CN104450762A - Biosynthesis method of alpha-lipoic acid, engineered strain and preparation method thereof - Google Patents
Biosynthesis method of alpha-lipoic acid, engineered strain and preparation method thereof Download PDFInfo
- Publication number
- CN104450762A CN104450762A CN201310425941.5A CN201310425941A CN104450762A CN 104450762 A CN104450762 A CN 104450762A CN 201310425941 A CN201310425941 A CN 201310425941A CN 104450762 A CN104450762 A CN 104450762A
- Authority
- CN
- China
- Prior art keywords
- lpla
- lipa
- lipd
- expression vector
- recombinant vectors
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses an alpha lipoic acid biosynthesis method, an engineered strain and a preparation method thereof. The biosynthesis method is as below: cloning an Escherichia coli lipD gene, an lplA gene, a metK gene and a lipA lipoic acid synthase gene; constructing a lipoic acid structural domain protein overexpression vector; cloning lplA into the vector highly expressing structural domain protein in series way structure to ensure full caprylyl; constructing a lipA expression vector or expression vector in series connection with metK; transforming the 4 vectors into appropriate Escherichia coli strains, regulating and comparing the medium composition and culture conditions, and promoting the conversion of caprylyl structural domain protein to lipoyl. The preparation method of alpha-lipoic acid provided by the invention employs combined low value chemical raw materials and pure biological production method, and has the advantages of little toxic substances in the production process, less pollution to the environment, high safety of the synthesized lipoic acid and high yield; and the alpha-lipoic acid has high activity.
Description
Technical field
The present invention relates to biological method synthetic active substance field, particularly relate to a kind of biosynthetic means of alpha-lipoic acid, engineering strain and preparation method thereof.
Background technology
Alpha-lipoic acid is that one has bioactive crude substance, and its chemical name is ALPHA-lipoic acid, and structural formula is such as formula I.It is present in organism widely as a kind of cofactor, and the epsilon-amino covalent attachment of Methionin, exists with amido linkage form usually and in protein molecule.Thioctic Acid has opticity, and R-(+)-alpha-lipoic acid (dextrorotation) is the natural form of Thioctic Acid in human body, and S-(+)-alpha-lipoic acid does not have activity in human body.
Alpha-lipoic acid can as food oral, and biological tissue very easily absorbs, and can play the effect of multi-functional what is called " versatility antioxidant " through hemato encephalic barrier, and its toxicity is very low.Therefore, alpha-lipoic acid is one strong oxidizer safely and effectively, is described as " universal antioxidant ".Its excellent antioxidation property shows three aspects: scavenging free radicals and active oxygen; Chelated metal ions; Regenerate other antioxidant (V
e, V
c, gsh etc.).In addition, Thioctic Acid has oxidized form (LA) and reduced form (DHLA) two kinds of forms, and it is not only water-soluble but also be dissolved in lipid, and oxidation resistant ability is liposoluble vitamin V
e100 times.
Due to Thioctic Acid have alleviate human body overtired, delay senility, the effects such as prevention is losing one's memory, and people's in-vivo content is considerably less, and reduce with advancing age, therefore, one of functional food of fast sale has been become in the U.S., Japan also have modified food and medicine and distinguishes standard, and regulation Thioctic Acid, not only as pharmaceuticals, also can be worked as food and use.In addition, Thioctic Acid not only has effect of beautifying face and moistering lotion, can also reach the object of fat-reducing simultaneously.Therefore, Thioctic Acid merits attention in the purposes of heath food and cosmetic field, and its market outlook are also very good.
Meanwhile, alpha-lipoic acid is also applied to the prevention of following disease with treatment: diabetes and chronic complicating diseases of diabetes, brain and neurodegenerative disorders, radiation injury, ischemical reperfusion injury and acquired immune deficiency syndrome (AIDS) etc.Germany's approved alpha-lipoic acid is as the curative of Diabetic distal symmetric polyneuropathy.
Current Thioctic Acid is produced mainly through chemosynthesis, is divided into two kinds according to the difference of raw material: hexanodioic acid method and pimelinketone method (Cai Huaixun etc., 2003; Liu Yu, 2005).Wherein, hexanodioic acid method is: aluminum chloride-catalyzed ethene and the condensation of chlorine acyl group monomethyl adipate, obtain chlorine ketoboidies, then obtain dithionic acid body through reduction, halogenation, dithiol and water decomposition, obtains object the product sulfur sad finally by iodine oxidation.Pimelinketone method is: take pimelinketone as starting raw material, through enamine, addition, peroxidation, replacement, oxidation totally 5 steps be obtained by reacting Thioctic Acid.
The shortcoming of Thioctic Acid is produced in chemosynthesis: complex steps, complex process, and all adopts industrial chemicals, and uses poisoned catalyst in a large number in building-up process, and the security of product is subject to serious query.Cause serious pollution to environment, be the non-friendly technique of environment simultaneously.In addition, the Thioctic Acid of chemosynthesis is the mixture that equivalent R-(+)-alpha-lipoic acid and S-(+)-alpha lipoic acid are formed, and need split further, just can obtain bioactive R-(+)-alpha-lipoic acid.The market quotes of current DL Thioctic Acid at 550 yuan/kilogram, and LA reach 2000-3000 unit/kilogram, price difference huge.Thioctic Acid production is in LA (dextrorotation) at present and replaces among the process of DL Thioctic Acid, and the Thioctic Acid that bacterium reincarnation is produced is LA, and therefore, this brings the huge market opportunity by producing Thioctic Acid to Bacterial Transformation.
Summary of the invention
Based on this, the object of the present invention is to provide a kind of biosynthetic means of alpha-lipoic acid, engineering strain and preparation method thereof.
The concrete technical scheme solved the problems of the technologies described above is as follows:
A preparation method for the engineering strain of biosynthesizing alpha-lipoic acid, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD
By the plasmid pGSS331 containing lipD and expression vector pET28 through Nco I and Sal I double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD;
(2) structure of expression vector pSU18-lplA
Clone E. coli lplA gene, through Xba I and Sal I double digestion and purifying reclaim, be connected to carrier pSU18 with ligase enzyme, obtain expression vector pSU18-lplA;
(3) preparation of recombinant vectors pET28-lipD-tac-lplA
A, amplification tac promoter gene: with plasmid pGSS331 for template, to increase to obtain tac promoter gene with primer PCR;
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, to increase to obtain lplA gene fragment with primer PCR;
C, with the lplA gene fragment in the tac promoter gene described in A in the step of equivalent (3) and step (3) described in B for template, increase with primer PCR, obtain junction fragment tac-lplA and purifying, be connected in carrier pMD19-T, obtain expression vector pMD19-T-tac-lplA;
D, the expression vector pMD19-T-tac-lplA described in C in step (3) and the recombinant vectors pET28-lipD described in step (1) to be cut through EcoRI and SalI enzyme, and purifying reclaims, and connects, obtain recombinant vectors pET28-lipD-tac-lplA with ligase enzyme; Use heat shock method, recombinant vectors pET28-lipD-tac-lplA is converted in E. coli expression strains BL21, obtain the sub-lipD-tac-lplA/BL21 of intestinal bacteria recombinant conversion;
(4) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
The structure of A, cloning vector pMD19-T-lipA
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene, and TA clone is connected to expression vector pMD19-T respectively, obtains pMD19-T-lipA;
The structure of B, expression vector pBAD34-lipA
By the pMD19-T-lipA described in A in expression vector pBAD34 and step (4), be connected through PstI with BspHI double digestion, obtain expression vector pBAD34-lipA;
C, pBAD34-lipA and pET28-lipD-tac-lplA is imported BL21 jointly, obtain the engineering strain of biosynthesizing alpha-lipoic acid.
The present invention also provides a kind of preparation method of engineering strain of biosynthesizing alpha-lipoic acid, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD
By the plasmid pGSS331 containing lipD and expression vector pET28 through Nco I and Sal I double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD;
(2) structure of expression vector pSU18-lplA
Clone E. coli lplA gene, through Xba I and Sal I double digestion and purifying reclaim, be connected to carrier pSU18 with ligase enzyme, obtain expression vector pSU18-lplA;
(3) preparation of recombinant vectors pET28-lipD-tac-lplA
A, amplification tac promoter gene: with plasmid pGSS331 for template, to increase to obtain tac promoter gene with primer PCR;
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, to increase to obtain lplA gene fragment with primer PCR;
C, with the lplA gene fragment in the tac promoter gene described in A in the step of equivalent (3) and step (3) described in B for template, increase with primer PCR, obtain junction fragment tac-lplA and purifying, be connected in carrier pMD19-T, obtain expression vector pMD19-T-tac-lplA;
D, the expression vector pMD19-T-tac-lplA described in C in step (3) and the recombinant vectors pET28-lipD described in step (1) to be cut through EcoRI and SalI enzyme, and purifying reclaims, and connects, obtain recombinant vectors pET28-lipD-tac-lplA with ligase enzyme; Use heat shock method, recombinant vectors pET28-lipD-tac-lplA is converted in E. coli expression strains BL21, obtain the sub-lipD-tac-lplA/BL21 of intestinal bacteria recombinant conversion;
(4) structure of recombinant vectors pBAD34-lipA-SD-metK
The structure of A, expression vector pMD19-T-lipA and pMD19-T-metK
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene and metK gene, and TA clone is connected to expression vector pMD19-T respectively, obtains pMD19-T-lipA and pMD19-T-metK;
The structure of B, expression vector pBAD34-lipA
By the pMD19-T-lipA described in A in expression vector pBAD34 and step (4), through PstI and BspHI double digestion, obtain expression vector pBAD34-lipA;
C, with the expression vector pBAD34-lipA described in B in step (4) for template, to increase to obtain lipA-SD gene fragment with primer PCR, by lipA-SD gene fragment and plasmid pSU18 through EcoRI and BamHI double digestion, obtain pSU18-lipA-SD, again by pSU18-lipA-SD and pBAD24 through EcoRI and PstI double digestion, obtain pBAD24-lipA-SD;
D, by the pBAD24-lipA-SD described in pMD19-T-metK and C described in A in step (4) through NdeI and SalI double digestion, connect with ligase enzyme, obtain expression vector pBAD24-lipA-SD-metK;
E, by plasmid pBAD34, expression vector pBAD24-lipA-SD-metK in step (4) described in D respectively through Nsi and SalI double digestion and purifying reclaim, obtain recombinant vectors pBAD34-lipA-SD-metK;
(5) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
By the recombinant vectors pET28-lipD-tac-lplA in the recombinant vectors pBAD34-lipA-SD-metK described in E in step (4) and step (3) described in D, jointly go in E. coli expression strains BL21, obtain the engineering strain of biosynthesizing alpha-lipoic acid.
Wherein in some embodiments, the primer in step (3) described in A is:
Upstream primer (Ptacpromoter up):
GTCTATGAATTCACTCCCCATCCCCCTGT；
Downstream primer (Ptacpromoter down):
GAGCAGGCGTAATGTGGACATGGATCCTGTTTCCTG；
Primer in step (3) described in B is:
Upstream primer (Promoter-lplA up):
CAGGAAACAGGATCCATGTCCACATTACGCCTGCTC；
T7 downstream primer (T7): GCTAGTTATTGCTCAGCGGTG;
Primer in step (3) described in C is:
Upstream primer (Ptacpromoter up):
GTCTATGAATTCACTCCCCATCCCCCTGT；
Downstream primer (T7): GCTAGTTATTGCTCAGCGGTG.
Wherein in some embodiments, the primer in step (4) described in C is:
Upstream primer: GAACACGCACGTCATGAGTAAAC;
Downstream primer:
GAGCTGGATCCCATATGCGTTTCACTCCTCTAGATTACTTAACTTCCATCCCTTTCG。
The present invention also provides a kind of preparation method of engineering strain of biosynthesizing alpha-lipoic acid, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD
By the plasmid pGSS331 containing lipD and expression vector pET28 through Nco I and Sal I double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD;
(2) structure of expression vector pSU18-lplA
Clone E. coli lplA, through Xba I and Sal I double digestion and purifying reclaim, be connected to carrier pSU18 with ligase enzyme, obtain expression vector pSU18-lplA;
(3) preparation of recombinant vectors pET28-lipD-lplA
A, amplification lipD gene fragment: with recombinant vectors pET28-lipD for template, to increase to obtain lipD gene fragment with primer PCR;
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, to increase to obtain lplA gene fragment with primer PCR;
C, with the lipD gene fragment described in A in the step of equivalent (3) and the lplA gene fragment described in B for template, lipD and lplA gene fragment is connected with primer PCR amplification, carry out TA clone, and be transformed in bacillus coli DH 5 alpha, screening positive clone, is defined as the correct recombinant vectors DH5 α-lipD-lplA of reading frame through order-checking; By recombinant vectors DH5 α-lipD-lplA and expression vector pET28 through NocI and BamHI double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD-lplA;
(4) structure of recombinant vectors pBAD34-lipA
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene, and is connected with pBAD34 carrier, builds recombinant vectors pBAD34-lipA;
(5) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
The pET28-lipD-lplA of C gained and the pBAD34-lipA of step (4) gained in step (3) is imported in E. coli expression strains BL21 jointly, obtains the engineering strain of biosynthesizing alpha-lipoic acid.
The present invention also provides a kind of preparation method of engineering strain of biosynthesizing alpha-lipoic acid, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD
By the plasmid pGSS331 containing lipD and expression vector pET28 through Nco I and Sal I double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD;
(2) structure of expression vector pSU18-lplA
Clone E. coli lplA gene, through Xba I and Sal I double digestion and purifying reclaim, be connected to carrier pSU18 with ligase enzyme, obtain expression vector pSU18-lplA;
(3) preparation of recombinant vectors pET28-lipD-lplA
A, amplification lipD gene fragment: with recombinant vectors pET28-lipD for template, to increase to obtain lipD gene fragment with primer PCR;
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, to increase to obtain lplA gene fragment with primer PCR;
C, with the lipD gene fragment described in A in the step of equivalent (3) and the lplA gene fragment described in B for template, lipD and lplA gene fragment is connected with primer PCR amplification, carry out TA clone, and be transformed in bacillus coli DH 5 alpha, screening positive clone, is defined as the correct recombinant vectors DH5 α-lipD-lplA of reading frame through order-checking; By recombinant vectors DH5 α-lipD-lplA and expression vector pET28 through NocI and BamHI double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD-lplA;
(4) structure of recombinant vectors pBAD34-lipA-SD-metK
The structure of A, cloning vector pMD19-T-lipA and pMD19-T-metK
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene and metK gene, and TA clone is connected to expression vector pMD19-T, DCRP carrier pMD19-T-lipA and pMD19-T-metK respectively;
The structure of B, expression vector pBAD34-lipA
By the cloning vector pMD19-T-lipA described in A in expression vector pBAD34 and step (5), through PstI and BspHI double digestion, obtain expression vector pBAD34-lipA;
C, with expression vector pBAD34-lipA for template, to increase to obtain lipA-SD gene fragment with primer PCR, by lipA-SD gene fragment and plasmid pSU18 through EcoRI and BamHI double digestion, obtain pSU18-lipA-SD, again by pSU18-lipA-SD and expression vector pBAD24 through EcoRI and PstI double digestion, obtain pBAD24-lipA-SD.Described primer comprises 3 ' end sequence (23bp) the XbalI site of lipA, the SD sequence (14bp) of carrier pBAD43, Ndel and BamHI site;
D, by the pBAD24-lipA-SD described in pMD19-T-metK and C described in A in step (4) through NdeI and SalI double digestion, connect with ligase enzyme, obtain expression vector pBAD24-lipA-SD-metK;
E, by plasmid pBAD34, expression vector pBAD24-lipA-SD-metK in step (4) described in D through Nsi and SalI double digestion and purifying reclaim, obtain recombinant vectors pBAD34-lipA-SD-metK;
(5) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
By the recombinant vectors pET28-lipD-lplA in the expression vector pBAD34-lipA-SD-metK described in E in step (4) and step (3) described in C, jointly go in E. coli expression strains BL21, obtain the engineering strain of biosynthesizing alpha-lipoic acid.
Wherein in some embodiments, the primer in step (3) described in A is:
Upstream primer (pET28forward): TAATACGACTCACTATAGGGG;
Downstream primer (lipD-lplANdeI):
GCGTAATGTGGACATATGTTACGCAGGAGCTGC；
Primer in step (3) described in B is:
Upstream primer (lipD-lplANdeI):
GCAGCTCCTGCGTAACATATGTCCACATTACGC；
Downstream primer (lplADown): CTTGGATCCCTGCAGGTAACTACCTTACAGC;
Primer in step (3) described in C is:
Upstream primer (pET28forward): TAATACGACTCACTATAGGGG;
Downstream primer (lplADown): CTTGGATCCCTGCAGGTAACTACCTTACAGC;
Wherein in some embodiments, the primer in step (4) described in C is:
Upstream primer: GAACACGCACGTCATGAGTAAAC;
Downstream primer:
GAGCTGGATCCCATATGCGTTTCACTCCTCTAGATTACTTAACTTCCATCCCTTTCG；
According to the engineering strain of the biosynthesizing alpha-lipoic acid that above-mentioned preparation method obtains.
The present invention also provides a kind of preparation method of alpha-lipoic acid, after the engineering strain of above-mentioned obtained biosynthesizing alpha-lipoic acid is cultivated 5-7h in LB substratum, 2YT+Fe substratum or 2YT substratum, be substrate with sad, IPTG and pectinose abduction delivering 2-4h.
The principle of the biosynthetic means, engineering strain and preparation method thereof of alpha-lipoic acid of the present invention is as follows:
The synthesis of Thioctic Acid is carried out on Apo-lipD, and in order to improve the output of Thioctic Acid, the present invention, by measuring the expression amount of Apo-lipD, filters out the carrier that expression amount is the highest, for further study based on it; In order to the complete n-octanoylation of the Apo-lipD making expression excessive; clone is used to have the pSU18(pYS1 of intestinal bacteria lplA gene first) Plastid transformation bacterial strain pSU18-lplA(YS17); inducement structure territory protein expression in containing IPTG and sad LB substratum; and the n-octanoylation degree of apo domain albumen is detected by native gel electrophoresis, and result shows at BL21(DE3) bacterial strain expresses lipD and lplA gene simultaneously that apo domain albumen can be made to be converted into n-octanoylation domain protein octanoylated domain completely.In order to reduce using and being convenient to next step operation of plasmid vector, the mode adopting series winding lipD and lplA is attempted in this research, completes the n-octanoylation of apo domain albumen.Construct two kinds of octanylated carriers, one is directly connected by two genes for this reason, and another kind first before lplA, connects a tac promotor, and rear and lipD contacts.In order to make the expression amount of lplA and lipD reach optimum balance, the promotor that increase by is slightly weak before lplA is attempted in this research.By comparing the promotor of all carriers in this laboratory, final tac promotor of selecting does further experiment, induce, but expression efficiency is lower than T7 because this promotor and T7 promotor belong to IPTG together.Pass through
softberrythe online promoter prediction software analysis in website obtains the promoter region of ptac85, and the promoter sequence according to ptac85 devises primer.
Again because lipA is key gene octanoylated-lipoyl domain being changed into lipoylated-lipoyl domain, the present invention is in preliminary experiment, same BL21(DE3 is imported with octanylated plasmid pET28-lipD-lplA by lipA gene clone to pBAD34 carrier) Host Strains, find that octanoylated-lipoyldomain can change into lipoylated-lipoyl domain; Obtain bacterial strain lipD-lplA & lipA/BL21, bacterial strain lipD-tac-lplA & lipA/BL21;
In addition, because two sulphur atoms are being inserted on 6 and 8 carbon atoms of Thioctic Acid by lipA, need S-adenosylmethionine synergism (Cicchillo, Iwig et al.2004), in order to the amount of S-adenosylmethionine in supplementary cell, therefore, this experiment increases a SD sequence by before S-adenosylmethionine synthase gene metK gene, adopt two kinds of method tandem expression with lipA afterwards, obtain bacterial strain lipD-lplA & lipA-SD-metK/BL21, bacterial strain lipD-tac-lplA & lipA-SD-metK/BL21.Namely adopting sad is substrate, and Thioctic Acid structural domain is synthetic vectors, by jointly importing lplA and lipA or jointly importing lplA, lipA and metK, obtains efficient Thioctic Acid and produces bacterial strain.
By the expression amount of more above-mentioned 4 kinds of bacterial strain apo-lipD, filter out the bacterial strain that expression amount is the highest.
The preparation method of alpha-lipoic acid of the present invention and the engineering strain of biosynthesizing alpha-lipoic acid and preparation method thereof tool has the following advantages and beneficial effect:
(1) biosynthetic means, engineering strain and preparation method thereof of alpha-lipoic acid of the present invention, adopt biological method for making, by Thioctic Acid structural domain lipD great expression, thus lay the foundation for synthesizing alpha-lipoic acid in a large number, then based on Thioctic Acid structural domain lipD, through great many of experiments, build and more different expression vectors, find lipD and lplA, lipA co expression, or by Thioctic Acid structural domain lipD and lplA, lipA and metK co expression, acquisition can synthesize the engineering strain of R-(+)-alpha-lipoic acid.
(2) engineering strain of the biosynthesizing alpha-lipoic acid obtained by the present invention, it produces the bacterial strain of output than wild colibacillary output high hundreds of times of R-(+)-alpha-lipoic acid, its alpha-lipoic acid produced is up to 500ng/mg dry cell weight, and output is higher than wild-type more than 200 times.
(3) preparation method of alpha-lipoic acid of the present invention, in production process, toxic substance is few, environmentally safe, and its synthesis Thioctic Acid security is high, nontoxic and be activated R-(+)-alpha-lipoic acid.
Accompanying drawing explanation
Fig. 1-A is that plasmid pGSS331 builds schematic diagram;
Fig. 1-B is that recombinant vectors pET28-lipD builds schematic diagram;
Fig. 1-C is lipD gene structure figure;
Fig. 2 is that plasmid pBAD24-lipD and plasmid pET15-lipD build schematic diagram;
Fig. 3 is that recombinant vectors pET28-lipD-lplA builds schematic diagram;
Fig. 4 is the structure schematic diagram of recombinant vectors pBAD34-lipA-SD-metK;
Fig. 5 is the structure schematic diagram of recombinant vectors pET28-lipD-tac-lplA;
Fig. 6 is that the obtained bacterial classification YS56 of embodiment 1 and wild-type e. coli BL21 produces obtained Thioctic Acid sample determination HPLC and schemes, wherein, and A:YS56 processing sample and standard specimen comparison diagram; The processing sample of B:BL21 and standard specimen comparison diagram;
Fig. 7 is the Thioctic Acid output of 4 kinds of bacterial strains in different culture media in embodiment 5.
Embodiment
In order to more clearly understand technology contents of the present invention, describe in detail especially exemplified by following examples.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, the people such as such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.Various conventional chemical reagent used in embodiment, is commercially available prod.
Pyruvic oxidase E2 subunit Thioctic Acid domain gene of the present invention, English name is apo-lipoyldomain, is called for short Apo-lipD or lipD;
Described Thioctic Acid protein ligase gene, is called for short lplA;
Described S-adenosylmethionine synthase gene, is called for short metK;
Described Thioctic Acid synthase gene, is called for short lipA;
Described octanylated domain protein, English name is octanoylated-lipoyl domain;
The octanylated domain protein of described sulphur, English name is lipoylated-lipoyl domain.
The plasmid pGSS331 that the present invention selects is presented by Illinois, US university professor Cronan; Described plasmid pGSS331 can by the ordinary method of this area, between its Nco I and Sal I restriction enzyme site, cloned by ptac85 that pyruvic oxidase E2 subunit lipD is gene constructed forms (Ali, S.T., Guest, J.R., 1990, Isolation AndCharacterization Of Lipoylated And Unlipoylated Domains Of the E2p Subunit Ofthe Pyruvate-Dehydrogenase Complex Of Escherichia-Coli, 271,1,139-145), see Fig. 1-C;
The expression vector pET28 that the present invention selects, bacillus coli DH 5 alpha, wild-type e. coli MG1655, E. coli expression strains BL21(DE3), expression vector pBAD34, plasmid pSU18, expression vector pMD19-T or expression vector pBAD24 be commercially available prod;
The metabolism of lipoic acid mutant strain of TM136 of the present invention is presented by Illinois, US university professor Cronan; (Morris, T.W., Reed, K.E., Cronan, J.E., 1995.Lipoic Acid Metabolism InEscherichia-Coli-the Lpla And Lipb Genes Define Redundant Pathways for LigationOf Lipoyl Groups To Apoprotein, 177,1,1-10);
LB substratum: Tryptones (Tryptone) 10g/L, yeast extract (Yeast extract) 5g/L, sodium-chlor (NaCl) 10g/L;
2YT+Fe substratum: 2YT substratum adds 50 μMs of FeCl
3, 20 μMs of CaCl
2, the MnCl of 10 μMs
2and ZnSO
4, the CoCl of 2 μMs
2, CuCl
2, NiCl
2, Na
2moO
4, Na
2seO
3and H
3bO
3
2YT substratum: bacto peptone 16g; Yeast extract 5g; NaCl5g; H
2o800ml adjusts pH=7.2 and adds H
2o to 1L, autoclaving.
Embodiment 1
A preparation method for the engineering strain of biosynthesizing alpha-lipoic acid, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD
By the plasmid pGSS331 containing lipD and expression vector pET28 through Nco I and Sal I double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD, see Fig. 1-A and Fig. 1-B;
Recombinant vectors pET28-lipD detects through Nco I and Sal I double digestion, shows consistent with on pGSS331 of lipD gene fragment that pET28-lipD carries.Showing that albumen that lipD encodes comprises N-terminal 33 amino-acid residues (1-33) and 52, middle part amino-acid residue (238-289) totally 85 amino-acid residues compositions of pyruvic oxidase E2 subunit through DNA sequencing and DNAstar software analysis, is a heterozygosis Thioctic Acid structural domain (Miles and Guest1987); The sequence of code segment pyruvic oxidase E3-binding structural domain is also had, see Fig. 1-C at 3 ' end of this DNA fragmentation; The experiment proved that, this partial sequence does not affect the expression of lipD, structure and function.
Cut pET28-lipD with Nco I and Sal I enzyme, lipD is connected on pBAD24, obtains plasmid pBAD24-lipD; Cut pET28-lipD with Nco I and Xho I enzyme, be connected to by lipD on pET15, obtain plasmid pET15-lipD, vector construction process is illustrated in fig. 2 shown below.
Above-mentioned recombinant vectors pET28-lipD, plasmid pBAD24-lipD and plasmid pET15-lipD are converted in e. coli bl21 (DE3) bacterial strain, analyze different strains apo domain expression amount, result shows: e. coli bl21 (DE3) bacterial strain carrying pET28-lipD plasmid, the apo domain albumen of accumulation is maximum, therefore chooses the starting vector of pET28-lipD plasmid as subsequent adaptation.
(2) structure of expression vector pSU18-lplA
Clone E. coli lplA gene, through Xba I and Sal I double digestion and purifying reclaim, be connected to carrier pSU18 with ligase enzyme, obtain expression vector pSU18-lplA;
(3) preparation of recombinant vectors pET28-lipD-lplA
A, amplification lipD gene fragment: use pfuDNA polysaccharase, with recombinant vectors pET28-lipD for template, pET28forward and lipD-lplANdeI is primer, the lipD gene fragment of pcr amplification 300bp;
Wherein, pET28forward is upstream primer: TAATACGACTCACTATAGGGG(SEQ IDNO.1);
LipD-lplANdeI(downstream primer):
GCGTAATGTGGACATATGTTACGCAGGAGCTGC（SEQ ID NO.2）；
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, lipD-lplANdeI and lplADown is primer, pcr amplification lplA gene fragment;
LipD-lplANdeI(upstream primer):
GCAGCTCCTGCGTAACATATGTCCACATTACGC（SEQ ID NO.3）；
LplADown(downstream primer): CTTGGATCCCTGCAGGTAACTACCTTACAGC(SEQ ID NO.4);
The lplA gene fragment described in lipD and B in C, purifying above-mentioned steps (3) described in A, with lipD and the lplA gene fragment of equivalent for template, with pET28forward and lplADown for primer, pcr amplification connects lipD and lplA gene fragment, purifying junction fragment, and under Taq DNA polymerase effect, tailing is held in fragment 3 ', purified fragments again, carry out TA clone, and being transformed in bacillus coli DH 5 alpha, screening positive clone, is defined as the correct recombinant vectors DH5 α-lipD-lplA of reading frame through order-checking;
By recombinant vectors DH5 α-lipD-lplA and expression vector pET28 through NoclI and BamHI double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD-lplA(see Fig. 3); Recombinant vectors pET28-lipD-lplA goes in E. coli expression strains BL21, obtains E. coli transformant lipD-lplA/BL21.
(4) structure of recombinant vectors pBAD34-lipA
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene, and TA clone is connected to carrier pMD19-T, is cloned into pBAD34 carrier by PstI and BspHI double digestion, builds recombinant vectors pBAD34-lipA;
(5) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
The pET28-lipD-lplA of C gained and the pBAD34-lipA of step (4) gained in step (3) is imported E. coli expression strains BL21 jointly, obtains the engineering strain (YS56) of biosynthesizing alpha-lipoic acid.
A kind of preparation method of alpha-lipoic acid, be specially: the abduction delivering by the engineering strain (YS56) of above-mentioned biosynthesizing alpha-lipoic acid: after the engineering strain (YS56) of the biosynthesizing alpha-lipoic acid of step (5) gained is cultivated 6h in LB substratum, 2YT+Fe substratum and 2YT substratum, it is substrate with sad, IPTG and pectinose abduction delivering 2-4h, obtain R-(+)-alpha-lipoic acid, output is see Fig. 7.
Embodiment 2
A preparation method for the engineering strain of biosynthesizing alpha-lipoic acid, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD: see embodiment 1 step (1);
(2) structure of expression vector pSU18-lplA: see embodiment 1 step (2);
(3) preparation of recombinant vectors pET28-lipD-lplA
A, amplification lipD gene fragment: see A in embodiment 1 step (3);
B, amplification lplA gene fragment: see B in embodiment 1 step (3);
C, see C in embodiment 1 step (3);
(4) structure (see Fig. 4) of recombinant vectors pBAD34-lipA-SD-metK
The structure of A, cloning vector pMD19-T-lipA and pMD19-T-metK
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene and metK gene, and TA clone is connected to expression vector pMD19-T respectively, obtains pMD19-T-lipA and pMD19-T-metK;
The structure of B, expression vector pBAD34-lipA
By the pMD19-T-lipA described in A in expression vector pBAD34 and step (4), through PstI and BspHI double digestion, obtain expression vector pBAD34-lipA;
C, with expression vector pBAD34-lipA for template,
SEQ ID NO.5:GTAAGTAATTACTGCAGGATTAC is upstream primer;
SEQ ID NO.6：
GAGCTGGATCCCATATGCGTTTCACTCCTCTAGATTACTTAACTTCCATCCCTTTC G is downstream primer (this downstream primer comprises the 3 ' end sequence (23bp) of lipA, XbaI site, the SD sequence (14bp) of carrier pBAD43, NdeI and BamHI site), pcr amplification obtains lipA-SD gene fragment, by lipA-SD gene fragment and plasmid pSU18 through EcoRI and BamHI double digestion, obtain carrier pSU18-lipA-SD, again by carrier pSU18-lipA-SD and expression vector pBAD24 through EcoRI and PstI double digestion, obtain pBAD24-lipA-SD;
D, by the pBAD24-lipA-SD described in pMD19-T-metK and C described in A in step (4) through NdeI and SalI double digestion, connect with ligase enzyme, obtain expression vector pBAD24-lipA-SD-metK;
E, by plasmid pBAD34, expression vector pBAD24-lipA-SD-metK in step (4) described in D through Nsi and SalI double digestion and purifying reclaim, obtain recombinant vectors pBAD34-lipA-SD-metK;
(5) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
By the recombinant vectors pET28-lipD-lplA in the expression vector pBAD34-lipA-SD-metK described in E in step (4) and step (3) described in C, jointly import BL21, obtain the engineering strain (YS59) of biosynthesizing alpha-lipoic acid;
A kind of preparation method of alpha-lipoic acid, be specially: after the engineering strain (YS59) of the biosynthesizing alpha-lipoic acid of above-mentioned steps (5) gained is cultivated 6h in LB substratum, 2YT+Fe substratum and 2YT substratum, it is substrate with sad, IPTG and pectinose abduction delivering 3 hours, obtain R-(+)-alpha-lipoic acid, its output can reach 340ng/mg dry cell weight, see Fig. 7.
Embodiment 3
A preparation method for the engineering strain of biosynthesizing alpha-lipoic acid, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD: see embodiment 1 step (1);
(2) structure of expression vector pSU18-lplA: see embodiment 1 step (2);
(3) structure of recombinant vectors pET28-lipD-tac-lplA
For making the expression amount of lplA and lipD reach optimum balance, the present embodiment increased a tac promotor before lplA.
A, amplification tac promoter gene: take pfuDNA as polysaccharase, plasmid pGSS331 is template, and Ptacpromoter down and Ptacpromoter up is primer, and pcr amplification obtains the tac promoter gene of 105bp;
Ptacpromoter up(upstream primer):
GTCTATGAATTCACTCCCCATCCCCCTGT（SEQ ID NO.7）；
Ptacpromoter down(downstream primer):
GAGCAGGCGTAATGTGGACATGGATCCTGTTTCCTG（SEQ ID NO.8）；
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, Promoter-lplA up and T7 is downstream primer, and pcr amplification obtains the lplA gene fragment of 1.4kb;
Promoter-lplA up(upstream primer):
CAGGAAACAGGATCCATGTCCACATTACGCCTGCTC（SEQ ID NO.9）；
T7 downstream primer: GCTAGTTATTGCTCAGCGGTG(SEQ ID NO.10);
C, with the lplA gene fragment in the tac promoter gene described in A in the step of equivalent (3) and step (3) described in B for template, with Ptacpromoter up and T7 as primer, before tac promotor PCR being connected to lplA gene with pfuDNA polysaccharase, purifying junction fragment tac-lplA, under Taq DNA polymerase effect, 3 ' end tailing is added in tac-lplA gene fragment, and carry out TA clone, transform large factory bacillus DH5 α, screening positive clone, and be connected in carrier pMD19-T, obtain expression vector pMD19-T-tac-lplA;
Ptacpromoter up upstream primer: GTCTATGAATTCACTCCCCATCCCCCTGT(SEQ ID NO.7);
T7 downstream primer: GCTAGTTATTGCTCAGCGGTG(SEQ ID NO.10).
D, the expression vector pMD19-T-tac-lplA described in C in step (3) and the recombinant vectors pET28-lipD described in step (1) to be cut through EcoRI and SalI enzyme, and purifying reclaims, connect with ligase enzyme, obtain recombinant vectors pET28-lipD-tac-lplA(see Fig. 5); Use heat shock method, recombinant vectors pET28-lipD-tac-lplA is converted in E. coli expression strains BL21, obtain E. coli transformant lipD-tac-lplA/BL21;
(4) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
The structure of A, cloning vector pMD19-T-lipA
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene, and TA clone is connected to expression vector pMD19-T respectively, obtains pMD19-T-lipA;
The structure of B, expression vector pBAD34-lipA
By the pMD19-T-lipA described in A in expression vector pBAD34 and step (5), be connected through PstI with BspHI double digestion, obtain expression vector pBAD34-lipA;
C, pBAD34-lipA and pET28-lipD-tac-lplA is imported BL21 jointly, obtain the engineering strain (YS61) of biosynthesizing alpha-lipoic acid;
A kind of preparation method of alpha-lipoic acid, be specially: the engineering strain BL21/pET28-lipD-tac-lplA & pBAD34-lipA(YS61 by the biosynthesizing alpha-lipoic acid of C gained in step (4)) in LB substratum, 2YT+Fe substratum and 2YT substratum, cultivate 6h after, it is substrate with sad, IPTG and pectinose abduction delivering 2-4h, obtain R-(+)-alpha-lipoic acid, output can reach 520ng/mg dry cell weight, specifically see Fig. 7.
Embodiment 4
A preparation method for the engineering strain of biosynthesizing alpha-lipoic acid, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD: see embodiment 1 step (1);
(2) structure of expression vector pSU18-lplA: see embodiment 1 step (2);
(3) structure of recombinant vectors pET28-lipD-tac-lplA
A: amplification tac promoter gene: see A in embodiment 3 step (3);
B, amplification lplA gene fragment: see B in embodiment 3 step (3);
The structure of C, expression vector pMD19-T-tac-lplA: see C in embodiment 3 step (3);
D, see D in embodiment 3 step (3);
(4) structure of recombinant vectors pBAD34-lipA-SD-metK: see embodiment 2 step (4);
(5) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
By the recombinant vectors pET28-lipD-tac-lplA in the recombinant vectors pBAD34-lipA-SD-metK described in E in step (4) and step (3) described in D, jointly go in E. coli expression strains BL21, obtain the engineering strain (YS58) of biosynthesizing alpha-lipoic acid.
A kind of preparation method of alpha-lipoic acid, be specially: the engineering strain (YS58) of biosynthesizing alpha-lipoic acid obtained for above-mentioned steps (5) is forwarded to after cultivating 6 hours in LB substratum, 2YT+Fe substratum and 2YT substratum, it is substrate with sad, IPTG and pectinose abduction delivering 3 hours, show that the output of Thioctic Acid can reach 350ng/mg dry cell weight, specifically see Fig. 7.
