CN104450915A - Hemifusus tuba microsatellite loci, and primers and application of hemifusus tuba microsatellite loci - Google Patents
Hemifusus tuba microsatellite loci, and primers and application of hemifusus tuba microsatellite loci Download PDFInfo
- Publication number
- CN104450915A CN104450915A CN201410750857.5A CN201410750857A CN104450915A CN 104450915 A CN104450915 A CN 104450915A CN 201410750857 A CN201410750857 A CN 201410750857A CN 104450915 A CN104450915 A CN 104450915A
- Authority
- CN
- China
- Prior art keywords
- trumpet shell
- microsatellite locus
- whelk
- shell whelk
- trumpet
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses 14 hemifusus tuba microsatellite loci and primers of the hemifusus tuba microsatellite loci. Research shows that amplification results of the primers have high polymorphism and stability and can be applied to detection of genetic diversity of populations, individual identification or molecular assisted breeding of hemifusus tuba. The hemifusus tuba microsatellite loci are applied to breeding conservation and scientific study of the hemifusus tuba; usable molecular markers are provided for studies on genetic diversity of the hemifusus tuba; a method for carrying out genetic individual identification on the hemifusus tuba by using the microsatellite loci is provided; the shortcomings of an existing basic theory are overcome; the genetic typing is carried out on PCR products of the microsatellite loci; the genetic typing results are used for analyzing wild individuals of the hemifusus tuba, namely, the individual identification of the hemifusus tuba can be realized.
Description
Technical field
The invention belongs to molecular biology DNA marker technical field, particularly relate to Trumpet shell whelk microsatellite locus and primer thereof and application.
Background technology
Trumpet shell whelk Hemifusus tuba (Gmelin) belongs to Mollusca (Mollusca), Gastropoda (Gastropoda), Caenogastropoda (Neogastropoda), Kui Luo section (Galeodidae), for warm water species, live in the torrid zone, the ooze of sea area, subtropics subtidal zone shallow water depth 11-42m and sandy seabed; Shell is relatively large, and shape is like pyriform, and chitin heavily fortified point is thick, and shell table is had tawny or the fine and closely woven and short fine hair shell skin of light brown; Adult shell height 110-200mm, the wide 70-117mm of shell (about 150-300g), maximum shell is high more than 300mm (body weight >500g); Gyration about 8.5 layers, height, the width of every layer increase very fast, and start to body whorl from spire third layer, the shoulder of every layer has a circular row tubercle projection, then becomes leg-of-mutton sour jujube at body whorl.Trumpet shell whelk is mainly distributed on the south China Zhejiang, Fujian, Guangdong, Guangxi and Hainan coastal, shell is large-scale makees bugle, therefore is commonly called as " angle spiral shell ", " ring spiral shell ".Its soft body is loose, fine and tender taste, delicious flavour and nutritious, has high economic worth.The Trumpet shell whelk sold in the market is all adopted and is caught in natural marine site, but, excessively adopting to catch and add the reasons such as environmental pollution goes from bad to worse, sea area Trumpet shell whelk natural resources subject to severe risks of damage due to Trumpet shell whelk in recent years.Therefore, protect its germ plasm resource and carry out population genetic diversity evaluation and become one of China's sea area Trumpet shell whelk natural resources Sustainable development important topic anxious to be resolved.
Along with China's marine shellfish aquaculture fast development, the germ plasm resource of protection shellfish is the reliable guarantee of China's shellfishery healthy and sustainable development, is also day by day subject to people's attention simultaneously.Before a certain resource is protected, need to understand the genetic background about these species and population genetic variations, thus set up the genetic background archives of germ plasm resource.In recent years, the various DNA molecular marker technology developed rapidly, make people from different perspectives and different levels, more comprehensively disclose the genetic information of species, also for the germ plasm resource of shellfish provides important basic data.At present, both at home and abroad the genetic background of Trumpet shell whelk is known little about it, very urgent to its genetic diversity Journal of Sex Research.But; select a kind of effectively reliable; and the extensive artificial breeding that the molecule marker of bioinformation rich content is Trumpet shell whelk, raising provide basic theory foundation; for the exploitation of China's Trumpet shell whelk germ plasm resource, population identification, propagation are banished and given information with Reasonable Protection, it is a urgent problem.
Summary of the invention
The technical problem to be solved in the present invention is to provide Trumpet shell whelk microsatellite locus and primer thereof and application, so that breed protection and scientific research to Trumpet shell whelk.
For solving the problems of the technologies described above, the present invention by the following technical solutions:
Trumpet shell whelk microsatellite locus, there is base sequence arbitrary in sequence table SEQ .ID.No.1 to SEQ.ID.No.14, they respectively marker number be HT1, HT2, HT3, HT4, HT5, HT6, HT7, HT8, HT9, HT10, HT11, HT12, HT13, HT14.
The combination of Trumpet shell whelk microsatellite locus, comprises Trumpet shell whelk microsatellite locus HT1, HT2, HT3, HT4, HT5, HT6, HT7, HT8, HT9, HT10, HT11, HT12, HT13, HT14.
The primer of Trumpet shell whelk microsatellite locus, Trumpet shell whelk microsatellite locus HT1, HT2, HT3, HT4, HT5, HT6, HT7, HT8, HT9, HT10, HT11, HT12, HT13, the primer of HT14 comprises respectively and has SEQ.ID.No.15/16, 17/18, 19/20, 21/22, 23/24, 25/26, 27/28, 29/30, 31/32, 33/34, 35/36, 37/38, 39/40, a pair base sequence in 41/42, they respectively marker number be HT1p1/p2, HT2p1/p2, HT3p1/p2, HT4p1/p2, HT5p1/p2, HT6p1/p2, HT7p1/p2, HT8p1/p2, HT9p1/p2, HT10p1/p2, HT11p1/p2, HT12p1/p2, HT13p1/p2, HT14p1/p2.
The combination of primers of Trumpet shell whelk microsatellite locus, comprises primer HT1p1/p2, HT2p1/p2, HT3p1/p2, HT4p1/p2, HT5p1/p2, HT6p1/p2, HT7p1/p2, HT8p1/p2, HT9p1/p2, HT10p1/p2, HT11p1/p2, HT12p1/p2, HT13p1/p2, HT14p1/p2.
Above-mentioned Trumpet shell whelk microsatellite locus or its population genetic diversity being combined in Trumpet shell whelk detects, the application of Individual identification or marker assisted selection aspect.
The primer of claim 3 or 4 Trumpet shell whelk microsatellite locus or its population genetic diversity being combined in Trumpet shell whelk detects, the application of Individual identification or marker assisted selection aspect.
The population genetic diversity of Trumpet shell whelk detects carries out according to the following steps:
The extraction of <1> genomic dna: adopt CTAB (cetyl trimethylammonium bromide) extraction process to extract limb tap bolt because of group DNA;
<2> microsatellite PCR increases: adopt three-primer detection method to detect screening Trumpet shell whelk micro-satellite primers, and the micro-satellite primers amplifying genom DNA that will filter out, obtain the individual micro-satellite amplified production of Trumpet shell whelk;
<3> amplified production electrophoresis: 8% native polyacrylamide gel electrophoresis, cma staining detects amplification, and scanner record electrophoretogram, according to the amplification situation of each microsatellite locus of Electrophoretic;
<4> analysis of genetic diversity: according to the molecular size range determination genotype of the micro-satellite amplified production of individuality, utilize GENEPOP Version 4.0 to calculate genetic diversity parameter;
The interpretation of result of <5> gene type, removes following alternative site: without the site of genotypic results; At arbitrary individual allelic number in plural site; In the individual site of allelic below two of 30 Trumpet shell whelks.
Contriver has filtered out 14 microsatellite locus by magnetic bead concentration method of mixing from Trumpet shell whelk genomic dna, and have devised corresponding 14 pairs of polymorphic micro-satellite primers according to the flanking sequence at these microsatellite locus two ends.Research shows, obtain primer amplification there is polymorphism and the stability of height, the population genetic diversity that can be used for Trumpet shell whelk detects, Individual identification or marker assisted selection aspect.The present invention is applied to Trumpet shell whelk breed protection and scientific research among; available molecule marker is provided by the genetic diversity Journal of Sex Research for Trumpet shell whelk; and provide and utilize microsatellite locus to carry out the method for genetics individual recognition to Trumpet shell whelk, compensate for the deficiency of existing basic theory.Gene type is carried out to the PCR primer of microsatellite locus, utilizes genotypic results to analyze the wild individuality of Trumpet shell whelk, the individual recognition to Trumpet shell whelk can be realized.
Embodiment
One, the screening of microsatellite locus
1, the extraction of genomic dna
1) by Trumpet shell whelk abdominal foot muscle freezing at-80 DEG C, scalper shreds, and claims rapidly about 100mg to put into 1.5ml sterile centrifugation tube;
2) in each centrifuge tube, add CTAB lysis buffer 500 μ L, Proteinase K (20mg/ml) 10 μ L, digested and spends the night under 56 degree of water-baths, every upset mixing in several hours;
3) after treatments of the sample is complete, add CIA (chloroform: primary isoamyl alcohol=24:1) equivalent, rotate 20min, the centrifugal 10000rpm 10min of room temperature, liquid-transfering gun is drawn supernatant (middle layer can not sucking-off) in other clean centrifuge tube and is repeated CIA extracting once; 4) add PCI (phenol: chloroform: primary isoamyl alcohol=25:24:1), with got supernatant equivalent, rotate 10min, the centrifugal 10000rpm 10min of room temperature, get supernatant in other clean sterile centrifugation tube;
5) add equivalent CIA, rotate 10min, the centrifugal 10000rpm 10min of room temperature, gets supernatant;
6) add 0.6 times of volume isopropanol, turn upside down to appearance precipitation; The centrifugal 15min of room temperature 12000rpm; Manually remove supernatant liquor;
7) add 100% alcohol 1ml (4 DEG C of precoolings), put upside down stirring several times with hand, the centrifugal 1min of 12000rpm, manually removes supernatant liquor; Add 100% alcohol, 1ml replaces; The centrifugal 1min of 12000rpm, manually removes supernatant liquor;
8) centrifuge tube opening, put upside down with on clean paper handkerchief, dry about 15min, until dry;
9) add TE (10mM Tris-HC, 1mM EDTA, PH8.0) 500 μ L, 4 DEG C of dissolvings are spent the night;
10) Rnase (10mg/ml) 1 μ L is added, 37 DEG C of process 1h;
11) PCI extraction buffer purify DNA (repeating above step) is added;
12) add appropriate TE, (50 μ L) is spent the night in 4 DEG C of dissolvings;
13) spectrophotometer is quantitative, adjustment DNA solubility 1 μ g/ μ L;
14) get 5 μ L agarose electrophoresiss and detect DNA quality, 0.15g agarose adds 15ml TBE; 4 DEG C save backup.
2, enzyme is cut, joint connects and reclaim
1) enzyme of DNA is cut
20 μ L reaction systems:
37 DEG C of water bath with thermostatic control 3h, place 30min for 65 DEG C, make Mbo I inactivation, use 1.5% agarose gel electrophoresis, EB staining examine enzyme cuts result.
2) joint connects
(1) joint sequence
Adaptor A:5’-GGCCAGAGACCCCAAGCTTCG-3’(SEQ.ID.NO.43)
Adaptor B:3’-CCGGTCTCTGGGGTTCGAAGCCTAG-5’(SEQ.ID.NO.44)
(2) joint preparation
Adaptor B 1.5nmol, after 90 DEG C of process 2min, is placed in ice and cools rapidly.
25 μ L systems:
37 DEG C of water bath with thermostatic control 2h, then 80 DEG C of 5min make T4olynucleotide kinase (PNK) inactivation; Add 1.5nmol Adaptor A again, 80 DEG C of 5min, room temperature Slow cooling.
(3) joint connects
200 μ L reaction solutions:
Flick mixing, gentle centrifugation, 16 DEG C are spent the night.Rear 65 DEG C of 10min make T4DNA Ligase inactivation.Add reaction solution 1/10 volume sodium-acetate (3M, pH=5.2), 440 μ L 100% ethanol ,-20 DEG C are spent the night.4 DEG C, the centrifugal 45min of 12000rpm, removes supernatant, 70% washing with alcohol secondary, and 100% washing with alcohol once afterwards.Uncoveredly be placed in metal bath 37 DEG C of dry 1h, add 15 μ L TE, 4 DEG C of dissolvings are spent the night.
3) glue reclaims
After the sepharose detection tabs connection state of 1.5%, use the SanPrep pillar DNA glue of the biological (Shanghai) Co., Ltd. of raw work to reclaim test kit and reclaim 400-1000bp fragment.
3, the separation of microsatellite locus and pcr amplification
The Streptavidin (Strep tavidin) of the upper bag quilt of magnetic bead (Promega) can with probe (CA)
16(GA)
16on vitamin H (biotin) combine, thus by magnetic force, probe together to be separated together with required microsatellite sequence.
1) PCR primer sex change and hybridization
Probe hybrid is 100 μ L:PCR purified product 10 μ L, biotin labeled DNA probe (CA)
16(CT)
16each 200pmol, 20 × SSC 15 μ L.Hybridization solution puts into PCR instrument 95 DEG C of sex change 5min, after being placed in cooled on ice rapidly, and 68 DEG C of temperature bath 1h.
2) magnetic bead prepares
Get the fresh magnetic bead of a pipe (Promega), softly mix bead suspension, draw 100 μ L and put into 1.5ml sterile centrifugation tube, after magnetic frame removes supernatant, clean 3 times with 100 μ L 0.5 × SSC and remove supernatant.
3) enrichment
(1) join in magnetic bead pipe by hybrid mixed liquid, place 30min for 25 DEG C, every 10min mixes 1 time, removing supernatant;
(2) with 100 μ L 6 × SSC, room temperature cleans 2 times, each 4min;
(3) with 100 μ L 3 × SSC, 68 DEG C are cleaned 2 times, each 13min;
(4) with 100 μ L 6 × SSC, room temperature cleans 2 times, each 8min.
4) single stranded DNA containing microsatellite sequence is caught
Removing supernatant, adds 30 μ L aqua sterilisas, proceeds to PCR pipe, 95 DEG C of hot wash-out 10min, and rapid Aspirate supernatant, in another sterilizing 1.5ml centrifuge tube, is the rear single stranded DNA of hybridization.
PCR amplification system: 50 μ L reaction solution compositions:
PCR program: 94 DEG C of 3min; 60 DEG C of 45s; 72 DEG C of 1min; 94 DEG C of 45s; 60 DEG C of 45s; 72 DEG C of 45s; 35 circulations; 72 DEG C of 30min.Get 5 μ L, use 1.5% agarose gel electrophoresis, EB staining examine.Then, by PCR primer purifying.
4, DNA fragmentation clone, order-checking
Use pMD
tM20-T Vector Cloning Kit (Takara) connects the DNA fragmentation after purifying.The reaction system that carrier connects is 10 μ L:pMD
tM20-T Vector 1 μ L; Solution I 5 μ L; Purify DNA 4 μ L.16 DEG C of reaction forming spend the night.Add 100 μ L be transformed into bacillus coli DH 5 alpha competent cell by all connecting product, 1h cultivated by 37 DEG C of shaking culture casees, bacterium liquid is applied on the amicillin resistance LB flat board containing IPTG, X-gal, cultivate 12h for 37 DEG C, picking positive colony, containing in 96 porocyte culture plates of LB liquid nutrient medium (containing amicillin resistance), cultivates 12h for 37 DEG C.With vector primer M13-47 (5 ' CGCCAGGGTTTTCCCAGTCACGAC3 ', SEQ.ID.NO.45), the probe sequence (CA) of RV-M (5 ' GAGCGGATAACAATTTCACACAGG3 ', SEQ.ID.NO.46) and lifeless matter element mark
12or (CT)
12pCR colony identification is carried out to the hickie clone of random choose.The PCR primer obtained of amplification is by after 1.2% agarose electrophoresis detection, if there is corresponding micro-satellite core in clone, every bar product band should be more than 2 or 2.The bacterium colony meeting above-mentioned condition is sent to the order-checking of the handsome biotech firm in Shanghai, determines microsatellite locus.
Result: filter out 14 microsatellite locus, its base sequence is SEQ.ID.NO.1-14 respectively, and micro-satellite repeating unit information of 14 microsatellite locus listed by table 2.
Two, micro-satellite primers
Have devised corresponding 14 pairs of polymorphic micro-satellite primers according to the flanking sequence at these microsatellite locus two ends.Design of primers adopts software PRIMER 5.0, and design of primers adopts following rigor: (1) primer length is 16-25bp; (2) GC content is 40%-60%; (3) return of goods temperature is 40-65 DEG C; (4) expect that PCR primer is 100-300bp.
Table 1 Trumpet shell whelk microsatellite locus and corresponding primer information
Apply primer of the present invention and can amplify the PCR primer that can hybridize under strict conditions on DNA that sequence is SEQ.ID.NO.1-14.
Three, Trumpet shell whelk population genetic diversity detects
1) extraction of genomic dna: employing CTAB extraction process extracts 30 individual Trumpet shell whelk genomic dnas;
2) microsatellite PCR amplification: PCR reaction system: add template DNA 100ng, each 10 μMs of forward and reverse primer, 10xBuffer 1 μ L, dNTP 2mM, MgCl in PCR pipe
21.5mM, Taq enzyme 0.25U, add aqua sterilisa and form 10 μ L reaction systems; PCR program: 94 DEG C of 3min; Then 94 DEG C of 45s; 45s under the suitableeest annealing temperature; 72 DEG C of 45s; Circulate 35 times; Again at 72 DEG C of downward-extension 5min, last 4 DEG C of preservations;
3) amplified production electrophoresis: 8% native polyacrylamide gel electrophoresis, cma staining detects amplification, and scanner record electrophoretogram, according to the amplification situation of each microsatellite locus of Electrophoretic;
4) analysis of genetic diversity: according to the molecular size range determination genotype of the micro-satellite amplified production of each individuality, after genotype data is converted to the discernible data pattern of GENEPOP Version 4.0, utilize GENEPOP Version 4.0 to calculate genetic diversity parameter, parameter information is as table 2;
5) interpretation of result of gene type, removes following alternative site: without the site of genotypic results; At arbitrary individual allelic number in plural site; In the individual site of allelic below two of 30 Trumpet shell whelks.
The repeating unit of table 2 14 microsatellite locus, the relevant information of primer
Wherein, TM represents the annealing temperature of micro-satellite primers, and n represents number of alleles, and Ho representative observation heterozygosity, heterozygosity is expected in He representative.Increase with primer pair of the present invention 30 Trumpet shell whelk genomic dnas, analysis of genetic diversity result shows that the number of alleles of each microsatellite locus is not from 2 to 12 etc., and average number of alleles is 5.0; The scope of observation heterozygosity, from 0.0667 to 1.0000, expects that the scope of heterozygosity is from 0.0655 to 0.8784.
Five, the individual recognition to Trumpet shell whelk is realized by micro-satellite gene type in above-mentioned 14 sites
Use above-mentioned 14 microsatellite locus, to the genotype distribution results of 30 wild Trumpet shell whelks, (in table, only listing 7 Trumpet shell whelk microsatellite locus) as shown in the table.Distinguished by individuality and analyze, in 30 individualities in table, what allelic differences was minimum is 1 allelotrope, account for whole 14 allelic 7.1%, the individuality of these 1 allelic differences to for: 1 to 3,14 to 27,18 to 19,18 to 20,19 to 20,20 to 21,23 to 24,27 to 28.The allelotrope of other individualities is all more than 1 allelotrope.In table, 30 wild Trumpet shell whelk individualities are all distinguished by these 14 micro-satellites, thus achieve the individual recognition in molecular genetic level.
The micro-satellite genotypic results of table 3 ("-" represents amorphs)
Because can there be different multiplicity in the repeating unit of microsatellite locus, thus cause micro-satellite repeat length to change, this is also microsatellite locus polymorphism Producing reason, so microsatellite sequence of the present invention also comprises and is that the DNA of SEQ.ID.NO.1-14 can be hybridized respectively under strict conditions with above-mentioned base sequence and comprises the DNA sequence dna molecule of identical micro-satellite repeating unit.
Claims (7)
1. Trumpet shell whelk microsatellite locus, it is characterized in that there is base sequence arbitrary in sequence table SEQ .ID.No.1 to SEQ.ID.No.14, they respectively marker number be HT1, HT2, HT3, HT4, HT5, HT6, HT7, HT8, HT9, HT10, HT11, HT12, HT13, HT14.
2. the combination of Trumpet shell whelk microsatellite locus described in claim 1, is characterized in that comprising Trumpet shell whelk microsatellite locus HT1, HT2, HT3, HT4, HT5, HT6, HT7, HT8, HT9, HT10, HT11, HT12, HT13, HT14.
3. the primer of Trumpet shell whelk microsatellite locus described in claim 1, it is characterized in that: described Trumpet shell whelk microsatellite locus HT1, HT2, HT3, HT4, HT5, HT6, HT7, HT8, HT9, HT10, HT11, HT12, HT13, the primer of HT14 comprises respectively and has SEQ.ID.No.15/16, 17/18, 19/20, 21/22, 23/24, 25/26, 27/28, 29/30, 31/32, 33/34, 35/36, 37/38, 39/40, a pair base sequence in 41/42, they respectively marker number be HT1p1/p2, HT2p1/p2, HT3p1/p2, HT4p1/p2, HT5p1/p2, HT6p1/p2, HT7p1/p2, HT8p1/p2, HT9p1/p2, HT10p1/p2, HT11p1/p2, HT12p1/p2, HT13p1/p2, HT14p1/p2.
4. the combination of primers of Trumpet shell whelk microsatellite locus described in claim 3, is characterized in that comprising primer HT1p1/p2, HT2p1/p2, HT3p1/p2, HT4p1/p2, HT5p1/p2, HT6p1/p2, HT7p1/p2, HT8p1/p2, HT9p1/p2, HT10p1/p2, HT11p1/p2, HT12p1/p2, HT13p1/p2, HT14p1/p2.
5. Trumpet shell whelk microsatellite locus described in claim 1 or 2 or its population genetic diversity being combined in Trumpet shell whelk detects, the application of Individual identification or marker assisted selection aspect.
6. the primer of Trumpet shell whelk microsatellite locus described in claim 3 or 4 or its population genetic diversity being combined in Trumpet shell whelk detects, the application of Individual identification or marker assisted selection aspect.
7. the application according to claim 5 or 6, is characterized in that the population genetic diversity of Trumpet shell whelk detects and carries out according to the following steps:
The extraction of <1> genomic dna: adopt CTAB extraction process to extract limb tap bolt because of group DNA;
<2> microsatellite PCR increases: adopt three-primer detection method to detect screening Trumpet shell whelk micro-satellite primers, and the micro-satellite primers amplifying genom DNA that will filter out, obtain the individual micro-satellite amplified production of Trumpet shell whelk;
<3> amplified production electrophoresis: 8% native polyacrylamide gel electrophoresis, cma staining detects amplification, and scanner record electrophoretogram, according to the amplification situation of each microsatellite locus of Electrophoretic;
<4> analysis of genetic diversity: according to the molecular size range determination genotype of the micro-satellite amplified production of individuality, utilize GENEPOPVersion 4.0 to calculate genetic diversity parameter;
The interpretation of result of <5> gene type, removes following alternative site: without the site of genotypic results; At arbitrary individual allelic number in plural site; In the individual site of allelic below two of 30 Trumpet shell whelks.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410750857.5A CN104450915A (en) | 2014-12-09 | 2014-12-09 | Hemifusus tuba microsatellite loci, and primers and application of hemifusus tuba microsatellite loci |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410750857.5A CN104450915A (en) | 2014-12-09 | 2014-12-09 | Hemifusus tuba microsatellite loci, and primers and application of hemifusus tuba microsatellite loci |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104450915A true CN104450915A (en) | 2015-03-25 |
Family
ID=52897660
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410750857.5A Pending CN104450915A (en) | 2014-12-09 | 2014-12-09 | Hemifusus tuba microsatellite loci, and primers and application of hemifusus tuba microsatellite loci |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450915A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103397030A (en) * | 2013-08-22 | 2013-11-20 | 宁波大学 | Hemifusus tuba micro-satellite site and primer |
-
2014
- 2014-12-09 CN CN201410750857.5A patent/CN104450915A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103397030A (en) * | 2013-08-22 | 2013-11-20 | 宁波大学 | Hemifusus tuba micro-satellite site and primer |
Non-Patent Citations (2)
| Title |
|---|
| LEI WU ET AL.: "Isolation and characterization of 42 microsatellite loci from the Hemifusus tuba Gmelin", 《CONSERVATION GENET RESOUR》, no. 6, 8 April 2014 (2014-04-08), pages 707 - 710 * |
| YANG YUAN ET AL.: "Isolation and characterization of microsatellite loci in the tuba false fusus (Hemifusus tuba Gmelin)", 《CONSERVATION GENET RESOUR》, no. 1, 9 May 2009 (2009-05-09), pages 9 - 11 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101696452B (en) | Method for identifying molecules of recessive white feather genes of chicken | |
| CN103583470B (en) | A kind of breeding method of the blue or green shank and recessive white feather chicken strain based on molecule assisted Selection | |
| CN102134593B (en) | Gender-specific microsatellite marker for Cynoglossus semilaevis and application of same in identification of superfemale Cynoglossus semilaevis | |
| CN105567865B (en) | SNP marker relevant to Marsupenaeus japonicus heat resistance and its detection method | |
| Hu et al. | Discovery of pod shatter-resistant associated SNPs by deep sequencing of a representative library followed by bulk segregant analysis in rapeseed | |
| CN106811536B (en) | The InDel molecular labeling isolated with cucumber ZYMV resistant gene | |
| CN106868156B (en) | The InDel molecular labeling isolated with cucumber ZYMV resistant gene | |
| Groenen et al. | QTL mapping in chicken using a three generation full sib family structure of an extreme broiler x broiler cross | |
| CN101818195B (en) | Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application | |
| CN104087582B (en) | Label of pig fat deposition description proterties SNP genetic marker and application | |
| CN103609527A (en) | Green-shin recessive white-feather chicken strain breeding method | |
| CN107881256A (en) | For identifying single nucleotide polymorphism site, primer pair, kit and the application of Peach fruits hardship benevolence/sweet tea benevolence character | |
| CN105624307B (en) | Microsatellite primers and identification method for identifying crassostrea hongkongensis, crassostrea gigas and crassostrea pacificus and hybrid species thereof | |
| CN111304337A (en) | SRAP molecular marker, kit and method for identifying first filial generation of pelteobagrus fulvidraco, pelteobagrus vachelli and hybride and application | |
| Bali et al. | Development of a set of genomic microsatellite markers in tea (Camellia L.)(Camelliaceae) | |
| Shan et al. | Sex‐linked microsatellite marker detected in the female gametophytes of Undaria pinnatifida (Phaeophyta) | |
| CN102747070A (en) | Two CAPs markers tightly linked with muskmelon anti-powdery mildew gene Pm-AN and its application method | |
| Zhang et al. | Construction of a genetic linkage map for silver carp (Hypophthalmichthys molitrix) | |
| CN110760603B (en) | Molecular marker locus linked with theanine content of tea tree and application thereof | |
| CN115948600B (en) | Grape powdery mildew resistance dCAPS molecular marker and application thereof | |
| CN107937395A (en) | A kind of Portunus pelagicus polymorphic micro-satellite molecular labeling and identification method and application | |
| CN109468410A (en) | The gene molecule marker and its application that a kind of and capsicum genic male sterile gene msc-2 is isolated | |
| CN103710427B (en) | Single nucleotide polymorphism, detection method and application of chicken gene | |
| Anand et al. | Development and characterization of genomic microsatellite markers in Prosopis cineraria | |
| Wang et al. | Development and characterization of 15 microsatellite loci for Rhododendron delavayi Franch.(Ericaceae) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150325 |