous regions and municipalities such as North China, northwest, Central China and East China to have so far point Cloth, and have the gesture gradually spread.Based on current main use chemical pesticide control.Although chemical pesticide prevention and control nematode is effective One of method, but the pollution that it is caused to environment and agricultural product is so that party's law limitation is highlighted.Therefore, find it is safe and The control of nematode approach of effective biological source is very necessary.

Current studies in China not yet has the related report of caffeine metabolite in resistance of the grass to pathogenic nematode Road, with the development of transcript profile sequencing technologies in recent years, plant is studied using transcript profile technology combination Comparative genomic strategy technology The report of resistance is in the gesture of growth year by year.This research is demonstrated is extracted and HPLC skills using transcript profile technology combination plant metabolites Art can be studied the metabolic pathway and product belonging to difference expression gene and related gene with high-throughout acquisition.

The content of the invention

To overcome shortcoming and deficiency present in prior art, primary and foremost purpose of the invention is to provide a kind of variable goat The extracting method of the Carbonado Diamond thing of grass.

Another object of the present invention is to the Carbonado Diamond thing for the Aegilops varibilis for providing the acquisition of said extracted method.

It is still another object of the present invention to provide the application of the Carbonado Diamond thing of above-mentioned Aegilops varibilis.

The purpose of the present invention is achieved through the following technical solutions：A kind of extraction side of the Carbonado Diamond thing of Aegilops varibilis Method, is comprised the following steps that：

Aegilops varibilis root is taken to be cut into slices after cleaning, drying thoroughly removes moisture removal, Ran Houyong in 6 hours in 80 DEG C of baking ovens Pulverizer is crushed, and is crossed after 60 mesh sieves, the Aegilops varibilis root sample of 10 grams of crushing is put into 50 milliliters of extraction kettle, using nothing Water-ethanol is as entrainer, in CO₂30MPa in extraction apparatus, 60 DEG C of extractions 2h, wherein CO₂Flow control obtains easy in 1.5LPM Become the Carbonado Diamond thing of goatweed.

Described CO₂Extraction apparatus is preferably to use Speed SFE-2 supercritical COs₂Extraction apparatus (Applied SeparationsAllentown Inc,PA,USA)。

A kind of Carbonado Diamond thing of Aegilops varibilis is obtained by above-mentioned extracting method.

The Carbonado Diamond thing of above-mentioned Aegilops varibilis is used to prepare the pest-resistant of cereal cyst nematode and Meloidogyne incognita Agent.Wherein caffeine exists in the Carbonado Diamond thing in Aegilops varibilis source>To cereal cyst nematode and southern root under 0.1% concentration The all toxic effect of tie lines worm；>To diseased plant resistance under 0.5% concentration.

The present invention is double using having to cereal cyst nematode (H.avenae) and root-knot nematode (Meloidogyne naasi) The root of the material Aegilops varibilis of anti-effect has carried out the transcript profile sequencing of depth.Pass through the generation to sequencing result related gene The approach of thanking is analyzed.Caffeine metabolite approach is found in variable goat first.Further carry out data verification and sample is carried Take and HPLC analysis after find, use caffeine>The Carbonado Diamond thing of the Aegilops varibilis of 0.1% concentration is to cereal sporangiocyst The all toxic effect of nematode and Meloidogyne incognita.

The present invention has the following advantages and effect relative to prior art：

The invention provides a kind of extracting method of the Carbonado Diamond thing of the Aegilops varibilis of easy-to-use, extracting Shi Caiyong CO₂For the organic solvent in superfluid supercritical fluid extraction method：CO₂It is nontoxic, it is nonflammable it is explosive, inexpensive, have relatively low face Boundary's pressure and temperature, it is easy to safely separate from mixture.Supercritical CO₂Extraction compared with traditional extraction process, Biggest advantage is that separation can be extracted under conditions of near ambient temperature, almost whole active ingredients, product purity in retained product Height, simple to operate, energy-conservation.The above method obtain Aegilops varibilis Carbonado Diamond thing can be used for prepare cereal cyst nematode and The preventing and treating of Meloidogyne incognita.Wherein caffeine exists in the Carbonado Diamond thing in Aegilops varibilis source>To cereal under 0.1% concentration The all toxic effect of cyst roundworm and Meloidogyne incognita；>To diseased plant resistance under 0.5% concentration.For cereal sporangiocyst line The consumption of the Carbonado Diamond thing of Aegilops varibilis used is few during the preventing and treating of worm and Meloidogyne incognita, and environment will not be made Into chemical contamination.

