CN104498453B - The alkaline alpha amylase mutant that a kind of heat endurance and specific enzyme activity are improved - Google Patents

The alkaline alpha amylase mutant that a kind of heat endurance and specific enzyme activity are improved Download PDF

Info

Publication number
CN104498453B
CN104498453B CN201410852880.5A CN201410852880A CN104498453B CN 104498453 B CN104498453 B CN 104498453B CN 201410852880 A CN201410852880 A CN 201410852880A CN 104498453 B CN104498453 B CN 104498453B
Authority
CN
China
Prior art keywords
amy703
mutant
amylase
pet28a
enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410852880.5A
Other languages
Chinese (zh)
Other versions
CN104498453A (en
Inventor
张桂敏
卢争辉
马延和
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hubei University
Original Assignee
Hubei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hubei University filed Critical Hubei University
Priority to CN201410852880.5A priority Critical patent/CN104498453B/en
Publication of CN104498453A publication Critical patent/CN104498453A/en
Application granted granted Critical
Publication of CN104498453B publication Critical patent/CN104498453B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
    • C12N9/2411—Amylases
    • C12N9/2414—Alpha-amylase (3.2.1.1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01001—Alpha-amylase (3.2.1.1)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Alkaline alpha amylase mutant improved the invention discloses a kind of heat endurance and specific enzyme activity and its preparation method and application.It is on the basis of GenBank accession number is KF451925.1 alkaline alpha amylase Gene A my703, lack 669 nucleotides of its N-terminal (223 amino acid), obtain alkaline alpha amylase mutant gene N Amy703, converted Escherichia coli and be built into genetic engineering bacterium, the alkaline alpha amylase mutant N Amy703 of the high specific enzyme activity of high thermal stability are obtained through induced expression, purifying.Mutant specific enzyme activity brings up to 170.15U/mg, is 40 times before mutation；Its t at 50 DEG C1/2For 28min, than the t before mutation1/2Improve nearly 4 times.Its optimal reactive temperature improves 10 DEG C simultaneously.The N Amy703 zymologic properties that the present invention is provided, which have, significantly to be improved, and is more suitable for industrial production application.