Embodiment 5
By the bacterial strain YS59 that bacterial strain YS56 obtained for embodiment 1, embodiment 2 obtain, the bacterial strain YS61 that embodiment 3 the is obtained and bacterial strain YS58 that embodiment 4 obtains is switched in LB substratum, 2YT+Fe substratum and 2YT substratum and cultivates after 6 hours, it is substrate with sad, IPTG and pectinose abduction delivering 3 hours, by HPLC and the biology method measuring output of each bacterial strain Thioctic Acid, result is see Fig. 7.
Wherein, the measuring method of HPLC is:
The KH of film process is crossed with 0.45 μM of millipore filtration
2pO
3(pH is 2.0, concentration 25mM) and HPLC level methyl alcohol are with the volume ratio mixed solution of 25:75 as moving phase, and flow velocity per minute 1ml, sample introduction 10 μ l, adopts the C18 post of Waters company to measure the content of Thioctic Acid in 330nm uv-absorbing light wave strong point.Concrete operations:
(1) spend the night and wash column equilibration chromatographic column: first with 100% equilibrium methanol 30min, the water of rear 25:75 volume ratio and equilibrium methanol 60min, then use the KH of 25:75 volume ratio
2pO
3with methanol wash column column equilibration 60min, finally use the KH of 25:75 volume ratio
2pO
3with methyl alcohol low flow velocity equilibrate overnight;
(2) sample determination: with the KH of 25:75 volume ratio
2pO
3with equilibrium methanol chromatographic column 20min, after in alignment with 330nm ultraviolet wavelength detection baseline, start sample introduction and measure: sample introduction 10 μ l, the KH of 25:75 volume ratio
2pO
3with methyl alcohol as moving phase, 1ml/min constant current working sample;
(3) post is washed after working sample: the KH adopting 25:75 volume ratio
2pO
3wash post 30min with equilibrium methanol, then use water and the equilibrium methanol 30min of 25:75 volume ratio, finally by 100% methyl alcohol 60min process chromatographic column.
The mensuration of standard specimen, prepare the Thioctic Acid standard specimen of 0.01mg/ml, 0.025mg/ml, 0.0500mg/ml, 0.075mg/ml, 0.1000mg/ml, 0.2mg/ml respectively, then the area concentration measuring Thioctic Acid according to each standard specimen absorption area compares typical curve, obtain its equation of linear regression, then extrapolate sample lipoic acid concentration according to equation.
As can be seen from Figure 6: the output of the bacterial strain YS56 that embodiment 1 is obtained is apparently higher than wild-type e. coli BL21.
As can be known from Fig. 7: 2YT Thioctic Acid that culture medium culturing produces, output is far above other substratum, wherein, the output of the bacterial strain YS59 that the output of the bacterial strain YS56 that embodiment 1 is obtained is 1.56mg/L, embodiment 2 is obtained is 1.06mg/L, and the output of the bacterial strain YS58 that output reaches 2.1mg/L, embodiment 4 obtains of the bacterial strain YS61 that embodiment 3 is obtained is 1.44mg/L.
And add in the substratum of micro-Fe at LB and 2YT, the production peak of Thioctic Acid is not also more than 1.4mg/ml.Tentatively show that 2 × YT is a kind of substratum of applicable accumulation Thioctic Acid.Adopting uses the same method determines the Thioctic Acid output of e. coli bl21 (DE3) and MG1655, is about 0.005mg/L.This shows that the amount of bacterial strain lipD-tac-lplA-lipA/BL21 biosynthesizing Thioctic Acid is wild colibacillary more than 100 times.
The determination of activity of embodiment 6 Thioctic Acid
The metabolism of lipoic acid mutant strain of TM136 is used to carry out Qualitative Identification.This mutant strain is adding energy normal growth on the sad basic medium of active sulphur, and can not normal growth on the basic medium not adding Thioctic Acid.In basic medium, add the 1ml Thioctic Acid sample 25 μ l of 500ng/ml Thioctic Acid standard model or hydrolysis extraction respectively, do basic medium blank simultaneously.Streak inoculation TM136, in often kind of culture medium flat plate, spends the night at 37 DEG C of same CMC model, detects its growing state.
Result shows: the fermentation strain described in embodiment 1-4 is adding normal growth on the sad basic medium of active sulphur, and the Thioctic Acid produced has very high biological activity.
The above embodiment only have expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but therefore can not be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Claims (10)
1. a preparation method for the engineering strain of biosynthesizing alpha-lipoic acid, is characterized in that, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD
By the plasmid pGSS331 containing lipD and expression vector pET28 through Nco I and Sal I double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD;
(2) structure of expression vector pSU18-lplA
Clone E. coli lplA gene, through Xba I and Sal I double digestion and purifying reclaim, be connected to carrier pSU18 with ligase enzyme, obtain expression vector pSU18-lplA;
(3) preparation of recombinant vectors pET28-lipD-tac-lplA
A, amplification tac promoter gene: with plasmid pGSS331 for template, to increase to obtain tac promoter gene with primer PCR;
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, to increase to obtain lplA gene fragment with primer PCR;
C, with the tac promoter gene described in A in step (3) and the lplA gene fragment described in B for template, with primer PCR amplification, obtain junction fragment tac-lplA and purifying, be connected in carrier pMD19-T, obtain expression vector pMD19-T-tac-lplA;
D, the expression vector pMD19-T-tac-lplA described in C in step (3) and the recombinant vectors pET28-lipD described in step (1) to be cut through EcoRI and SalI enzyme, and purifying reclaims, and connects, obtain recombinant vectors pET28-lipD-tac-lplA with ligase enzyme;
(4) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
The structure of A, cloning vector pMD19-T-lipA
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene, and TA clone is connected to expression vector pMD19-T respectively, obtains pMD19-T-lipA;
The structure of B, expression vector pBAD34-lipA
By the pMD19-T-lipA described in A in expression vector pBAD34 and step (4), be connected through PstI with BspHI double digestion, obtain expression vector pBAD34-lipA;
C, the pBAD34-lipA of B gained in step (4) and the pET28-lipD-tac-lplA of the middle D gained of step (3) are imported BL21 jointly, obtain the engineering strain of biosynthesizing alpha-lipoic acid.
2. a preparation method for the engineering strain of biosynthesizing alpha-lipoic acid, is characterized in that, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD
By the plasmid pGSS331 containing lipD and expression vector pET28 through Nco I and Sal I double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD;
(2) structure of expression vector pSU18-lplA
Clone E. coli lplA gene, through Xba I and Sal I double digestion and purifying reclaim, be connected to carrier pSU18 with ligase enzyme, obtain construction of expression vector pSU18-lplA;
(3) preparation of recombinant vectors pET28-lipD-tac-lplA
A, amplification tac promoter gene: with plasmid pGSS331 for template, to increase to obtain tac promoter gene with primer PCR;
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, to increase to obtain lplA gene fragment with primer PCR;
C, with the lplA gene fragment in the tac promoter gene described in A in step (3) and step (3) described in B for template, increase with primer PCR, obtain junction fragment tac-lplA and purifying, be connected in carrier pMD19-T, obtain expression vector pMD19-T-tac-lplA;
D, the expression vector pMD19-T-tac-lplA described in C in step (3) and the recombinant vectors pET28-lipD described in step (1) to be cut through EcoRI and SalI enzyme, and purifying reclaims, and connects, obtain recombinant vectors pET28-lipD-tac-lplA with ligase enzyme;
(4) structure of recombinant vectors pBAD34-lipA-SD-metK
The structure of A, expression vector pMD19-T-lipA and pMD19-T-metK
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene and metK gene, and TA clone is connected to expression vector pMD19-T respectively, obtains pMD19-T-lipA and pMD19-T-metK;
The structure of B, expression vector pBAD34-lipA
By the pMD19-T-lipA described in A in expression vector pBAD34 and step (4), through PstI and BspHI double digestion, obtain expression vector pBAD34-lipA;
C, with the expression vector pBAD34-lipA described in B in step (4) for template, to increase to obtain lipA-SD gene fragment with primer PCR, by lipA-SD gene fragment and plasmid pSU18 through EcoRI and BamHI double digestion, obtain pSU18-lipA-SD, again by pSU18-lipA-SD and pBAD24 through EcoRI and PstI double digestion, obtain pBAD24-lipA-SD;
D, by the pBAD24-lipA-SD described in pMD19-T-metK and C described in A in step (4) through NdeI and SalI double digestion, connect with ligase enzyme, obtain expression vector pBAD24-lipA-SD-metK;
E, by plasmid pBAD34, expression vector pBAD24-lipA-SD-metK in step (4) described in D respectively through Nsi and SalI double digestion and purifying reclaim, obtain recombinant vectors pBAD34-lipA-SD-metK;
(5) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
By the recombinant vectors pET28-lipD-tac-lplA in the recombinant vectors pBAD34-lipA-SD-metK described in E in step (4) and step (3) described in D, jointly go in E. coli expression strains BL21, obtain the engineering strain of biosynthesizing alpha-lipoic acid.
3. the preparation method of the engineering strain of biosynthesizing alpha-lipoic acid according to claim 1 and 2, is characterized in that, the primer in step (3) described in A is:
Ptacpromoter up upstream primer: GTCTATGAATTCACTCCCCATCCCCCTGT;
Ptacpromoter down downstream primer:
GAGCAGGCGTAATGTGGACATGGATCCTGTTTCCTG；
Primer in step (3) described in B is:
Promoter-lplA up upstream primer:
CAGGAAACAGGATCCATGTCCACATTACGCCTGCTC；
T7 downstream primer: GCTAGTTATTGCTCAGCGGTG;
Primer in step (3) described in C is:
Ptacpromoter up upstream primer: GTCTATGAATTCACTCCCCATCCCCCTGT;
T7 downstream primer: GCTAGTTATTGCTCAGCGGTG.
4. the preparation method of the engineering strain of biosynthesizing alpha-lipoic acid according to claim 2, is characterized in that, the primer in step (4) described in C is:
Upstream primer: GAACACGCACGTCATGAGTAAAC;
Downstream primer:
GAGCTGGATCCCATATGCGTTTCACTCCTCTAGATTACTTAACTTCCATCCCTTTCG。
5. a preparation method for the engineering strain of biosynthesizing alpha-lipoic acid, is characterized in that, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD
By the plasmid pGSS331 containing lipD and expression vector pET28 through Nco I and Sal I double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD;
(2) structure of expression vector pSU18-lplA
Clone E. coli lplA gene, through Xba I and Sal I double digestion and purifying reclaim, be connected to carrier pSU18 with ligase enzyme, obtain expression vector pSU18-lplA;
(3) preparation of recombinant vectors pET28-lipD-lplA
A, amplification lipD gene fragment: with recombinant vectors pET28-lipD for template, to increase to obtain lipD gene fragment with primer PCR;
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, to increase to obtain lplA gene fragment with primer PCR;
C, with the lplA gene fragment of the lipD gene fragment of A gained in step (3) and B gained for template, lipD and lplA gene fragment is connected with primer PCR amplification, carry out TA clone, and be transformed in bacillus coli DH 5 alpha, screening positive clone, is defined as the correct recombinant vectors DH5 α-lipD-lplA of reading frame through order-checking; By recombinant vectors DH5 α-lipD-lplA and expression vector pET28 through NcoI and BamHI double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD-lplA;
(4) structure of recombinant vectors pBAD34-lipA
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene, and TA clone is connected to carrier pMD19-T, is cloned into pBAD34 carrier by PstI and BspHI double digestion, builds recombinant vectors pBAD34-lipA;
(5) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
The pET28-lipD-lplA of C gained and the pBAD34-lipA of step (4) gained in step (3) is imported in E. coli expression strains BL21 jointly, obtains the engineering strain of biosynthesizing alpha-lipoic acid.
6. a preparation method for the engineering strain of biosynthesizing alpha-lipoic acid, is characterized in that, comprises the steps:
(1) structure of prokaryotic expression carrier pET28-lipD
By the plasmid pGSS331 containing lipD and expression vector pET28 through NcoI and Sal I double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD;
(2) structure of expression vector pSU18-lplA
Clone E. coli lplA gene, through Xba I and Sal I double digestion and purifying reclaim, be connected to carrier pSU18 with ligase enzyme, obtain expression vector pSU18-lplA;
(3) preparation of recombinant vectors pET28-lipD-lplA
A, amplification lipD gene fragment: with recombinant vectors pET28-lipD for template, to increase to obtain lipD gene fragment with primer PCR;
B, amplification lplA gene fragment: with recombinant vectors pSU18-lplA for template, to increase to obtain lplA gene fragment with primer PCR;
C, with the lplA gene fragment of the lipD gene fragment of A gained in step (3) and B gained for template, lipD and lplA gene fragment is connected with primer PCR amplification, carry out TA clone, and be transformed in bacillus coli DH 5 alpha, screening positive clone, is defined as the correct recombinant vectors DH5 α-lipD-lplA of reading frame through order-checking; By recombinant vectors DH5 α-lipD-lplA and expression vector pET28 through NcoI and BamHI double digestion and purifying reclaim, connect with ligase enzyme, obtain recombinant vectors pET28-lipD-lplA;
(4) structure of recombinant vectors pBAD34-lipA-SD-metK
The structure of A, cloning vector pMD19-T-lipA and pMD19-T-metK
With wild-type e. coli MG1655 STb gene for template, pcr amplification obtains lipA gene and metK gene, and TA clone is connected to expression vector pMD19-T, DCRP carrier pMD19-T-lipA and pMD19-T-metK respectively;
The structure of B, expression vector pBAD34-lipA
By the cloning vector pMD19-T-lipA of gained in A in expression vector pBAD34 and step (4), be connected through PstI with BspHI double digestion, obtain expression vector pBAD34-lipA;
C, with the expression vector pBAD34-lipA of B gained in step (4) for template, to increase to obtain lipA-SD gene fragment with primer PCR, by lipA-SD gene fragment and plasmid pSU18 through EcoRI and BamHI double digestion, obtain pSU18-lipA-SD, again by pSU18-lipA-SD and expression vector pBAD24 through EcoRI and PstI double digestion, obtain pBAD24-lipA-SD;
D, by the pBAD24-lipA-SD described in pMD19-T-metK and C described in A in step (4) through NdeI and SalI double digestion, connect with ligase enzyme, obtain expression vector pBAD24-lipA-SD-metK;
E, by plasmid pBAD34, expression vector pBAD24-lipA-SD-metK in step (4) described in D through Nsi and SalI double digestion and purifying reclaim, obtain recombinant vectors pBAD34-lipA-SD-metK;
(5) preparation of the engineering strain of biosynthesizing alpha-lipoic acid
By the recombinant vectors pET28-lipD-lplA in the expression vector pBAD34-lipA-SD-metK described in E in step (4) and step (3) described in C, jointly go in E. coli expression strains BL21, obtain the engineering strain of biosynthesizing alpha-lipoic acid.