Brief description of the drawings

Fig. 1 screens for the metabolic pathway of difference expression gene.

Fig. 2 (is related to gene with the bright EC of red collimation mark to be related to caffeine metabolite figure in transcript profile data： 1.17.32.3Aldehyde oxidase aldehyde dehydrogenases).

The quantitative verification that Fig. 3 is caffeine metabolite correlation Unigene in transcript profile data.

Fig. 4 is that HPLC detects caffeine standards and connects worm induction back root part extract, wherein：A caffeine standards, B Aegilops varibilis root extract, the comparison of C standard items and extract.

Fig. 5 is the identification schematic diagram of root-knot nematode chemotaxis assay (chemotaxis assay), wherein：A. root-knot nematode The schematic diagram of chemotaxis assay (chemotaxis assay) (Tajima et al (2001) J.Biosci.Bioeng.) (is used 1cm²PDA is that medium is placed in petri diss (Petri Dish) A. is control medium part above；B. it is to add coffee The culture base section of cause；Two as a child after add about 200 root-knot nematodes two in the centre (D regions) of culture dish Instar larvae (J2s), and 4 hours (25 DEG C) of culture in darkroom, A, the nematode number in B and C regions is under inverted microscope (Olympus CKX41) is counted, and the training culture dish not comprising medium is used as control.This experiment contains seven repeating groups (replicates) and a repetition experiment (repeated)) b. is identification that root-knot nematode petri diss grows rate of rejection Statistical results chart (P<0.05).

Fig. 6 for 0.1% caffeine to the result figure of cyst roundworm, wherein：A is control group, and B is 0.1% coffee Coffee is because for the treatment of group.

Fig. 7 is that various concentrations caffeine handles lower cereal cyst nematode and the incubation rate and the death rate of root-knot nematode, wherein： A. incubation rate (concentration for the treatment of is 0 (CK) 0.1%, and 0.3%, 1%, processing time is 3,7,14 days) B. cereal spores of root-knot nematode Incubation rate (concentration for the treatment of is 0 (CK) 0.1%, and 0.3%, 1% processing time was 3,7,14 days) C. root-knot nematodes two of capsule nematode The death rate (concentration for the treatment of is 0 (CK) 0.1%, and 0.3%, 1%, processing time is 24,48,72 hours) D cereal sporangiocysts of instar The death rate of the instar of nematode two (concentration for the treatment of is 0 (CK) 0.1%, and 0.3%, 1%, processing time is 24,48,72 hours)

Fig. 8 is the autochthonal long identification of cereal cyst nematode of susceptible Aegilops varibilis (No. 2) after caffeine is handled, wherein： A.0.5% the cereal cyst nematode after caffeine processing connects cereal cyst nematode number in worm identification tri- experiment packets of B. and identified (P<0.05) the sporangiocyst number identification of susceptible variety root, tolerant gene expression knot after the D. different disposal times after the processing of C. various concentrations Fruit is schemed.

Fig. 9 is the identification of the Meloidogyne incognita soil of susceptible tobacco after caffeine is handled, wherein：The south of the susceptible tobaccos of A Root-knot nematode connects worm identification, susceptible variety root root knot number identification (P after the processing of B various concentrations<0.05), the C different disposals time Tolerant gene expression result figure afterwards.

Embodiment

With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited In this.

Embodiment 1

First, experiment material and reagent

1. vegetable material is sequenced：From Aegilops varibilis (the MQ Yu et al (1990) with CCN resistances and RKN resistances Agronomie, 6,451-456) as transcript profile sequencing material, to determine it in inoculation CCN processing and not be inoculated with two kinds of feelings of CCN The expression of all genes in root under condition.The seed of material is subjected to surface sterilizing processing (in the hypochlorous acid of 3% concentration first Soak after 5min and soaked 3 times with aqua sterilisa again in sodium and 0.01% Tween20 mixed liquors, then seed is uniformly elaborated lasting In the culture dish that 5cm diameters are placed on the filter paper of moistening, issued in 20 DEG C or so of room temperatures and 16h/8h periodicity of illumination environment Seedling.Seedling is divided into two groups after ten days：One group of J2 larva (H.avenae) (every plant is inoculated with 1000) for being inoculated with CCN, Another group do not connect worm and as first group of control, while the time point for being inoculated with CCN is defined as into 0h/dpi (hours or Days post inoculation, hpi or dpi).After 30 hours (30hpi), all plant are gone into no nematode and nothing To avoid the CCN of unimpinged root from persistently infecting in the environment of bacterium, so that the development synchronization of plasomidum (syncytia), Simultaneously ensure surrounding environment be 20 DEG C or so room temperature and 16h/8h periodicity of illumination with promote plant continued growth develop.

2. for examination nematode

Cereal cyst nematode：Shandong Feicheng colony (H.avenae, pathological form pathotype Ha43) is big by Shandong agricultural Professor Liu Feng is learned to provide.With aggrieved wheat root and rhizosphere soil is gathered, take 200ml soil to be twisted into pieces in plastic tub, use strong water Stream is rinsed, agitation, in precipitation a moment, the aqueous solution is crossed to the mesh screen of 20 and 80 mesh, is repeated above step 3 times, then with weep gently 80 sieve residues are cleaned, are filtered with filter paper, the available sporangiocyst of picking health under anatomical lens.

Meloidogyne incognita：The inoculation root-knot nematode tomato of about 50 days is taken, soil around root is cleaned up, chosen under anatomical lens The pieces of an egg on root system are taken, are placed in after washing paint in the double-deck mesh screen for being lined with filter paper, aqua sterilisa is added and hatches training in 25 DEG C of incubator Support.The second instar larvae of fresh hatching is collected, in the rhizosphere soil that tomato susceptible variety is seeded to the inoculum concentration of 5000/plant. Tomato seedling after inoculation is divided into two groups, and one group is cleaned tomato root two days later in inoculation, the picking intrusion root tissue under anatomical lens Second instar larvae, obtains parasitic early stage second instar larvae；Another group is cleaned tomato root after being inoculated with 12 days, is invaded in picking under anatomical lens Oneself larva through substantially expanding, i.e. parasitic stage larva of the polypide of root tissue.

2nd, transcript profile data analysis and data verification：

1. transcript profile is sequenced：Mixed in equal amounts is inoculated with cereal cyst nematode and does not connect two kinds of processing of worm 30 hours after worm is connect, 3 The root RNA of it and 9 days carries out Illumina HiSeq^TMThe transcript profile de novo sequencing of 2000 microarray dataset 4G depth, with two Individual assembly program splices to sequencing data.118,064 separate genes are obtained by Trinity method (unigene), its average length is that 500bp, N50 are that 599bp, average sequencing depth are 33.25 times.Further to these independences Gene is explained.

2. the clustering of difference expression gene：We are with Pathway-based analysis methods in transcript profile level (Transcriptome background) analyzes the metabolic pathway and signal route of metastasis that DEG may be participated in.It is based on Pathway main public database, is examined using hypergeometry, is found out compared with whole transcript profile in relatively rear difference expression gene The pathway of conspicuousness enrichment.There is the number gene that pathway is annotated during N is set herein as all genes；N is poor in N The number of different expressing gene；M is the number gene that annotation is certain specific pathway in all genes；M is that annotation is that certain is specific Pathway difference expression gene number.The pathway of Qvalue≤0.05 is defined as the significant enrichment in difference expression gene Pathway.By pathway conspicuousnesses enrichment energy we have found that caffeine metabolite specific expressed under the conditions of worm is connect (Fig. 1).

3. based on caffeine metabolite (Fig. 2) candidate Unigene genes (Aldehyde oxidase) fragment in transcript profile And resistance related gene, the total length of correspondence gene is downloaded from NCBI, the conserved region based on gene is designed using Premier 5.0 Primer：

Aldehyde oxidase:

Unigene100201_AS,

GCTATTACTTTACTACGGAGCGACCTTGTG

Unigene100201_S,

CGGCATTTGTTTCGTGTTCTTCGTTTAT；

Unigene100216_AS,

CGGCATTCCATTCAGCAATGTGCGTGTC

Unigene100216_S,

GCCTTCCCACCAAAGCCTCCTCCAACCC；

Unigene110602_AS,

GCAGTGAACTGAAGCTGCAAGGAGCAAA

Unigene110602_S,

CACCAAGACCAACTACCGAACCACAAGA；

Unigene11935_AS,

TTGGGATGAACTGAAGGCATCTTGTAAT；

Unigene11935_S,

ATGAGGCGGCAACTTGGGCTATCTTTGT；

Unigene12233_AS

GGTAGCTGCGTAGAGGAGTAGACGGTGA；

Unigene12233_S

TTCTGACAATAGAGGATGCCATCCAACA；

Unigene12312_AS

GGGATGGTGTCAACCGTAGGGATCTTGTA；

Unigene12312_S

ATGGAGCCGCCGTCAGCGAGGTGGAAAT；

Resistance related gene：

R genes

Unigene17651_AS

CATCTGAGCTTCTTATGAACCCTTCTGC

Unigne17651_S

GACGGGACCTCTGTGGTGGAGCTACAAT

PAL

Unigene55623_AS

CCTGTCCGCCGTCTTCTGCGAGGTGATG

Unigene55623_S

TGTCCTGCTTGGGCTTGAGCTGCGTGTC

NPR1

Unigene111463_AS

ACCAATATGGCAAGAATGGGCCAGGGAG

Unigene111463_S

AAGGCGTTCAGCGAGGACAAGGAGGAGT

B.PCR is expanded

PCR amplification system

PCR amplification programs are as follows：

RT-qPCR quantitative results (Fig. 3)

The identification of three, Aegilops varibilis root caffeines

1. Aegilops varibilis root caffeine sample extraction

Aegilops varibilis root sample dries 6 hours in 80 DEG C of baking ovens and thoroughly drives away moisture, is then crushed with pulverizer, Sieved through sample sifter, obtain the root sample (being respectively 0.2-0.6mm, 0.6-1.2mm, 1.2-2.0mm) of 3 kinds of particle diameters.Caffeine Standard items are purchased from Sigma companies (Sigma-Aldrich, St.Louis, USA), and other agents useful for same are color without specified otherwise Spectrum is pure.Experiment ultra-pure water used is the small-sized ultrapure water systems of UV D7401EASY Pure.

Using Speed SFE-2 supercritical COs₂Extraction apparatus (Applied Separations Allentown Inc, PA, USA).Subsidiary two pumps of abstraction instrument, one is SAPMAC method pump (SDC-6, the biological Co., Ltd of the new sesame in Ningbo), and another is entrainment Agent pump (K-501, Knauer.Ltd, Berlin, Germany) is used to add entrainer online.The variable goat of 10 grams of crushing Grass roots portion sample is put into 50 milliliters of extraction kettle, is set as using absolute ethyl alcohol as entrainer, pressure and temp and time 30MPa, 60 DEG C and 2h, carbon dioxide flow is controlled in 1.5LPM.

2.HPLC is detected

A. sample pre-treatments：Cut into slices, crushed after drying after Aegilops varibilis root is cleaned, cross 60 mesh sieves, use concentration For 85% ethanol be 1: 20 in solid-liquid ratio ratio extracted in apparatus,Soxhlet's, filter, with 6000r/min rotating speeds centrifuge Be concentrated under reduced pressure to obtain extract medicinal extract after 10min, is placed in dry for standby in baking oven.Weigh extract after appropriate drying, plus 200.0g/ L potassium ferrocyanide solution 2.0mL and 200.0g/L basic lead acetate solution 2.0mL remove the egg in Aegilops varibilis root White matter, filtering is standby after filtrate ultrasound degassing.Compound concentration is 4mg/mL sample liquid, then uses 0.45m membrane filtrations, as Treat sample measuring liquid.

B. chromatographic column:ACQUITYUPLC BEH-C18 posts (2.1 × 100mm, 1.7 μm)

Column temperature：50℃

Flow velocity：0.4mL/min

Sample size：1 μ L/5 μ L (the μ L of 1 μ L/ samples of standard items 5)

Mobile phase：Water (A)：Methanol (B), using gradient elution.Type of elution is as shown in table 1.

The chromatographic condition of table 1.

C. the preparation precision of caffeine standards liquid weighs caffeine standards 5mg, with methanol: water=70: 30 mixing is molten Simultaneously constant volume is in 10mL volumetric flasks for liquid dissolving, and the titer that 0.5,1.0,1.5,2,2.5mL are pipetted respectively distinguishes constant volume in 10mL In volumetric flask, again by 0.45m water system membrane filtrations after ultrasonic wave degassing 10min, sample size is 10L, with caffeine mass concentration For abscissa, peak area is ordinate, draws standard curve.

HPLC, which detects caffeine standards and connects worm, induces the result of back root part extract as shown in Figure 4.

3. caffeine suppresses to nematode growth

As shown in Fig. 5, Fig. 6 and Fig. 7, the caffeine that Aegilops varibilis root is extracted with>0.1% concentration adds respectively Enter 24h in root-knot nematode (Mi) culture medium and cyst roundworm (CCN) solution, living nematode is counted by disecting microscope microscopy respectively The statistical comparison calculated with the number of dead nematode between nematode survival rate, each two samples of Setup Experiments, sample is used Mann-Whitney U-test methods in statistics software SPSS 20, significant difference value is (P<0.05).

4. raising of the caffeine to diseased plant resistance is acted on

Using susceptible Aegilops varibilis plant (Aegilops varibilis 2, cereal cyst nematode is susceptible) and tobacco (big treasure, Meloidogyne incognita is susceptible), start plantation at tri-leaf period, meet the 12h after worm, 30h, 3d, 30d, 90d distinguishes spraying concentration and is 0.1%, 0.2%0.5% and 1% caffeine solution.The cyst roundworm number and root-knot nematode number of root are counted respectively, And detected using RT-qPCR method antagonism related genes.Statistics ratio between two samples of each Setup Experiments, sample Relatively using the Mann-Whitney U-test methods in statistics software SPSS 20, significant difference value is (P<0.05).It is tied Fruit figure see Fig. 8 and Fig. 9 respectively, the autochthonal length of cereal cyst nematode of the Aegilops varibilis (No. 2) after being handled through caffeine solution with Control group, which is compared, has notable growth vigor, while the autochthonal length of Meloidogyne incognita of susceptible tobacco is with compareing after caffeine processing Group, which is compared, has notable growth vigor.Show that the present invention obtains the Carbonado Diamond thing in Aegilops varibilis source to cereal cyst nematode There is inhibitory action with Meloidogyne incognita and improve plant resistance to environment stress effect.

The foregoing is only a specific embodiment of the invention, but protection scope of the present invention is not limited thereto, any The change or replacement expected without creative work, should all be included within the scope of the present invention.Therefore, it is of the invention Protection domain should be determined by the scope of protection defined in the claims.

Sequence table

SEQUENCE LISTING

<110>Chengdu Inst. of Biology, Chinese Academy of Sciences

<120>The Carbonado Diamond thing and its extracting method of a kind of Aegilops varibilis and application

<130> 1

<160> 18

<170> PatentIn version 3.5

<210> 1

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene100201_AS

<400> 1

gctattactt tactacggag cgaccttgtg 30

<210> 2

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene100201_S

<400> 2

cggcatttgt ttcgtgttct tcgtttat 28

<210> 3

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene100216_AS

<400> 3

cggcattcca ttcagcaatg tgcgtgtc 28

<210> 4

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene100216 _S

<400> 4

gccttcccac caaagcctcc tccaaccc 28

<210> 5

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene110602_AS

<400> 5

gcagtgaact gaagctgcaa ggagcaaa 28

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene110602 _S

<400> 6

caccaagacc aactaccgaa ccacaaga 28

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene11935_AS

<400> 7

ttgggatgaa ctgaaggcat cttgtaat 28

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene11935_S

<400> 8

atgaggcggc aacttgggct atctttgt 28

<210> 9

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene12233_AS

<400> 9

ggtagctgcg tagaggagta gacggtga 28

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene12233_S

<400> 10

ttctgacaat agaggatgcc atccaaca 28

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene12312_AS

<400> 11

gggatggtgt caaccgtagg gatcttgta 29

<210> 12

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene12312_S

<400> 12

atggagccgc cgtcagcgag gtggaaat 28

<210> 13

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene17651_AS

<400> 13

catctgagct tcttatgaac ccttctgc 28

<210> 14

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigne17651_S

<400> 14

gacgggacct ctgtggtgga gctacaat 28

<210> 15

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene55623_AS

<400> 15

cctgtccgcc gtcttctgcg aggtgatg 28

<210> 16

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene55623_S

<400> 16

tgtcctgctt gggcttgagc tgcgtgtc 28

<210> 17

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene111463_AS

<400> 17

accaatatgg caagaatggg ccagggag 28

<210> 18

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Unigene111463_S

<400> 18

aaggcgttca gcgaggacaa ggaggagt 28

Claims (2)

1. the extracting method of the Carbonado Diamond thing of a kind of Aegilops varibilis, it is characterised in that comprise the following steps that：

Aegilops varibilis root is taken to be cut into slices after cleaning, drying thoroughly removes moisture removal in 6 hours in 80 DEG C of baking ovens, then with crushing Machine is crushed, and is crossed after 60 mesh sieves, the Aegilops varibilis root sample of 10 grams of crushing is put into 50 milliliters of extraction kettle, using anhydrous second Alcohol is as entrainer, in CO₂30MPa in extraction apparatus, 60 DEG C of extractions 2h, wherein CO₂Flow control obtains variable mountain in 1.5LPM The Carbonado Diamond thing of sheep's hay.

2. the extracting method of the Carbonado Diamond thing of Aegilops varibilis according to claim 1, it is characterised in that：Described CO₂Extraction apparatus is Speed SFE-2 supercritical COs₂Extraction apparatus.