Description

The alkaline alpha-amylase enzyme mutant that a kind of heat endurance and specific enzyme activity are improved
Technical field
The alkaline alpha-amylase enzyme mutant and its construction method that are improved the present invention relates to a kind of heat endurance and specific enzyme activity and Using belonging to genetic engineering technology field.
Background technology
Alpha-amylase (EC 3.2.1.1) belongs to the family of glycoside hydrolase 13 (GH13), and energy catalyzing hydrolysis starch and correlation are more α-Isosorbide-5-Nitrae-glycosidic bond inside polymers, is distributed in plant, animal and microorganism.Alpha-amylase is more because of energy hydrolysis starch and correlation Polymers produces the monose or oligosaccharides of α anomers, or forms α glycosidic bonds by transglucosidation, is to realize industrialized production earliest And it is the commercialization enzyme that purposes is most wide so far, yield is maximum, accounts for the 25%~33% of the global enzyme preparation market share, especially It is that acid starch enzyme is widely used in the industrialized productions such as starch material liquefaction, ensilage, brewed spirit, baking. In addition, the starch that the alkali alpha amylase that optimum activity is shown in alkaline solution can be applied in papermaking and pulp industry changes Property, and starch spot is removed as detergent additive, effect becomes increasingly conspicuous.
Have the advantages that to reduce microorganism pollution, increase substrate solubility and reduction viscosity, work due to reacting at high temperature Industry production process typically requires to carry out at high temperature.Meanwhile, the higher enzymatic conversion equivalent substrate of specific enzyme activity or generation equivalent product Required enzyme is less, and the time is shorter.
Come from Bacillus pseudofirmus 703 alkali alpha amylase Amy703 (amino acid sequence GenBank accession number is AGT54942), it has highest enzyme activity in 9.0,40 DEG C of pH, in alkaline pH (8.0~10.5) bar Stable under part, after 50 DEG C handle 20min, remnant enzyme activity is 18.5%, and induced expression, Ni posts be after purification in Escherichia coli Specific enzyme activity is 4.93U/mg.But alkali alpha amylase Amy703 specific enzyme activity also needs further raising with heat endurance, to meet Industrial production improves the requirement that efficiency saves the energy.
The content of the invention
The purpose of the present invention is to transform the alkali alpha amylase that GenBank accession number is AGT54942 using gene technology, Its specific enzyme activity, heat endurance are improved, industrial requirements at the higher level are further adapted to.
What the present invention was realized in.In the alkaline alpha-amylase enzyme gene that GenBank accession number is KF451925.1 Amy703, its corresponding amino acid sequence indexed number is on the basis of AGT54942, design primer (FP and RP) enters performing PCR, obtains The alpha-amylase mutant gene N-Amy703 of 669 nucleotides of N-terminal, its amino acid sequence such as SEQ ID NO.1 institutes must be lacked Show；
The primer is：FP:5’CGCGGATCCAATGTCTCTCACAACTTTAACCACAACC 3’
RP:5’CCGCTCGAGTTATTTCTGACCTCGCTTGTCACTC 3’。
The recombinant basic alpha-amylase Amy703 of present invention construction method, specifically includes following steps：
1) use chemistry fully synthetic or PCR method clone obtains alkaline α-shallow lake of the GenBank accession number for KF451925.1 Powder enzyme gene Amy703.
2) Amy703 genetic fragments are connected on coli expression carrier pET28a, obtain recombinant vector pET28a- Amy703；
3) the mutant primer FP and RP of design missing Amy703 genes 669 nucleotides of N-terminal, with recombinant vector pET28a- Amy703 is template, enters performing PCR；
FP:5’CGCGGATCCAATGTCTCTCACAACTTTAACCACAACC 3’
RP:5’CCGCTCGAGTTATTTCTGACCTCGCTTGTCACTC 3’
PCR reaction systems：10 × Ex Taq buffer, 5 μ l；DNTP (2.5mM), 5 μ l；Mutant primer FP (10 μM), 2 μ l；Mutant primer RP (10 μM), 2 μ l；Ex Taq, 0.3 μ l；Template, 1 μ l；Plus ddH2O to 50 μ l.
Blank control：Change the DNA profiling in above system into ddH2O, other are constant.
PCR amplification system：94 DEG C, 5min；94 DEG C, 30s, 55 DEG C, 30s, 72 DEG C, 2min 15s, 25 circulations；72 DEG C, 7min；12 DEG C, ∞；
4) by step 3) after the PCR primer that obtains reclaims with 0.7% Ago-Gel, carrier T pMD18-T is connected, it is logical Sequence verification is crossed, alkaline alpha-amylase enzyme mutant gene N-Amy703 is obtained, its amino acid sequence is as shown in SEQ ID NO.1；
5) by N-Amy703 genetic fragments restriction enzyme BamH I and the double digestions of Xho I, digestion system is：BamH I, 0.5μl；Xho I, 0.5 μ l；10 × K buffer, 5 μ l；PCR recovery products, 30 μ l, plus ddH2O to 50 μ l, 37 DEG C of processing 2h Afterwards, reclaimed with 0.7% Ago-Gel, connect 2h in 16 DEG C of enzymes with the carrier pET28a after the same manner is handled, enzyme connects System is：Endonuclease bamhi, 1.2 μ l；Digestion carrier, 0.3 μ l；Solution I, 1.5 μ l.Enzyme connect product thing is directly transformed into large intestine bar In bacterium XL-GOLD clone's competent cells, the restructuring load that two transformants obtain 669 nucleotide deletions of N-terminal through sequencing is selected Body pET28a-N-Amy703；
6) by step 5) obtain recombinant vector pET28a-N-Amy703 conversion e. coli bl21 (DE3), obtain produce alkali Property alpha-amylase N-Amy703 recombinant bacterial strain BL21 (DE3)-pET28a-N-Amy703；
7) by bacterial strain BL21 (DE3)-pET28a-N-Amy703 according to conventional Escherichia coli induced expression recombinant protein side Method, obtains recombinant protein N-Amy703, analysis alkaline alpha-amylase enzyme mutant N-Amy703 zymologic property.
The fermentation medium constituent is tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L.
669 nucleotides of N-terminal that the present invention lacks Amy703 genes by PCR method obtain N-Amy703, and are connected It is connected on coli expression carrier pET28a, is transformed into Escherichia coli XL-GOLD competence, screens recombinant vector PET28a-N-Amy703 (Fig. 1) simultaneously converts e. coli bl21 (DE3) expression bacterial strain, is obtained through induced expression, broken bacterium, purifying Alkaline alpha-amylase enzyme mutant N-Amy703 (Fig. 2), characterization analysis is carried out to N-Amy703, finds it in 50 DEG C of processing After 20min, remnant enzyme activity brings up to 72.2% (Fig. 4) from the 18.5% of protoenzyme Amy703.Meanwhile, specific enzyme activity is from protoenzyme Amy703 4.93U/mg, brings up to 170.15U/mg, improves nearly 40 times.Mutant N-Amy703 optimal reactive temperatures and most Suitable pH is respectively from 40 DEG C of Amy703, and pH 9.0 brings up to 50 DEG C, pH 9.5.This has established good for the application of alkali alpha amylase Good basis.
Amylase enzyme activity (U) defines method：Under optimum reaction conditionses, 1 micromole's product institute is converted into 1 minute The enzyme amount needed is a unit of activity (U).
Detect the definition method of alkali alpha amylase specific enzyme activity (U/mg)：Protoenzyme (Amy703) and mutant (N- Amy703 same way (purifying of Ni posts), the enzyme activity that every milligram of purifying protein has after purification) is passed through.
Brief description of the drawings
Fig. 1：(a) amplification of target gene.M：λ-EcoT14Ⅰdigest DNA Marker；1：PCR amplified bands；
(b) recombinant plasmid is detected.M：λ-EcoT14Ⅰdigest DNA Marker；1：Recombinant plasmid digestion band.
Fig. 2：The alkaline alpha-amylase enzyme mutant of SDS-PAGE electrophoresis detections after purification.M：Protein molecular weight standard；1： The alkaline alpha-amylase enzyme mutant band of purifying.
Fig. 3：Protoenzyme Amy703 heat endurance：Enzyme after purification is handled after 20min at different temperatures, determined residual Remaining enzyme activity.
Fig. 4：Mutant N-Amy703 heat endurance：Enzyme after purification is handled after 20min at different temperatures, determined Remnant enzyme activity.
Embodiment
Embodiment 1
1) PCR method clone is used to obtain alkaline alpha-amylase enzyme gene of the GenBank accession number for KF451925.1 Amy703.Amy703 genetic fragments are connected on coli expression carrier pET28a, recombinant vector pET28a- is obtained Amy703；
2) using recombinant vector pET28a-Amy703 as template, performing PCR is entered using mutant primer FP and RP；
FP:5’CGCGGATCCAATGTCTCTCACAACTTTAACCACAACC 3’
RP:5’CCGCTCGAGTTATTTCTGACCTCGCTTGTCACTC 3’
PCR reaction systems：10 × Pyrobest buffer, 5 μ l；DNTP (2.5mM), 5 μ l；Mutant primer FP (10 μM), 2μl；Mutant primer RP (10 μM), 2 μ l；Pyrobest, 0.3 μ l；Template, 1 μ l；Plus ddH2O to 50 μ l.Blank control：Will be with DNA profiling in upper system changes ddH into2O, other are constant.
PCR amplification system：94 DEG C, 5min；94 DEG C, 30s, 55 DEG C, 30s, 72 DEG C, 2min 15s, 25 circulations；72 DEG C, 7min；12 DEG C, ∞；
3) by step 2) after the PCR primer that obtains reclaims with 0.7% Ago-Gel, carrier T pMD18-T is connected, it is logical Sequence verification is crossed, alkaline alpha-amylase enzyme mutant gene N-Amy703 is obtained, its amino acid sequence is as shown in SEQ ID NO.1. N-Amy703 genetic fragments restriction enzyme BamH I and the double digestions of Xho I, digestion system is：BamH I, 0.5 μ l；Xho I, 0.5μl；10 × K buffer, 5 μ l；PCR recovery products, 30 μ l, plus ddH2After O to 50 μ l, 37 DEG C of processing 2h, with 0.7% Ago-Gel is reclaimed, and connects 2h in 16 DEG C of enzymes with the carrier pET28a after the same manner is handled, enzyme disjunctor system is：Digestion piece Section, 1.2 μ l；Digestion carrier, 0.3 μ l；Solution I, 1.5 μ l.Enzyme connect product thing is directly transformed into Escherichia coli XL-GOLD In (Invitrogen companies) clone competent cell, select two transformants and obtain 669 nucleotide deletions of N-terminal through sequencing Recombinant vector pET28a-N-Amy703；
4) by step 3) obtain recombinant vector pET28a-N-Amy703 conversion e. coli bl21 (DE3), obtain produce alkali Property alpha-amylase mutant N-Amy703 recombinant bacterial strain BL21 (DE3)-pET28a-N-Amy703；
The induced expression of the alkaline alpha-amylase enzyme mutant of embodiment 2 and purifying
Recombinant bacterial strain BL21 (DE3)-pET28a-N-Amy703 of embodiment 1 is inoculated into containing 50 μ g/ml kanamycins LB fluid nutrient mediums in, 37 DEG C, cultivate to OD under the conditions of 200rpm600=0.8, IPTG is added to final concentration of 0.5mM, 18 DEG C, induce 12h under the conditions of 200rpm.Thalline is collected by centrifugation, ultrasonic wave breaks bacterium, and supernatant is removed in centrifugation, crosses the purifying of Ni posts, uses super filter tube Concentration, obtains alkali alpha amylase mutant protein after purification, SDS-PAGE detections.
The enzyme activity determination of the alkaline alpha-amylase enzyme mutant of embodiment 3
The enzyme activity determination method of alpha-amylase：Albumen after purification is diluted into suitable multiple, takes 50 μ l to dilute enzyme liquid, is added to In the soluble starch substrate that 500 μ l are preheated in advance, 15min is reacted under assigned temperature, boiling water bath 5min terminating reactions, plus 800 μ l DNS solution, boiling water bath 10min after cooling, determines light absorption value at 540nm wavelength.Blank control adds when being boiling water bath Enter 50 μ l enzyme liquids.So that under optimum reaction conditionses, the enzyme amount needed for 1 μm of ol/L reduced sugar of production per minute is used as an enzyme activity Unit (U).
Through measuring, amylase mutant N-Amy703 is after 50 DEG C handle 20min, and remnant enzyme activity is from protoenzyme The 18.5% of Amy703 brings up to 72.2%.Meanwhile, specific enzyme activity brings up to 170.15U/ from protoenzyme Amy703 4.93U/mg Mg, improves nearly 40 times.

Claims (2)

1. the alkaline alpha-amylase enzyme mutant N-Amy703 that a kind of heat endurance and specific enzyme activity are improved, it is characterised in that GenBank accession number is KF451925.1 alkali alpha amylase Gene A my703, and its corresponding amino acid sequence indexed number is On the basis of AGT54942, design primers F P, RP enters performing PCR, obtains the alpha-amylase mutant of missing 669 nucleotides of N-terminal Gene N-Amy703, its amino acid sequence is as shown in SEQ ID NO.1；
The primer is：FP:5’CGCGGATCCAATGTCTCTCACAACTTTAACCACAACC 3’
RP:5’CCGCTCGAGTTATTTCTGACCTCGCTTGTCACTC 3’。
2. the alkaline alpha-amylase enzyme mutant N-Amy703 that the heat endurance and specific enzyme activity described in a kind of claim 1 are improved is built Method, it is characterised in that comprise the following steps：
1) alkali alpha amylase Gene A my703 is obtained using chemical fully synthetic or PCR method clone；
2) by step 1) obtain alkali alpha amylase Gene A my703 be connected on coli expression carrier pET28a, obtain Recombinant vector pET28a-Amy703；
3) the mutant primer FP and RP of design missing Amy703 genes 669 nucleotides of N-terminal, with recombinant vector pET28a- Amy703 is that template enters performing PCR,
FP:5’CGCGGATCCAATGTCTCTCACAACTTTAACCACAACC 3’
RP:5’CCGCTCGAGTTATTTCTGACCTCGCTTGTCACTC 3’
4) by step 3) obtain PCR primer with 0.7% Ago-Gel recovery after, be connected to carrier T pMD18-T, pass through Sequence verification, obtains claim 1) described in alkaline alpha-amylase enzyme mutant gene N-Amy703；
5) by N-Amy703 genetic fragments restriction enzyme BamH I and the double digestions of Xho I, digestion system is：BamH I, 0.5 μ l；Xho I, 0.5 μ l；10 × K buffer, 5 μ l；PCR recovery products, 30 μ l, plus ddH2After O to 50 μ l, 37 DEG C of processing 2h, use 0.7% Ago-Gel is reclaimed, and connects 2h, enzyme disjunctor system in 16 DEG C of enzymes with the carrier pET28a after the same manner is handled For：Endonuclease bamhi, 1.2 μ l；Digestion carrier, 0.3 μ l；Solution I, 1.5 μ l, enzyme connect product thing is directly transformed into Escherichia coli In XL-GOLD clone's competent cells, the recombinant vector that two transformants obtain 669 nucleotide deletions of N-terminal through sequencing is selected pET28a-N-Amy703；
6) by step 5) the recombinant vector pET28a-N-Amy703 conversion e. coli bl21s (DE3) that obtain, obtain producing alkaline α- Amylase mutant N-Amy703 recombinant bacterial strain BL21 (DE3)-pET28a-N-Amy703；
7) by bacterial strain BL21 (DE3)-pET28a-N-Amy703 according to conventional Escherichia coli induced expression recombinant protein method, Obtain recombinant protein N-Amy703, analysis alkali alpha amylase N-Amy703 zymologic property.
CN201410852880.5A 2014-12-31 2014-12-31 The alkaline alpha amylase mutant that a kind of heat endurance and specific enzyme activity are improved Active CN104498453B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410852880.5A CN104498453B (en) 2014-12-31 2014-12-31 The alkaline alpha amylase mutant that a kind of heat endurance and specific enzyme activity are improved

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410852880.5A CN104498453B (en) 2014-12-31 2014-12-31 The alkaline alpha amylase mutant that a kind of heat endurance and specific enzyme activity are improved

Publications (2)

Publication Number Publication Date
CN104498453A CN104498453A (en) 2015-04-08
CN104498453B true CN104498453B (en) 2017-08-08

Family

ID=52939905

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410852880.5A Active CN104498453B (en) 2014-12-31 2014-12-31 The alkaline alpha amylase mutant that a kind of heat endurance and specific enzyme activity are improved

Country Status (1)

Country Link
CN (1) CN104498453B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102057040A (en) * 2008-06-06 2011-05-11 丹尼斯科美国公司 Geobacillus stearothermophilus alpha-amylase (AMYS) variants with improved properties
CN102112605A (en) * 2008-06-06 2011-06-29 丹尼斯科美国公司 Variant alpha-amylases from bacillus subtilis and methods of use, thereof
CN102719418A (en) * 2012-03-23 2012-10-10 广西科学院 Alpha-amylase truncated body and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102057040A (en) * 2008-06-06 2011-05-11 丹尼斯科美国公司 Geobacillus stearothermophilus alpha-amylase (AMYS) variants with improved properties
CN102112605A (en) * 2008-06-06 2011-06-29 丹尼斯科美国公司 Variant alpha-amylases from bacillus subtilis and methods of use, thereof
CN102719418A (en) * 2012-03-23 2012-10-10 广西科学院 Alpha-amylase truncated body and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AGT54942.1;Lu Z 等;《GENBANK》;20140502;第1页 *
amylase Amy703 belonging to a new clade from Bacillus pseudofirmus.《J Ind Microbiol Biotechnol》.2014,第41卷783-793. *
KF451925.1;Lu Z 等;《GENBANK》;20140502;1-2 *
Zhenghui Lu 等.Identification and characterization of a novel alkaline α&#8209 *

Also Published As

Publication number Publication date
CN104498453A (en) 2015-04-08

Similar Documents

Publication Publication Date Title
Chadha et al. Thermostable xylanases from thermophilic fungi and bacteria: current perspective
Liu et al. Biochemical characterization of a novel xylanase from Paenibacillus barengoltzii and its application in xylooligosaccharides production from corncobs
CA2677643C (en) Starch hydrolysis using phytase with an alpha amylase
CN110628741B (en) Maltooligosyl trehalose synthase mutant and application thereof
CN103068997A (en) Neutral ph saccharification and fermentation
CN113373131B (en) GH16 family heat-resistant beta-1, 3-1, 4-glucanase mutant and application thereof
CN107709559B (en) Novel xylanase
CN104726435B (en) β -glucosidase mutant, recombinant expression plasmid thereof and transformed engineering strain
CN105039374B (en) A kind of starch induction type recombined bacillus subtilis and preparation method and application
Šuchová et al. A novel bacterial GH30 xylobiohydrolase from Hungateiclostridium clariflavum
CN105368805A (en) Pullulanase mutants capable of improving heat stability and catalytic efficiency
CN105112433A (en) Novel coding gene of Type-I pullulanase, and recombinant expression and application thereof
CN104498453B (en) The alkaline alpha amylase mutant that a kind of heat endurance and specific enzyme activity are improved
JP5641478B2 (en) How to reuse enzymes
CN109182301B (en) Disaccharide degrading enzyme gene and application thereof
CN106434604A (en) Pullulanase mutant with improved catalytic performance
CN105925594A (en) Raw starch-digesting glucoamylase, preparation method thereof and application of raw starch-digesting glucoamylase to raw starch hydrolysis and preparation of ethanol by simultaneous saccharification and fermentation of raw starch
CN113430217B (en) Continuous endo-cellulase and coding gene and application thereof
CN108410903A (en) The endo-xylanase and its encoding gene of a kind of resistance to low ph value and application
CN104928306A (en) Expression and application of high-temperature-resistant xylanase gene and protein thereof
CN101503678A (en) Malt oligosaccharide based mycose synthetase, coding gene and use
CN101519652A (en) Trehalose synthetase as well as encoding genes and application thereof
CN103695387B (en) Saccharomonospora viridis maltose alpha-amylase mutant and application thereof
CN112646797A (en) Method for heterogeneously expressing stropharia rugoso-annulata beta-glucosidase gene
Brumm et al. Identification, cloning and characterization of Dictyoglomus turgidum CelA, an endoglucanase with cellulase and mannanase activity

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant