CN104497112A - Atriplex canescens[Puesh]Nute photosystem II oxygen-evolving complex-containing protein gene cloning and use thereof - Google Patents

Abstract

The invention discloses Atriplex canescens[Puesh]Nute photosystem II oxygen-evolving complex-containing protein gene cloning and a use thereof and belongs to the technical field of plant gene engineering. A plant stress resistance-associated protein AcPsbP1 has an amino acid sequence shown in the formula of SEQ ID NO: 2 in the sequence table. A coding gene AcPsbP1 of the plant stress resistance-associated protein AcPsbP1 has a coding sequence selected from the following coding sequences: 1, a coding sequence with a nucleotide sequence composed of 30th-845th deoxynucleotide molecules at the end 5' in the formula of SEQ ID NO: 1 in the sequence table, and 2, a coding sequence composed of nucleotide molecules shown in the protein sequence formula of SEQ ID NO: 2 in the coding sequence table. A recombinant expression vector contains the coding gene AcPsbP1 of the plant stress resistance-associated protein AcPsbP1. Recombinant bacteria contain coding genes AcPsbP1 of the plant stress resistance-associated protein AcPsbP1. An Atriplex canescens[Puesh]Nute qRT-PCR detection result shows that the gene is subjected to up-regulated expression under NaCl and PEG stress. The AcPsbP1 is introduced into saccharomyces cerevisiae so that transgenic saccharomyces cerevisiae is obtained, the transgenic saccharomyces cerevisiae is subjected to stress treatment and a result shows that the AcPsbP1 can improve drought (sorbitol) and salt (NaCl) resistance of saccharomyces cerevisiae.

Description

Atyiplex canescen is containing Photosystem I I oxygen evolution complex protein gene cloning and application thereof

Technical field

The invention belongs to field of plant genetic, particularly relate to and use Saccharomyces Cerevisiae in S accharomyces cerevisiaeINVSc1 bacterial strain to express the albumin A cPsbP1 relevant to plant stress-resistance (being specially salt and arid), adopt real-time fluorescence quantitative PCR (PCR in real time simultaneously, RT-PCR) method study the function of this gene pairs abiotic stress NaCl and PEG.

Background technology

In current agriculture production, environment stress affects one of the most important factor of grain yield and challenge.Farm crop are in the whole season of growth, the impact of various stress factors can be subject to, as the disease and pest etc. of biotic, and the salt of abiotic stress, alkali, high temperature, low temperature, arid etc., these are coerced and limit growing of plant, crop yield finally can be caused to reduce, quality declines, direct impact even threatens grain security, have a strong impact in the adverse circumstance factor of crop production at these, extreme temperature, arid, high salt, nutritional trouble (comprise mineral substance poisoning and mineral deficiency) is the main limiting factor affecting crop yield, direct from salt every year, alkali, arid, the crop production reduction that the adverse circumstances such as low temperature stress cause still exceedes 20% of ultimate production, and Drought and salt to coerce be topmost restraining factors.Therefore, study the gene relevant with abiotic stress, and imported crop and carry out molecular breeding, cause the broad interest of researcher, and carry out the clone of adverse circumstance genes involved and the parsing of function thereof by engineered method, valuable information and material can be provided for plant stress-resistance breeding.But, from the angle directly solving key issue agriculture production, the genetically modified crops kind that agriculture production can rise remarkable effect is also few, the research of the mankind to plant adverse circumstance adaptability molecule mechanism is also nowhere near, far can not meet the demand of plant molecular breeding, compare with World Developed Countries, it is relative with the gene with important utility value less that China has independent intellectual property right.Meanwhile, current research also mainly concentrates on herbaceous plant, and also relative less with the Molecular and Genetic Study of arid to xylophyta and salt tolerant thereof.But at structure, growth, growth, physiology, and there is larger otherness in reply biology and abiotic stress etc. in draft and xylophyta.So, from xylophyta, find degeneration-resistant relevant gene and study, more candidate gene can be provided for the biology and this means of abiotic stress tolerance being improved crop by genetically engineered.

Atyiplex canescen (Atriplex canescens [Pursh] Nute) is a kind of saltbush, classification is Chenopodiaceae, atriplex, be prevalent in arid, semiarid zone, there is the characteristic of stronger drought-resistant, anti-saline and alkaline, cold resistant and resistance to heavy metal, especially drought-resistant and salt characteristic.Atyiplex canescen is at the Arid&semi-arid area of every annual rainfall>=180mm, average temperature of the whole year is only the low temp area of about 5 DEG C, even still well-grown under extreme low temperature is the severe environment such as-40 DEG C of areas and saltings, also be applicable to growth in the area of height above sea level about 2000 meters simultaneously, according to having been reported, Atyiplex canescen is called " biological demineralizer " by some country, and its one-year age just can absorb the salinity of more than 1 ton from the soil of 6.07 mu, Bush biomass also can reach 15t/hm ²crude protein content in branches and leaves, more than 12%, high yield and high quality, is rich in nutrition, and related science men think, Atyiplex canescen has and abundant nutritive value and considerable feed applications, therefore becomes desert, the very valuable excellent food shrub species in half-desert arid area.Meanwhile, Atyiplex canescen also has the ability of accumulation selenium, be therefore also widely used in soil conservation and slope, road is fixed in the U.S., but range improvement remains its main application.In recent years, Atyiplex canescen successively in the Xinjiang of China, Gansu, Ningxia, Qinghai and other local plantation, by large quantity research, fully demonstrated the anti-salt that Atyiplex canescen is stronger, alkali, arid, low temperature, barren good characteristic such as grade, becomes the fine tree species of greening and soil conservation gradually.

S. cervisiae (Saccharomyces cerevisiae) has typical eukaryotic system, it is diploid, it can form disulfide linkage in protein translation post-treatment process, there is the feature such as glycosylation and protein folding, make its gene expression pattern more close to the expression pattern in eukaryote, it also has the advantage that growth is quick, genetic manipulation is easy and be easy to cultivation etc., so in the correlative study to plant function gene, with yeast expression system screening, there is the irreplaceable dominance of prokaryotic expression system.Wine brewing yeast strain INVSc1 (genotype is MATa his3D1leu2trp1-289ura3-52) be through artificial reconstructed after uracil auxotrophy bacterial strain, when the yeast transformant of this bacterial strain uses SC-U to lack Screening of Media, false positive is low, transformation efficiency is high, is therefore desirable yeast expression bacterial strain.Utilize yeast nutrition deficient strain to the research of plant cDNA libraries and excavation, in plant, receive more and more concern.Frommer etc. and Hsu etc. (1993) are cloned into the NAT2/AAP1 gene of amino acid through enzyme in screening Arabidopis thaliana cDNA library, and this gene can the amino acid transport defect mutant of complementary yeast; The functional study of Yeast system research plant salt endurance expressing gene is also widely used, Yamada etc. (2002) just utilize yeast transformant to verify that propadiene cyclisation oxydase (AOC) gene can improve salt resistance greatly, infer in plant, also may have anti-salt functional to AOC gene further.Tang Yulin etc. (2007) utilize yeast to have studied soybean SALI3-2 albumen the salt resistance ability of yeast transformant can be made to be significantly improved, thus infer the anti-adversity ability that SALI3-2 gene has.As can be seen here, utilize yeast expression foreign protein and study its function and be subject to widespread use.

Real-Time PCR (RT-PCR) is the technology of the general gene expression detection of a kind of current application, it is by adding fluorophor, and utilize fluorescent signal to accumulate the process of the whole PCR of Real-Time Monitoring, finally by typical curve, quantitative analysis is carried out to unknown template, the method can avoid the deviation produced during the quantitative end product of normal PCR, thus the repeatability of experiment is improved, this technology has now been widely used in the expression amount change of monitoring cell mRNA.SYBR green is one of common method of Real-time PCR, advantages such as this method is highly sensitive, and versatility is good, and method is simple and generally being used by domestic and international scientific research.

Photosystem I I (PSII) in higher plant has and changes the function that luminous energy is chemical energy.PSII reduces plastoquinone Q under light _b, promote the running of photosynthetic oxygen evolution and PSII electron transmission.PSII complex body can be divided into two functional domains, and 1: electron transfer function territory (catching photopigment albumen and periphery by PSII core, inner circumferential to catch photopigment albumen and form); 2: oxygen evolution complex (oxygen evolvingcomplex, OEC), the cracking of the oxygen evolution complex catalytic water molecule of PS II, discharges oxygen and proton.In higher plant, nuclear gene PsbO, PsbP and PsbQ encodes 33 of PSII respectively, 24, with 17kDa oxygen evolution complex peripherin (these three albumen are also referred to as OEE1, OEE2 and OEE3), these 3 peripherins are positioned at the blister cavities side of PSII and combine closely with the manganese bunch of PSII, and the maintenance of PSII being put to oxygen vigor plays an important role.Wherein PsbP (The photosystem II oxygen evolving complexprotein) coding molecule amount size is the oxygen evolution complex peripherin PsbP of 24kDa, this proteinoid is very strong because of high so its folding ability of mind of β-pleated sheet structure composition, can to combine closely around oxygen evolution complex thus stablize PSII put oxygen vigor.The proton that in photosynthesis, photosynthetic oxygen evolution reaction needed is extremely stable and ionic environment, Na ⁺, Cl ⁺, Ca ²⁺, Mn ²⁺concentration ratio directly determines the efficiency that photosynthetic oxygen evolution reacts, though PsbP albumen do not participate in directly photosynthetic oxygen evolution reaction, PsbP albumen itself or by this albumen and other interactions between protein thus for photosynthetic oxygen evolution react provide the best environment and ion-exchange path.PsbP albumen can with Mn ²⁺in conjunction with so also can as Mn in plant materials ²⁺storage protein, for it provides Mn in the forming process of PSII ²⁺.Plant be subject to extraneous environment stress especially high-salt stress time, the Na of high density ⁺, Cl ^-the Meng Cu center of direct destruction photosystem PSII, PsbP albumen can provide Mn for the reparation of PSII ^2+,in this process, PsbP transcriptional level significantly raises thus helps PSII to complete reparation as early as possible.But in current numerous researchs, also without about the research report of Atyiplex canescen AcPsbP1 gene in the physiological function such as degeneration-resistant.

Summary of the invention

The present invention is by building low temperature (-10 DEG C) and salt stress (400mM NaCl) cDNA library of Atyiplex canescen (Atriplex canescens), and utilize Gateway technology to be recombinated to by cDNA library LR in Yeast expression carrier (pYES-DEST52), mixing plasmid vector is through being transformed in yeast strain INVSc1, and by simulation environment stress (NaCl, sorbyl alcohol) filter out the gene relevant to environment stress, utilize RT-PCR technology to detect this gene at environment stress (NaCl simultaneously, PEG6000) the expression amount change under condition, with the respective action of this gene of preliminary study environment stress in Atyiplex canescen.The present invention not only provides new foundation to the research of the drought-resistant of Atyiplex canescen and salt tolerant molecular mechanism, has the transgenic crop of anti-adversity ability and forest (salt tolerant, arid) lays the foundation for obtaining simultaneously.In the present invention, the recombination yeast transformant turning pYES-AcPsbP1 shows the ability of significantly drought-resistant and salt stress-resistant.Simultaneously in origin plant Atyiplex canescen, the expression of AcPsbP1 gene is also coerced salt stress and drought and is shown obvious response.

The invention provides a kind of albumen relevant to plant stress-resistance (salt and drought) containing Photosystem I I oxygen evolution complex functional protein domain and coding gene sequence thereof in Atyiplex canescen, by utilizing Yeast system to carry out functional verification, and the method detected by RT-PCR in origin plant is resolved further to this gene and application in plant stress-resistance:

Photosystem I I oxygen evolution complex protein gene provided by the invention, name is called AcPsbP1, is the nucleotide sequence shown in SEQ ID NO:1 in sequence table.AcPsbP1 gene is obtained by the order-checking of Atyiplex canescen cDNA library.This gene is altogether by 1036 based compositions, and complete open reading frame contains 813bp, and simultaneously also containing 5 ' non-translational region and 3 ' non-translational region sequence, the initiator codon of open reading frame is ATG, and terminator codon is TAA.

Drought-resistant and the salt stress of albumen provided by the present invention, name is called AcPsbP1, plant anti-adversity associated protein AcPsbP1, the protein be made up of the aminoacid sequence shown in SEQ ID NO:2 in sequence table.

The encoding sequence of the encoding gene AcPsbP1 of plant adversity resistance related protein AcPsbP1 is one of following:

1) nucleotide sequence of encoding sequence holds 30-845 position deoxynucleotide as 5 ' of SEQ ID NO:1 in sequence table;

2) nucleic acid molecule of SEQIDNO:2 protein sequence in polynucleotide.

A kind of recombinant expression vector, the encoding gene AcPsbP1 containing plant adversity resistance related protein AcPsbP1.

A kind of recombinant bacterium, the encoding gene AcPsbP1 containing plant adversity resistance related protein AcPsbP1.

Sequence 2 in sequence table is analyzed according to DNAMAN, and albumen is made up of 272 amino acid, iso-electric point 8.75, Tot Prot 28.96KDa.Generally, containing a transmembrane structure district, Protein secondary structure is curling containing 140,71 spirals, and 61 fold, have 15 antigen peptide sections.Albumen is containing 98 hydrophilic amino acids, and 174 hydrophobic amino acids, have slightly water-wet, analyzes the possible surf zone of sphaeroprotein at middle part and C end according to the Hphob./Kyte & Doolittle of Expasy protscale.PSORT Prediction predicted protein location possibility is followed successively by chloroplast(id), plastosome from big to small.

The Yeast expression carrier pYES-DEST52 (purchased from Invitrogen company) that the present invention relates to and AcPsbP1 gene recombination are pYES-AcPsbP1, and host's competent cell that this recombinant yeast expression vector transforms is yeast saccharomyces cerevisiae INVSc1.This Yeast expression carrier is except containing except the DNA sequences encoding of AcPsbP1, also carry GAL1 promotor, T7 promotor, URA3 gene, ampicillin resistance marker's gene, CYC1 stop transcription signal, LR recombination site attR1 and attR2, lethal gene ccdB for reverse screening, the various controlling elements of exogenous gene albumen in yeast needed for high expression such as the 6xHis Tag of protein purification, the V5epitope that protein expression detects.

The present invention have detected by RT-PCR method the response (PEG that this gene coercing for Drought and salt, NaCl process), gene shows gene upregulation under two kinds of Stress treatments, this gene of further supposition plays an important role in coercing at plant participation stress response especially Drought and salt, and the up-regulated expression of this gene contributes to the ability of the drought-resistant and anti-salt improving Atyiplex canescen.

The present invention is passing through yeast (NaCl, sorbyl alcohol) and RT-PCR (NaCl, PEG) about after the research of Drought and salt, the application of AcPsbP1 gene in adverse circumstance: this gene overexpression may improve the resistance of plant, described stress resistance of plant specifically can be the resistance to abiotic stress and biotic, abiotic stress as arid, extreme temperature, saline and alkaline etc., the particularly ability of the drought-resistant and salt stress of plant.

Accompanying drawing explanation

Fig. 1 is Atyiplex canescen Total RNAs extraction picture

Fig. 2 is 1Kb Plus DNA Ladder

Fig. 3 is that cDNA library Insert Fragment length PCR detects picture

Fig. 4 is for detecting picture for cDNA library Insert Fragment length PCR

Fig. 5 is 1Kb Plus DNA Ladder

Fig. 6 is pYES-AcPsbP1 recombinant plasmid pcr amplification gel electrophoresis figure

M:DL2000DNA Marker; M:2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp; 1,2: amplified fragments

Fig. 7 is AcPsbP1 functional domain compare of analysis result in NCBI

Fig. 8 is the homologous protein phylogenetic analysis of AcPsbP1 and other species

Fig. 9 is pYES-AcPsbP1 positive recombination yeast transformant PCR gel electrophoresis figure

M:2000bp, 1470bp, 1090bp, 738bp, 434bp, 280bp; 1,2: amplified fragments

1,2: positive yeast transformant PCR electroresis appraisal

The result of Figure 10 under to be that recombination yeast pYES-AcPsbP1 and pYES-DEST52 is non-coerce

Figure 11 is the result of recombination yeast pYES-AcPsbP1 and pYES-DEST52 under 3M sorbyl alcohol is coerced

Figure 12 is the result of recombination yeast pYES-AcPsbP1 and pYES-DEST52 under 2M NaCl coerces

Figure 10--in 12: pYES-AcPsbP1 yeast conversion is obviously being better than empty carrier pYES-DEST52 yeast transformant to the anti-adversity ability of 2M NaCl and 3M sorbyl alcohol.

Figure 13 is the expression amount variation diagram of AcPsbP1 gene after 400mM NaCl Stress treatment

Figure 14 is the expression amount variation diagram of AcPsbP1 gene after 20%PEG6000 Stress treatment

In Figure 13 and 14: AcPsbP1 gene starts up-regulated expression after NaCl process 6h; Meanwhile, after PEG process 6h, this gene starts up-regulated expression, and expression amount all can improve more than 10 times.

Embodiment

The acquisition of embodiment one: AcPsbP1 full length gene cDNA and sequential analysis

1. Stress treatment Atyiplex canescen:

Grow trimestral Atyiplex canescen plantlet of transplant under-10 DEG C of conditions to artificial climate incubator, normal cultivation is after 10 days, and plant to be planted recovery survival, sends young leaves, robust growth.Plant is transferred to containing under nutritious water planting condition, normal growth two days later, with 500mL containing the saline solution water planting process Atyiplex canescen plant of NaCl400mM, Stress treatment, after 4 days, plucks blade, and tender stem and young root clean up and liquid nitrogen flash freezer,-80 DEG C frozen, in order to building storehouse.

2. construction cDNA library:

The Atyiplex canescen sample of NaCl process after 4 days (blade, tender stem and young root) is extracted total serum IgE (Fig. 1, Fig. 2), then use Invitrogen company ' the strand cDNA containing complete cap sequence is carried out enrichment by cap antibody module ', and according to Super full-Length cDNA Library Construction Kit test kit builds cDNA library, and by Gateway technology, this cDNA library LR is recombinated in Yeast expression carrier pYES-DEST52, at random PCR detection (Fig. 3, Fig. 4, Fig. 5) is carried out to cDNA library, the fragment of more than length 500bp is checked order, utilize the BlastX of NCBI to carry out comparison and the relevant biological information Epidemiological Analysis of functional domain, obtain the expressed sequence tag (ESTs) of Atyiplex canescen salt stress.

The method of 2.1 Atyiplex canescen Total RNAs extraction:

2.1.1 get 100mg plant sample, with the rapid grinding powder of liquid nitrogen in the mortar of precooling, be quickly transferred to and meet in cold 2mL centrifuge tube.(ensure that whole process is in ventilating kitchen, prevents RNA from degrading.)

2.1.2 add 1mlTrizol reagent, thermal agitation mixing 15s, leaves standstill the abundant lysing cell of 10min.

2.1.3 add 0.2mL chloroform (trichloromethane), concussion mixing 15s, leaves standstill 5min rapidly.

2.1.4 high-speed low temperature (12,000rpm, 4 DEG C) centrifugal 15min.

2.1.5 supernatant is carefully transferred to new 1.5mL centrifuge tube, add 0.5mL Virahol, put upside down mixing, leave standstill 10min.

2.1.6 high-speed low temperature (12,000rpm, 4 DEG C) centrifugal 10min again.

2.1.7 remove supernatant, add the ethanol of 0.5mL75%, 7,500rpm low-temperature centrifugation 5min is with washing precipitation.

2.1.8 repeating step 2.1.7 once, further washing precipitation, removes ion.

2.1.9 carefully supernatant is drawn, and dry RNA precipitation in ventilating kitchen, and with the DEPC water dissolution RNA of 50 μ L.

3. screen the clone of AcPsbP1 gene fragment:

According to sequencing analysis, obtain Atyiplex canescen ESTs, therefrom obtain a coding to give out light the cDNA complete sequence AcPsbP1 of system II oxygen complex protein, the Yeast expression carrier pYES-AcPsbP1 obtained that recombinated by LR is converted into (DH5 α) in competent escherichia coli cell, after incubated overnight, picking list bacterium colony, and in LB (Amp containing 100mg/L) liquid nutrient medium incubated overnight, extract plasmid by plasmid extraction kit (Ding Guo company).And according to the universal sequence PCR primer on carrier, and carry out plasmid PCR amplification checking, to identify the cDNA sequence of acquisition.

Upstream (T7): 5 '-TAATACGACTCACTATAGGG-3 '

Downstream (R): 5 '-AGGGTTAGGGATAGGCTTACCTTC-3 '

PCR reaction system (25 μ L): each 0.5 μ L, Tag enzyme 0.5 μ L of Buffer2.5 μ L, upstream and downstream primer (T7, R), dNTP0.5 μ L, template 0.2 μ L, ddH ₂o20.8 μ L.The condition of PCR reaction: 94 DEG C of denaturations 5 minutes; 94 DEG C of sex change 30 seconds; Be cooled to rapidly 58 DEG C of annealing 30 seconds; 72 DEG C extend 2 minutes, 30 circulations; 72 DEG C extend 10 minutes; 4 DEG C of cooling preservation.Amplified production detects through the agarose gel electrophoresis of 1%, and the position of about 1036bp has specific object band (Fig. 6).

The sequential analysis of embodiment two: AcPsbP1 gene

After sequencing analysis, the full length cDNA sequence total length 1036bp of AcPsbP1 gene, comprises the open reading frame of 813bp, and analyze according to DNAMAN, albumen is made up of 272 amino acid, iso-electric point 8.75, Tot Prot 28.96KDa.Generally, containing a transmembrane structure district, Protein secondary structure is curling containing 140,71 spirals, and 61 fold, have 15 antigen peptide sections.Albumen is containing 98 hydrophilic amino acids, and 174 hydrophobic amino acids, have slightly water-wet, analyzes the possible surf zone of sphaeroprotein at middle part and C end according to the Hphob./Kyte & Doolittle of Expasy protscale.PSORT Prediction predicted protein location possibility is followed successively by chloroplast(id), plastosome from big to small, and this is the principal character of oxygen evolution complex PsbP family protein.Showing by analyzing, obtain the full length cDNA sequence of AcPsbP1 gene, and the accession number on GenBank being KJ027117.

Utilize NCBI (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) to carry out conservative region analysis (Fig. 7) to this encoding gene, the albumen of this genes encoding belongs to oxygen evolution complex PsbP family protein.By NCBI, BLASTX is carried out to the aminoacid sequence of AcPsbP1 genes encoding, by carrying out homology analysis and phylogenetic analysis with the aminoacid sequence of other species determining function, utilize MEGA4 software to carry out phylogenetic analysis, result shows: the evolution of amino acid relation that the PsbP in AcPsbP1 and spinach encodes is nearest.(Fig. 8).

Embodiment three: the conversion of recombination yeast and detection

Wine brewing yeast strain INVSc1 is urinary ammonia acid auxotroph (Ura ^-) type strain, lacking the yeast minimal medium (SC-Ura of urinary ammonia acid ^-) on, this yeast strain almost can not Growth and reproduction.And Yeast expression carrier (pYES2-DEST52) is upper containing URA3 gene, and the expression of this gene can make yeast transformant at SC-Ura ^-normal growth on substratum.Therefore, SC-Ura ^-selective agar medium can carry out screening that is positive and non-positive yeast transformant.By Li-acetate method, vector plasmid pYES-AcPsbP1 and pYES-DEST52 is transformed in competent yeast bacterial strain INVSc1 respectively, transformed yeast bacterium liquid is coated in SC-Ura ^-on solid selection medium, contrast with unconverted yeast, cultivate, after 2d except empty yeast is completely not long, the yeast transforming two kinds of plasmids all can grow and have bacterium colony to grow, and yeast conversion success is described, picking yeast list bacterium colony, carry out after incubated overnight abolishing cell walls, and carry out the further qualification of positive transformant by bacterium liquid PCR method.

1. use Lithium Acetate chemical transformation transformed saccharomyces cerevisiae INVSc1, its concrete step of converting:

A yeast strain mono-clonal (INVSc1) joins in 10mLYPD liquid nutrient medium by 1.1, and 30 DEG C are spent the night and shake training.

The OD of 1.2 detection yeast liquid ₆₀₀value, utilizes 50mL YPD liquid nutrient medium that the yeast liquid of incubated overnight is diluted to OD ₆₀₀be 0.4,30 DEG C to continue to shake training 2-4h.

After 1.3 low-temperature centrifugations (4 DEG C, 2500rpm) 5min, remove supernatant and collect thalline, with the resuspended thalline of 40mL1xTE damping fluid.

1.4 again after low-temperature centrifugation (4 DEG C, 2500rpm) 5min, collects thalline, with the resuspended thalline of 2mL1xLiAc/0.5xTE damping fluid.

The resuspended thalline obtained is dispensed into 1.5mL centrifuge tube according to the system of every pipe 100 μ L by 1.5.

The yeast cell of packing is placed in incubated at room 10min by 1.6.

1.7, in each transformation system (100 μ L), add 1 μ g plasmid DNA, 100 μ g denaturated salmon essence DNA, mixing.

700 μ L1x LiAc/40%PEG-3350/1xTE are added, mixing in 1.8 every individual system.

Mixed solution 30min in 1.930 DEG C of incubation step 1.8.

1.10 DMSO adding 88 μ L in every individual system again, after mixing, 42 DEG C of Water Unders bath thermal shock 7min.

1.115000rpm low-temperature centrifugation 1min, remove supernatant.

1.12 with the resuspended thalline of the damping fluid of the 1mL1xTE got ready, and 5000rpm low-temperature centrifugation 1min, removes supernatant further.

1.13 is resuspended by thalline with the damping fluid of 100 μ L1xTE, and be applied on yeast Selective agar medium, cultivates 24h for 30 DEG C.

2. the qualification of positive transformant

Single bacterium colony of random picking 5 yeast transformants (pYES2-AcPsbP1) from yeast Selective agar medium, 30 DEG C of shaking culture spend the night (200rpm), collect incubated overnight thalline, boiling water boiling 5min, be placed in rapidly on ice 5min with smudge cells, repeat several times, bacterium liquid PCR is carried out as template using cytoclasis liquid centrifugal concentrating sample, carry out pcr amplification with primer T7 and R, PCR reaction system is (25 μ L): each 0.5 μ L, Tag enzyme 0.5 μ L of Buffer2.5 μ L, upstream and downstream primer (T7, R), dNTP0.5 μ L, template 5 μ L, ddH ₂o15.5 μ L.

PCR primer is electrophoresis detection on the sepharose of 1%, and amplified fragments size is 1036bp, coincide (Fig. 9) with target length.Prove that recombinant plasmid pYES2-AcPsbP1 has been transformed in yeast strain.

Embodiment four: positive transformants yeast environment stress process

1. prepare before environment stress process

Get appropriate positive yeast transformant (pYES-DEST52, pYES2-AcPsbP1) bacterium liquid, be inoculated in the SC-U liquid nutrient medium containing 2% glucose, 200rpm shaking culture 24h under 30 DEG C of conditions, survey OD ₆₀₀value, and with SC-U liquid nutrient medium (2% glucose) by bacterium liquid OD ₆₀₀unification is adjusted to 0.4, cumulative volume 5mL, the centrifugal 1min of 8000rpm, Aspirate supernatant, add the yeast inducing culture resuspended thalline of 2mL containing 2% semi-lactosi, receive enlarged culturing in the inducing culture of 5mL with the ratio of 1:50,30 DEG C of shaking culture 24h, detect the OD of yeast INVSc1 (pYES-DEST52) and INVSc1 (pYES2-AcPsbP1) ₆₀₀value, and OD is adjusted in unification ₆₀₀value is 2, for subsequent use.Different abiotic stress process is carried out to this two primary yeasts transformant, compares the anti-salt of two primary yeast transformants and drought stress ability, experiment repetition 3 times.

2. simulate environment stress process

The plant being present in occurring in nature in the face of various biology and abiotic stress, most importantly salt stress (NaCl, KCl etc.) and drought stress in abiotic stress.

Carry out the simulation of salt and arid in laboratory conditions, coerce with 2M NaCl analog salt, the sorbyl alcohol Drought stress simulation of 3M.Use above two kinds of simulated conditions process yeast transformants, contrasted by the growing state of yeast, thus evaluate this gene in yeast after abduction delivering on the impact of yeast resistance, to carry out pre-test (Figure 10, Figure 11, Figure 12) to the degeneration-resistant function of this gene in yeast.

2.1NaCl process: by above-mentioned thalline for subsequent use respectively with the thalline not diluting and dilute 10,100,1000,10000 times, drawing 2 μ L bacterium liquid is inoculated on the SC-U solid medium containing 2% semi-lactosi, cultivate two days later, compare the colony growth state of two primary yeast transformed bacterias for 30 DEG C.

2.23M sorbyl alcohol arid simulation process: by above-mentioned thalline for subsequent use respectively with the thalline not diluting and dilute 10,100,1000,10000 times, drawing 2 μ L bacterium liquid is inoculated on the SC-U solid medium containing 2% semi-lactosi, cultivate two days later, compare the colony growth state of two primary yeast transformed bacterias for 30 DEG C.

The response of embodiment five: AcPsbP1 gene under Atyiplex canescen PEG and NaCl coerces

1. Atyiplex canescen Stress treatment:

After Atyiplex canescen seed normal condition in Nutrition Soil is grown 50 days, choose well-grown Atyiplex canescen to transfer in MS nutritive medium and carry out water planting, every day changes nutritive medium, water planting 3 days is after Atyiplex canescen robust growth, respectively with 400mM NaCl and 20%PEG6000 process, and 0,6,12,24, get root, stem and leaf, liquid nitrogen flash freezer ,-80 DEG C of preservations after 48h.

2.RNA extracts and reverse transcription:

Adopt Trizol method to extract total serum IgE (as embodiment one, 2.1), utilize the Prime of Takara company rT reagent KitWith gDNA Eraser (Perfect Real Time) test kit carries out reverse transcription to prepare cDNA, analyzes for quantity Real-timePCR.

3. quantitative fluorescent PCR analysis:

Utilize green Reagent test kit, uses 7500 fluorescent quantitation systems axiol-ogy AcPsbP1 gene (F:GGTTGGCTCTCACTGTCCTC; R:AATCCTTCGCCGTTGTAGGG) time dependent expression amount difference under different treatment.The eucaryon elongation growth factor (EF1-α) as reference gene (F:5 '-CCCCAGTTCTCGACTGTCAC-3 '; R5 '-TGGTGGGAACCATCTTCACG-3 ').Reaction conditions is: 95 DEG C of denaturations 30 seconds; 95 DEG C of sex change 5 seconds, 60 DEG C of annealing extensions 34 seconds, carry out 40 circulations; 95 DEG C of sex change 15 seconds, 60 DEG C of annealing extensions 1 minute, 95 DEG C of sex change 15 seconds; 60 DEG C extend 15 seconds.Adopt method analyzes expression amount difference (Figure 13, Figure 14).

Claims (4)

1. a plant anti-adversity associated protein AcPsbP1, is characterized in that the protein be made up of the aminoacid sequence shown in SEQ ID NO:2 in sequence table.

2., by the encoding gene AcPsbP1 of plant adversity resistance related protein AcPsbP1 described in claim 1, it is characterized in that the encoding sequence of described encoding gene AcPsbP1 is one of following:

1) nucleotide sequence of encoding sequence holds 30-845 position deoxynucleotide as 5 ' of SEQ ID NO:1 in sequence table; 2) nucleic acid molecule of SEQ ID NO:2 protein sequence in polynucleotide.

3. a recombinant expression vector, is characterized in that the encoding gene AcPsbP1 containing plant adversity resistance related protein AcPsbP1 described in claim 2.

4. a recombinant bacterium, is characterized in that the encoding gene AcPsbP1 containing plant adversity resistance related protein AcPsbP1 described in claim 2.