CN104450759A - Method for constructing mitochondrial potassium channel Kv1.3 gene knock-out mice model associated with myocardial protection - Google Patents

Abstract

The invention discloses a method for constructing a mitochondrial potassium channel Kv1.3 gene knock-out mice model associated with myocardial protection. The method comprises the following steps: (1) preparing homologous recombination vectors; (2) targeting and screening ES cells; (3) carrying out PCR identification on recombinant stem cells; (4) preparing a chimeric mice: after a homologous recombinant clone is obtained by virtue of the PCR identification, injecting correct homologous recombinant ES cells through a blastocoels to obtain chimera progeny; and (5) breeding F1-generation hybrid mice Kv1.3<+/->. In addition, the invention also discloses PCR primer pairs for constructing the mitochondrial potassium channel Kv1.3 gene knock-out mice model associated with myocardial protection.

Description

Build the method for the plastosome potassium channel Kv1.3 gene knock-out mice model relevant to myocardial preservation

Technical field

The invention belongs to technology of preparing and the cell construction field of biology and medical experiment model.Relate to a kind of method building the plastosome potassium channel Kv1.3 gene knock-out mice model relevant to myocardial preservation.

Background technology

Compared with other organ, the damage that ischemia/reperfusion (I/R) produces heart is more serious more rapidly.The easier appearance of free radicals of myocardial cell increases and supplies dysfunction.Namely there is obviously damage in plastosome, sees cardiac muscle, coronary artery unstriated muscle and endotheliocyte pathology, especially plastosome pathology in early days under microscope.Show as fluoride-free flux (vasospasm of organ level) and heart mistake merit.Make a general survey of known result of study, plastosome for dysfunction, calcium potassium abnormal cause apoptosis to start and positive regeeration even structure deteriorate be key link.Current potassium channel and Cardioprotective relation start to become study hotspot.Domestic and international research finds K _aTPpotassium channel plays a role in Ischemic reperfusion, is affirmative with the relation of myocardial preservation.Also find in the research in our early stage, opioid receptor agonist pre-treatment can produce obvious myocardium protecting action, and these effect and plastosome K _aTPpassage relevant (Liu Zhongmin, 2008), provides experimental basis for inquiring into potassium channel medicine further for myocardial preservation.Along with research expansion, we find, myocardial damage and plastosome Kv1.3 potassium channel in close relations, be worth further investigation, wherein to explore emphatically the problem of following main aspect.

In mammalian cell plastosome, known existence two kinds relates to the potassium channel regulating stream in potassium, K _aTPand Bkca.Have been found that to there is Kv1.3 potassium channel in lymphocyte mitochondrial.It is most important to research myocardial preservation whether cardiac muscle mitochondrial exists Kv1.3 potassium channel.The present invention relates to this field.

During myocardial damage, the importance of plastosome Kv1.3 potassium channel and mechanism need be studied emphatically:

First, with two the plastosome potassium channel (K that there will be a known provide protection _aTP, Bkca) compare, how secondly the status of plastosome Kv1.3 in myocardial damage, if relation is very important, does the impact of this impact on myocardial cell exceed the impact on endothelium and coronary artery unstriated muscle? finally, relate to the research of machine-processed aspect, the downstream signal passage of this passage how, those are had to understand further with the interaction of neighboring molecule? plastosome Kv1.3 and myocardial damage relations problems, these problems are only had to have gained some understanding, could the relation of clear and definite plastosome Kv1.3 and myocardial damage.

Whether Kv1.3 passage has expression in cardiac muscle, whether they relevant with MI/RI? or and other passage synergy it be unclear that, and lays the foundation for the control of MI/RI and the exploitation of medicine to the further research of these passages.For this reason, we construct Kv1.3 knock out mice.In experimenting, we find out that, and wild-type mice atrial tissue expressing K ir3.4 is apparently higher than its hetero-organization, and Kv1.3 not only has expression at atrial tissue, expresses more obvious in myocardium of ventricle.Heart three kinds of parenchymas are all shown in immune labeled presenting.After Kv1.3 gene knockout, mouse performance energy metabolism noticeable change and the performance such as anti-obesity, build sudden change.And cause peripheral cells to insulin sensitivity enhancing effect (show as the glucose transporter increase of fat, Develop-ment of Skeletal Muscle Cells film, Sugar intake increases).This passage is generally expressed organizing of Regular Insulin of dependence.Cardiac muscle is the tissue relying on Regular Insulin, and the detailed location and effect in this passage myocardial cell lacks research.

Point out the gene expression research of spontaneous hypertension mouse blood vessel, Kv1.3 is too high closely relevant with antiotasis.Whether vascular smooth muscle Kv1.3 passage produces spasm in heart I/R causes fluoride-free flux to be worth research.Also find recently, cerebral tissue endotheliocyte is expressing K v1,2 potassium channels also, and Kv1.3 participates in the effect of endothelial cell membrane potential balance, and its blocker prevents significant to I/R.Extensive type and otherness is there is in Kv1.3 gene in the expression prompting of various tissue.In heart tissue, sarcoplast and the equal expressing K v1.3 passage of inoblast, and relevant with the coupling between sarcoplast and between inoblast and myocardial cell, relate to the programming that calcium relies on gene simultaneously.And bibliographical information before this, this gene is not expressed on the fibrocyte surface of some tissues.These differences have any physiological significance not know.

Thus, inspire that examination heart three kinds of parenchymas (cardiac muscle, vascular smooth muscle, endothelium) is interior, certain relation that the change of Intramitochondrial Kv1.3 and myocardial preservation exist.Still lack the research of this respect at present.Therefore the expression rule studied further in the physiological and pathological situation of different this gene of cell of heart is necessary.

Plastosome KV1.3 passage is intervened in the expression of the different cell of cardiac muscle and effect available channel drug regimen:

The potassium channel K that current discovery plastosome exists _aTPthe effect of protection myocardial damage is had with BKca." Mitochondrial permeability transition pore " by active oxygen (ROS) activate and a large amount of penetrating startup apoptosis even swelling break.K _aTPchannel opener be conducive to alleviating this process, protection cardiac muscle.In addition, on bibliographical information mitochondrial inner membrane, calcium dependence potassium channel Bkca also has relation with the protection of damage.The blocking-up (ciclosporin etc.) of " Mitochondrial permeability transition pore " also may have effect to myocardial preservation." Mitochondrial permeability transition pore " is directly involved in mitochondrial film integrality and maintains, directly relevant with apoptosis with the necrosis of cell.Study lymphocytic growth course to find, except there is K in plastosome _aTPand Bkca, also have Kv1.3 tri-kinds of potassium channels.They with mitochondrial potassium concn, plastosome volume, interior membrane potential, apoptosis be relevant.When T lymphocyte development and transformation memory cell, people observe Kv1.3 potassium channel and are distributed in Lymphocyte Membrane, can regulate lymphocyte activator, propagation, differentiation and cytokine secretion, are immunoregulatory target spots.The anti-apoptotic of Kv1.3 molecular channel to cell on T lymphocyte mitochondrial inner membrane plays an important role.The mistake of K passage is quick also has substantial connection with hypoxia response and conductivity function.We also find to there is Kv1.3 channel protein in cardiac muscle by preliminary experiment in early stage.This albumen whether directly and myocardial damage mechanism exist to contact and not yet know.Owing to having K in plastosome _aTPwith Kv1.3, Bkca tri-kinds of potassium channels, common effect is all that release potassium is in plastosome.The peptide fragment susceptor of three is different, and the effect of three is different, and downstream signaling pathway is different.And the mysterious relation of three in myocardial mitochondria needs to be disclosed.Therefore holistic approach scheme is proposed, in the different aspects such as the models such as clpp gene deratization and live body, organ, cell, signal path with three kinds of potassium channels separately specific blockage agent and opener through various combination intervention, statistical study separation factor, thus understand the effect of different potassium channels at antibody Monoclonal.

Further investigation plastosome Kv1.3 passage participates in the signal path of apoptosis, energy metabolism:

At present, potassium channel and the research of myocardial preservation relation have developed into the aspect can understanding the contact of passages downstream molecular signal and damage prevention design thereof.In plastosome, three kinds of potassium channel downstream molecules contacts start to cause concern.This research from other cell finds the thinking that this passages downstream signal path of myocardial cell can be inspired to study, and studies the effect of this passage when myocardial preservation especially provide effective Research Thinking and means to the research of plastosome potassium channel to next step.(1) understand at research this molecular moiety path lymphocytic.(2) this molecular moiety path neuronic is understood.(3) this study group has carried out heart expression library (imported from America library)-yeast two-hybrid screening (potassium channel downstream) preliminary experiment early stage, has tested and can instruct next step exploratory development myocardial cell Kv1.3 passages downstream signal path specific direction.These are theoretical is all that research signal path provides feasibility with experiment.At present, this kind of research that is prepared as of single passage gene knockout model mice provides good platform.

In sum, background of invention have following some: 1. in clinical practice, MI/RI remains the high risk factor threatening advanced age, neonates with serious diseases human therapy effect, needs the prevention and controls inquiring into further MI/RI; 2. during myocardial ischemia/reperfusion injury, myocardial preservation is relevant with injury of mitochondria degree and potassium-channel, such as K _aTP, Bkca.T cell Kv1.3 potassium channel is relevant with mitochondrial potassium concn, plastosome volume, interior membrane potential, energy metabolism and apoptosis.3. early-stage Study finds that mitochondria in brain tissue Kv1.3 passage participates in ischemical reperfusion injury.We study discovery, and Kv1.3 not only has expression at atrial tissue, express more obvious in myocardium of ventricle.4. infer in heart three kinds of parenchymas, the change of Intramitochondrial Kv1.3 and myocardial preservation may exist certain relation.

According to the result and grasp enough special passage medicine in early stage that there is Kv1.3 passage in cardiac muscle; the Kv1.3 channel gene knock-out mice model built does the inside and outside two kinds of Kv1.3 passage specific blockages of cell; combine the special opening of other two kinds of Mitochondrial Channels, block various combination intervention, the effect of plastosome Kv1.3 potassium channel in myocardial preservation can be distinguished.In conjunction with mechanics electricity and biochemical immunity research, explore the contact between plastosome potassium channel and degree of injury that is myocardium and endotheliocyte.And further investigate plastosome Kv1.3 passage and participate in apoptosis, the signal path of energy metabolism and mechanism thereof.Result of study provides potassium channel pharmacological agent for clinical treatment and protects the theoretical basis of cardiac muscle, by the approach providing myocardial preservation new for clinical treatment heart failure.

Summary of the invention

One of the technical problem to be solved in the present invention is to provide a kind of method building the plastosome potassium channel Kv1.3 gene knock-out mice model relevant to myocardial preservation.

Two of the technical problem to be solved in the present invention is to provide a kind of PCR primer pair for building the plastosome potassium channel Kv1.3 gene knock-out mice model relevant to myocardial preservation.

Specifically, in a first aspect of the present invention, provide a kind of method building the plastosome potassium channel Kv1.3 gene knock-out mice model relevant to myocardial preservation, comprise the steps:

(1) homologous recombination vector is prepared:

(2) ES cell targeting and screening;

(3) the stem cell PCR that recombinates identifies;

(4) gomphosis mouse preparation: after PCR qualification obtains homologous recombination clone, obtains mosaic filial generation by the ES cell of correct homologous recombination by segmentation cavity injection;

(5) F1 generation chimeric mice Kv1.3 ^+/-breed.

As preferred technical scheme, step (1) is specially: targeting vector uses BAC carrier, and plasmid BanmHI, EcoRI, HindIII enzyme built is cut, and product electrophoresis identifies band after taking a picture.

As preferred technical scheme, step (2) is: by electroporated for targeting vector embryonic stem cell, makes itself and genome generation homologous recombination.

As preferred technical scheme, in step (3), design following PCR primer pair: P1:ATGAAACCATTCACATAGCCT AAACAG, as shown in SEQ ID NO.1; P2:CCTCCCCCGTGCCTTCCTTG AC, as shown in SEQ ID NO.2; P3:GGCAAAGCTAATGGTTACTGGCAAATGT, as shown in SEQ ID NO.3; P4:CTGAGCCCAGAAAGC GAAGGA, as shown in SEQ ID NO.4; P1 and P2 is pair of primers, P3 and P4 is pair of primers.

As preferred technical scheme, in step (3), described PCR reaction conditions is: 94 DEG C of 30s; 67 DEG C of 30s; 72 DEG C of 5min; 35 circulations.

As preferred technical scheme, in step (4), injection blastaea picks up from C57BL/6J inbred mouse, and by superovulation, natural conception, is developed to blastocyst stage in embryoid body, for injection; Be implanted into pseudopregnant mouse acceptor uterus after injection, pseudopregnant recipients is C57BL/6J (♂) and CBA(♀) first-filial generation, give birth to the chimeric male mouse that chimeric rate is greater than 50%.

As preferred technical scheme, in step (5), the ripe mouse and the wild-type C57BL/6J female mice that chimeric rate are greater than 50% carry out mating, offspring's grey mouse carries out PCR qualification through extracting coda gene group DNA, by PCR method identified gene type, by normal enzyme short-movie section pcr amplification method, PCR positive products is transformed into intestinal bacteria after connecting by carrier T, electrophoresis result judges wild-type, heterozygote or homozygote, product T4 ligase enzyme links pMD18T carrier, be transformed into intestinal bacteria screening, after boiling bacterium PCR preliminary evaluation, send order-checking qualification.

In a second aspect of the present invention, provide the PCR primer pair for building the plastosome potassium channel Kv1.3 gene knock-out mice model relevant to myocardial preservation, adopt following two pairs of primer pairs: P1 and P2 primer pair, P3 and P4 is primer pair; P1:ATGAAACCATTCACATAGCCT AAACAG, as shown in SEQ ID NO.1; P2:CCTCCCCCGTGCCTTCCTTG AC, as shown in SEQ ID NO.2; P3:GGCAAAGCTAATGGTTACTGGCAAATGT, as shown in SEQ ID NO.3; P4:CTGAGCCCAGAAAGC GAAGGA, as shown in SEQ ID NO.4.

Beneficial effect of the present invention is; this model can be knocked out and wild-type mice Model of Myocardial Ischemia-Reperfusion Injury method by foundation and applying gene; respectively in effect in myocardial preservation of integral level, cell levels, subcellsular level and ion single-channel level further investigated Kv1.3 and mechanism, and and K _aTP, Bkca potassium channel Myocardial protective effects compares, attempt to disclose Kv1.3, K in parenchyma Mitochondria _aTP, science between Bkca passage and MI/RI contacts.Knocking out of mouse Kv1.3 potassium channel molecule is that preparation acquires a certain degree of difficulty; it detects especially difficulty; the invention solves a difficult problem for prior art, provide the method for a kind of structure plastosome potassium channel Kv1.3 gene knock-out mice model relevant to myocardial preservation and relate to PCR detection primer and particular assay method.

Building of tradition gene targeted mice is that many methods such as use miniplasmids and DNA hybridization etc. build and qualification.This experiment uses BAC carrier and PCR to add order-checking qualification and obtains effect same.Knock out the target gene of ES stem cell with methods of homologous recombination, breed engineering and Screening and Identification through mosaic, hybridization reproduction, the deratization of preliminary acquisition Kv1.3 clpp gene.Improve one's methods produce head build mouse tail tissue DNA qualification confirm the method also can obtain knock-out mice groups of individuals.Knock-out mice personal feature meets the personal feature of foreign literature report.Want further biochemical identification although still need and breed the C57 inbred lines that backcrosses further could obtain and stablize population, the method that acquisition head builds fast tentatively obtains confirmation through gene test, and method is worth to be applied.This mouse breed successfully, for establishing the sick research model of stable potassium-channel and advanced research method, the pathophysiological mechanism etc. of myocardial preservation is laid the foundation.Murine genes Kv1.3 be Kcna3 again, is voltage gated potassium channels.Ildik Szab in 2005 find the evo-devo of the Kv1.3 passage in lymphocytic plastosome and immunocyte and function closely related, be the main potassium channel of T lymphocyte cell film.Electronic Speculum and immunohistochemical study display are positioned on mitochondrial membrane.Research finds that the molecule high expression level of Kv1.3 gene is on autoimmune disease man memory T and M cell, and prompting and Immunological diseases also exist much relations.Report, this potassium channel even also has relation with cancer.Also studies have found that recently, in mitochondrial potassium channel, Kv1.3 molecule is important composition in apoptotic pathways.Mitochondrial depolarization release cells apoptosis labelled protein CYTC is relevant with Kv1.3 potassium channel.Separately have documents, Kv1.3 is relevant with energy metabolism and weight regulation, can adjusting energy metabolism with this passage of drugs block ^[10].Myocardial damage and plastosome in early days impaired and energy metabolism have indivisible contact.Carry out the research of this model, will useful advanced model be provided to myocardial preservation research.This molecule knock out rear animal mainly substantially performance mainly contain body weight reduce clearly, generate super little body weight mouse ^[11].This molecularity of taste buds cell film may be one of the main reasons.This molecule also shows anion channel metabolic and expresses enhancing after rejecting ^[12].Also regulating effect is there is in it to this link relating to energy metabolism of the insulin sensitivity of cell ^[13, ^14].In a word, the foundation of this model, for study immunity, natural death of cerebral cells, myocardial preservation isopachic plastochondria potassium channel relation even study metabolic syndrome and provide a kind of new method.

Below will be described in detail the present invention by specific embodiment and accompanying drawing.It is important to note that these descriptions are only exemplary descriptions, do not form limitation of the scope of the invention.According to the discussion of this specification sheets, many changes of the present invention, to change concerning one of ordinary skill in the art be all obviously.

Accompanying drawing explanation

Fig. 1 is the mouse Kcna3 gene knockout schematic diagram of the embodiment of the present invention 1.

Fig. 2 is the mouse Kcna3 gene targeting carrier schematic diagram of the embodiment of the present invention 1.

Fig. 3 is the mouse Kcna3 gene targeting Plasmid restriction restriction endonuclease qualification electrophoretogram of the embodiment of the present invention 1.

Fig. 4 A and Fig. 4 B is that after the mouse 129 embryonic stem cell gene targeting drug screening of the embodiment of the present invention 1, PCR identifies agarose electrophoresis result schematic diagram, and wherein, Fig. 4 A is shown in that 4.8kbp is positive band, and Fig. 4 B is shown in that 4.2kbp is positive band.

Fig. 5 is microscope schematic diagram in the embodiment of the present invention 2;

Fig. 6 is Kv1.3 potassium channel immunostaining schematic diagram (200 ×) in the embodiment of the present invention 2, C57 new life (2d) mouse primary myocardial cells culture creep plate being shown in four kinds of chief functional cells (myocardial cell, Coronary Arterial Endothelial Cells, coronary artery smooth muscle cells, conduction (macronucleus) cell).

Embodiment

Carry out example below by way of specific embodiment, wherein agents useful for same is all bought by market channel, if any not to the greatest extent part, and can with reference to the laboratory manual of corresponding PCR and gene sequencing.

Embodiment 1

The preparation of 1.Kv1.3 knock out mice:

1.1. homologous recombination vector is prepared

Design and the target practice principle conceived to Kcna3 in genome.Kcna3 targeting vector uses BAC(Geneserve Co, U.K.) carrier (BAC:bMQ42P18).Reference literature (Otani H.The role of nitric oxide in myocardial repairand remodeling.Antioxid Redox Signal, 2009,11 (8): 1913-28; With Halestrap AP, Clarke SJ, Khaliulin I.The role of mitochondria in protection of the heart by preconditioning.BiochimBiophys Acta., 2007,1767 (8): 1007 – 1031).Plasmid BanmHI, EcoRI, HindIII enzyme built is cut, and product electrophoresis identifies band after taking a picture.

1.2.ES cell targeting and screening

Gene targeting: 100 μ g Kcna3-KO-vector plasmid DNA NotI(enzyme dosage: 300U) linearizing.The targeting vector linearizing enzyme system of cutting is 250 μ L, 37 DEG C of digestion are spent the night, and after equal-volume phenol chloroform, chloroform process, dehydrated alcohol precipitates, and the aseptic PBS of 100 μ L is resuspended for subsequent use.35 μ g linearizing Kcna3-KO-voctor DNA on Bio-Rad Gene Pulser electroporation to 129/S6/SvEv mouse embryonic stem cell SCR012 electroporation.Electroporation conditions: voltage 256v, electric capacity 500 μ F, conduction time 9.6ms.Choose clone with after 300 μ g/mL G418 and 2 μM ol/L GanC two medicine screening 8d after practicing shooting, and carry out the DNA qualification across 5 ' or 3 ' arm and Insert Fragment, use long-chain PCR enzyme (Fermentas Co, Lithuania).

1.3. stem cell of recombinating is identified:

Design PCR primer: P1 (5 ' arm): ATGAAACCATTCACATAGCCT AAACAG(is as shown in SEQ ID NO.1); P2 (Neo F): CCTCCCCCGTGCCTTCCTTG AC(is as shown in SEQ ID NO.2); P3 (3 ' arm): GGCAAAGCTAATGGTTACTGGCAAATGT(is as shown in SEQ ID NO.3); P4 (Neo-R): CTGAGCCCAGAAAGC GAAGGA(as shown in SEQ ID NO.4); 5 ' arm P1 and P2 detects.PCR condition: 94 DEG C of 30s; 67 DEG C of 30s; 72 DEG C of 5min; 35 circulations.PCR instrument uses Eppendorf AG22331(Hamburg, Germany).Reagent: TaKaRa La Taq EcoRI is from precious biotechnology (Dalian) company limited.Marker:MBIGeneRuler; 1kb DNA Ladder (brilliant U.S. biological company limited, Shanghai).Electrophoresis is shown in 4.8kbp positive band.3 ' arm P3 and P4 detects.PCR condition: 94 DEG C 30 seconds; 63 DEG C 30 seconds; 72 DEG C 5 points; 35 circulations.Electrophoresis is shown in 4.2kbp positive band.

1.4. laboratory animal:

SPF level C57BL/6J (♂) and CBA(♀) mouse derives from Laboratory Animal Resource center, Shanghai [SyXK (Shanghai) 2008-0035].Aseptic operation carries out [SyXK (Shanghai) 2009-0069] at Shanghai Univ. of Traditional Chinese Medicine's Experimental Animal Center barrier animal Experimental Establishment, and the 3R principle that empirically animal uses gives human care.

1.5. gomphosis mouse preparation:

Reference is with Publication about Document (Facundo HT, Fornazari M, Kowaltowski AJ.Tissue protection mediated bymitochondrial K+channels.Biochim Biophys Acta., 2006,1762 (2): 202-12..) method recorded.The positive colony of drug screening picking, after PCR qualification obtains homologous recombination clone, obtains mosaic filial generation by the ES cell of correct homologous recombination by segmentation cavity injection.Injection blastaea picks up from C57BL/6J inbred mouse, and by superovulation, natural conception, is developed to blastocyst stage in embryoid body, for injection.Be implanted into pseudopregnant mouse acceptor uterus after injection, pseudopregnant recipients is C57BL/6J (♂) and CBA(♀) first-filial generation.Give birth to the chimeric male mouse that chimeric rate is greater than 50%.

1.6.F1 for chimeric mice Kv1.3 ^+/-breed:

The ripe mouse and the wild-type C57BL/6J female mice that chimeric rate are greater than 50% carry out mating, and offspring's grey mouse carries out PCR qualification through extracting coda gene group DNA.By PCR method identified gene type.By normal enzyme short-movie section pcr amplification method.PCR positive products is transformed into intestinal bacteria after connecting by carrier T.Electrophoresis result judges wild-type, heterozygote or homozygote.Product T4 ligase enzyme links pMD18T carrier, is transformed into intestinal bacteria screening.After boiling bacterium PCR preliminary evaluation, send order-checking qualification.

2. result

2.1 plasmid BanmHI, EcoRI, HindIII restriction enzyme reaction rear electrophoresis qualification collection of illustrative plates built and gene targeting schema are shown in Fig. 1, Fig. 2, Fig. 3.As shown in Figure 1, be mouse Kcna3 gene wild-type, target practice mutated genes seat, target practice both arms position view respectively.As shown in Figure 2, in carrier, 5 ' end 4410bp, 3 ' the end 3744bp and middle Pgk of insertion sequence mouse Kcna3 gene starts NEO expression frame (1926bp).As shown in Figure 3, M representation DNA size reference standard; (-) represents negative control; 1 swimming lane represents the reaction of BamHI restriction endonuclease, 10388bp and 5654bp; 2 swimming lanes represent the reaction of EcoRI restriction endonuclease, 5653bp, 3950bp, 3255bp, 1590bp, 1480bp, 48bp and 16bp; 3 swimming lanes represent the reaction of HindIII restriction endonuclease, 8952bp, 6341bp and 699bp.It is correct that the prompting of Fig. 1-Fig. 3 result detects fragment.After gene targeting, do ES clone identification.The NEO expression cassette that pGK promotor instructs is driven in and is substituted into Kv1.3 the 3rd exon position.Upstream arm 3.2k, downstream arm is 5.0k, and downstream arm flank connects the TK expression cassette that pGK promotor instructs.PCR identifies drug resistance ES cell clone 96, and wherein both arms homologous recombination occurs 9 ES clones.PCR primer confirms further through determined dna sequence.9 ES clone PCR electrophorograms as shown in Figure 4 A and 4 B shown in FIG..As shown in Figure 4 A, 5 ' end positive PCR bands 4.8kbp sees 1,2,4,6,7,8,9,10,11 ducts; As shown in Figure 4 B, 3 ' end positive PCR bands 4.2kbp sees 1,6,12,13,16,20,21 ducts; Often pair has a primer in Insert Fragment.

2.2 surpass and arranged 80 C57BL/6J mouse, injected 151 pieces of blastaeas altogether, transplanted the female mouse of 9 false pregnancys, be born 17 mouse, wherein 4 chimeric male mouse being chimeric rate and being greater than 50%.Chimeric male mouse obtains 40 squirrels after C57BL/6J mouse mating breeding, through genotype identification analysis, has 8 for hybrid mice, is 5 male 3 female (F1 generations).

2.3 gene knockout F1 generation chimeric mice.Genotype identification is done to the F1 generation offspring bred.PCR is pointed out to be the specific product that genomic dna sequence knocks out original design position by PCR method to the result of carrier construction sequencer address.Eliminate non-specific amplification phenomenon, prompting reliable results.Chimeric mice now obtains homozygotic individual through breeding.

2.4, backcross more than 7 generations, genotype is stabilized in inbred lines fauna.

The discovery of embodiment 2 myocardial mitochondria inner membrance Kv1.3 potassium channel

Take heart after the sterilization of 1.C572D mouse, shred;

2. trysinization cardiac muscle;

3. cultivate slide glass room of going down to posterity after three days, 48H changes liquid, within 72 hours, changes liquid;

4. go to train liquid, DPBS washes twice, and cold 95% fixes 5 minutes, send company to process;

5. probably process: 4% paraformaldehyde fixes 15 points, and the PBS of film to be worn washes twice, preserves under being placed on 4 DEG C of temperature.

6. dye fluorescence:

(1) after closing 15 points,

(2) primary antibodie: contaminate 15 minutes, wash twice,

(3) two resist: contaminate 15 minutes, wash twice,

7. add after PI contaminates ten minutes, to be measured under being placed on 4 DEG C of temperature;

8. take image under microscope, see Fig. 5:

One, see that culturing cell all has dyeing, mainly concentrate in myocardial mitochondria; Cardiac conduction intracellular mitochondrial is few, and core is large, the weak positive but cytolemma Kv1.3 dyes.

Two, in cardiac muscle four kinds of cells (myocardial cell, Coronary Arterial Endothelial Cells, coronary artery smooth muscle cells, conduction (macronucleus) cell), Kv1.3 is distributed with difference: cardiac muscle is many, and endothelium is also a lot, unstriated muscle is relatively less, and transfer cell (macronucleus) seldom (see figure 6).

Claims (8)

1. build a method for the plastosome potassium channel Kv1.3 gene knock-out mice model relevant to myocardial preservation, it is characterized in that, comprise the steps: that (1) prepares homologous recombination vector: (2) ES cell targeting and screening; (3) the stem cell PCR that recombinates identifies; (4) gomphosis mouse preparation: after PCR qualification obtains homologous recombination clone, obtains mosaic filial generation by the ES cell of correct homologous recombination by segmentation cavity injection; (5) F1 generation chimeric mice Kv1.3 ^+/-breed.

2. the method for claim 1, is characterized in that, step (1) is specially: targeting vector uses BAC carrier, and plasmid BanmHI, EcoRI, HindIII enzyme built is cut, and product electrophoresis identifies band after taking a picture.

3. the method for claim 1, is characterized in that, step (2) is: by electroporated for targeting vector embryonic stem cell, makes itself and genome generation homologous recombination.

4. the method for claim 1, is characterized in that, in step (3), designs following PCR primer pair: P1:ATGAAACCATTCACATAGCCT AAACAG, as shown in SEQ ID NO.1; P2:CCTCCCCCGTGCCTTCCTTG AC, as shown in SEQ ID NO.2; P3:GGCAAAGCTAATGGTTACTGGCAAATGT, as shown in SEQ ID NO.3; P4:CTGAGCCCAGAAAGC GAAGGA, as shown in SEQ ID NO.4; P1 and P2 is pair of primers, P3 and P4 is pair of primers.

5. the method as described in claim 1 or 4, is characterized in that, in step (3), described PCR reaction conditions is: 94 DEG C of 30s; 67 DEG C of 30s; 72 DEG C of 5min; 35 circulations.

6. the method for claim 1, is characterized in that, in step (4), injection blastaea picks up from C57BL/6J inbred mouse, and by superovulation, natural conception, is developed to blastocyst stage in embryoid body, for injection; Be implanted into pseudopregnant mouse acceptor uterus after injection, pseudopregnant recipients is C57BL/6J (♂) and CBA(♀) first-filial generation, give birth to the chimeric male mouse that chimeric rate is greater than 50%.

7. the method for claim 1, it is characterized in that, in step (5), the ripe mouse and the wild-type C57BL/6J female mice that chimeric rate are greater than 50% carry out mating, offspring's grey mouse carries out PCR qualification through extracting coda gene group DNA, by PCR method identified gene type, by normal enzyme short-movie section pcr amplification method, PCR positive products is transformed into intestinal bacteria after connecting by carrier T, electrophoresis result judges wild-type, heterozygote or homozygote, product T4 ligase enzyme links pMD18T carrier, be transformed into intestinal bacteria screening, after boiling bacterium PCR preliminary evaluation, send order-checking qualification.

8. for building the PCR primer pair of the plastosome potassium channel Kv1.3 gene knock-out mice model relevant to myocardial preservation, it is characterized in that: adopt following two pairs of primer pairs: P1 and P2 primer pair, P3 and P4 is primer pair; P1:ATGAAACCATTCACATAGCCT AAACAG, as shown in SEQ ID NO.1; P2:CCTCCCCCGTGCCTTCCTTG AC, as shown in SEQ ID NO.2; P3:GGCAAAGCTAATGGTTACTGGCAAATGT, as shown in SEQ ID NO.3; P4:CTGAGCCCAGAAAGC GAAGGA, as shown in SEQ ID NO.4.