7. the preparation method of the engineering strain of the biosynthesizing alpha-lipoic acid according to claim 5 or 6, is characterized in that, the primer in step (3) described in A is:
PET28forward upstream primer: TAATACGACTCACTATAGGGG;
LipD-lplANdeI downstream primer:
GCGTAATGTGGACATATGTTACGCAGGAGCTGC；
Primer in step (3) described in B is:
LipD-lplANdeI upstream primer:
GCAGCTCCTGCGTAACATATGTCCACATTACGC；
LplADown downstream primer: CTTGGATCCCTGCAGGTAACTACCTTACAGC;
Primer in step (3) described in C is:
PET28forward upstream primer: TAATACGACTCACTATAGGGG;
LplADown downstream primer: CTTGGATCCCTGCAGGTAACTACCTTACAGC.
8. the preparation method of the engineering strain of biosynthesizing alpha-lipoic acid according to claim 6, is characterized in that, the primer in step (4) described in C is:
Upstream primer: GTAAGTAATTACTGCAGGATTAC;
Downstream primer:
GAGCTGGATCCCATATGCGTTTCACTCCTCTAGATTACTTAACTTCCATCCCTTTCG。
9. the engineering strain of the biosynthesizing alpha-lipoic acid that the preparation method according to any one of claim 1-8 obtains.
10. the preparation method of an alpha-lipoic acid, it is characterized in that, after the engineering strain of the biosynthesizing alpha-lipoic acid obtained by claim 9 is cultivated 5-7h in LB substratum, 2YT+Fe substratum or 2YT substratum, be substrate with sad, IPTG and pectinose abduction delivering 2-4h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310425941.5A CN104450762B (en) | 2013-09-17 | 2013-09-17 | The biological synthesis method of alpha lipoic acid, engineered strain and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310425941.5A CN104450762B (en) | 2013-09-17 | 2013-09-17 | The biological synthesis method of alpha lipoic acid, engineered strain and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450762A true CN104450762A (en) | 2015-03-25 |
| CN104450762B CN104450762B (en) | 2018-03-20 |
Family
ID=52897512
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310425941.5A Active CN104450762B (en) | 2013-09-17 | 2013-09-17 | The biological synthesis method of alpha lipoic acid, engineered strain and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450762B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108300726A (en) * | 2018-01-08 | 2018-07-20 | 苏州大学 | α-bisabolol synthetic plasmid and its construction method and colibacillus engineering strain |
| CN110869384A (en) * | 2017-07-14 | 2020-03-06 | 毒菌公司 | Cell factory with improved delivery of iron-sulfur clusters |
| CN111206035A (en) * | 2020-02-17 | 2020-05-29 | 河南科技学院 | Gene and method for regulating senescence process of target plant leaves and application of gene and method to cotton crops |
| CN113862293A (en) * | 2020-06-30 | 2021-12-31 | 中国科学院广州生物医药与健康研究院 | Biosynthesis method of alpha-lipoic acid, engineering strain and preparation method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040235123A1 (en) * | 2001-04-20 | 2004-11-25 | Liao Hans H | Production of alpha-lipoic acid |
-
2013
- 2013-09-17 CN CN201310425941.5A patent/CN104450762B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040235123A1 (en) * | 2001-04-20 | 2004-11-25 | Liao Hans H | Production of alpha-lipoic acid |
Non-Patent Citations (2)
| Title |
|---|
| ALI,S.T.ET AL.: "Isolation And Characterization of Lipoylated And Unlipoylated Domains of the E2p Subunit of the Pyruvate-Dehydrogenase Complex of Escherichia-Coli", 《BIOCHEM.J.》 * |
| 阮丽娟等: "抗氧化剂α-硫辛酸的生物合成研究进展", 《精细与专用化学品》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110869384A (en) * | 2017-07-14 | 2020-03-06 | 毒菌公司 | Cell factory with improved delivery of iron-sulfur clusters |
| CN108300726A (en) * | 2018-01-08 | 2018-07-20 | 苏州大学 | α-bisabolol synthetic plasmid and its construction method and colibacillus engineering strain |
| CN108300726B (en) * | 2018-01-08 | 2020-01-31 | 苏州大学 | α -bisabolol synthetic plasmid, construction method thereof and escherichia coli engineering strain |
| CN111206035A (en) * | 2020-02-17 | 2020-05-29 | 河南科技学院 | Gene and method for regulating senescence process of target plant leaves and application of gene and method to cotton crops |
| CN111206035B (en) * | 2020-02-17 | 2021-12-28 | 河南科技学院 | Gene and method for regulating senescence process of target plant leaves and application of gene and method to cotton crops |
| CN113862293A (en) * | 2020-06-30 | 2021-12-31 | 中国科学院广州生物医药与健康研究院 | Biosynthesis method of alpha-lipoic acid, engineering strain and preparation method thereof |
| CN113862293B (en) * | 2020-06-30 | 2023-06-09 | 中国科学院广州生物医药与健康研究院 | Biosynthesis method of alpha-lipoic acid, engineering strain and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450762B (en) | 2018-03-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Reece et al. | The C-terminal domain of the Escherichia coli DNA gyrase A subunit is a DNA-binding protein | |
| KR20150058478A (en) | Glucosyltransferase enzymes for production of glucan polymers | |
| CN104450762A (en) | Biosynthesis method of alpha-lipoic acid, engineered strain and preparation method thereof | |
| CN102504022A (en) | Proinsulin containing protecting lysine and preparation method for insulin by utilizing proinsulin | |
| JP2012531198A (en) | Bacterial expression of artificial genes for production of CRM197 and its derivatives | |
| CN113121705B (en) | Fusion protein for preparing short peptide mixture, target polypeptide, preparation method and application of short peptide mixture | |
| CN106520715B (en) | A kind of short-chain dehydrogenase and its gene, recombinant expression carrier, genetic engineering bacterium and its application in the synthesis of astaxanthin chiral intermediate | |
| JP7387194B2 (en) | Biosynthesis of vanillin from isoeugenol | |
| Karwaski et al. | High-level expression of recombinant Neisseria CMP-sialic acid synthetase in Escherichia coli | |
| Mohorčič et al. | Expression of soluble versatile peroxidase of Bjerkandera adusta in Escherichia coli | |
| CN108998462B (en) | Escherichia coli expression system of manganese ion-containing recombinant protein and application method thereof | |
| Herbaud et al. | Escherichia coli is able to produce heterologous tetraheme cytochrome c3 when the ccm genes are co-expressed | |
| Sunitha et al. | Refolding and purification of Zymomonas mobilis levansucrase produced as inclusion bodies in fed-batch culture of recombinant Escherichia coli | |
| CN113736762B (en) | alpha-L-rhamnosidase mutant and application thereof in preparation of pullulan | |
| CN113005132B (en) | D-psicose-3-epimerase gene and application method thereof | |
| Ishibashi et al. | Facilitated folding and subunit assembly in Escherichia coli and in vitro of nucleoside diphosphate kinase from extremely halophilic archaeon conferred by amino-terminal extension containing hexa-His-tag | |
| CN113980880A (en) | Genetically engineered bacterium, application thereof and method for producing psicose by taking glucose as raw material | |
| CN108251406B (en) | L-rhamnose-1-phosphate aldolase and application thereof in catalytic synthesis of rare sugar D-psicose | |
| KR101250994B1 (en) | Method for producing alpha-lipoic acid using lipoic acid synthesis associated enzymes | |
| JP3004788B2 (en) | Arginine deiminase expression vector, transformed microorganism and method for producing arginine deiminase | |
| GB2515367A (en) | Protein | |
| CN100371439C (en) | Preparation method of recombinant can diad urate oxidase | |
| KR102513450B1 (en) | Novel ectoine synthase and uses thereof | |
| CN114277069B (en) | Method for preparing L-valine and biological material used by same | |
| CN112941058B (en) | Recombinant clostridium histolyticum type II collagenase as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |