CN104450696A - Two-way starting plant expression vector system of double recombination sites - Google Patents

Abstract

The invention aims at providing a two-way starting plant expression vector system of double recombination sites. The two-way starting plant expression vector system is composed of a two-way expressing plant expression vector pRGFL of double recombination sites and two cloning vectors p-FRT and p-loxp with specific recombination sites respectively. The two-way expressing plant expression vector pRGFL of the double recombination sites provided by the invention is a transformed plant expression vector containing specific DNA molecules. The two cloning vectors with the specific recombination sites respectively provided by the invention are respectively inserted into the recombination vector containing the specific DNA molecules at multiple cloning sites of a starting vector. The cloning vector p-FRT and the cloning vector p-loxp provided by the invention form a vector with a T tail end or a flat tail end after being digested by XcmI enzyme or EcorV enzyme, and can be directly connected with a PCR product of a target gene to achieve the cloning target. The target genes on the cloning vector p-FRT and the cloning vector p-loxp can respectively replace fluorescence protein reporter genes on the two-way expressing plant expression vector of the double recombination sites through specific site combination, and thus the target genes are transferred to the plant expression vector; only enzyme medium needs to be recombined in the process; and other operations are not required, so that the two-way starting plant expression vector system is simple and feasible.

Description

The two-way startup plant expression vector system of a kind of pair of recombination site

Technical field

The present invention relates to two two-way expression plant expression vector of recombination site and constructing system thereof.

Background technology

In plant transgene research, two genes work in coordination with the Perfected process that conversion is interaction between research polygene.Or can utilize the method for bidirectional promoter in same carrier, carry two different genes by tandem gene on carrier at present, then conversion of plant reach the effect that two genes work in coordination with conversion.In the vector construction of aforesaid method, mostly be and adopt that enzyme is cut, goal gene is connected on carrier by method one by one that connect, carrier sequence limits only has a few restriction enzyme site can be used for building, if but goal gene is inner just also with the restriction enzyme site needed for structure, then can not cut with enzyme the method connected to build, this brings restriction with regard to giving the application of aforesaid method.

Site-specific recombinase is a kind of DNA recombination form be first found in prokaryotic organism, it exchanges restructuring by recombinase-mediated at the specific DNA that completes between sequence in pairs, and this restructuring is only under specific recombinase effect, identify specific sequence in pairs and complete restructuring, so the sequence of recombinase and specific recognition thereof is called as recombinase system.Cre/loxP is the recombinase system obtained from coliphage P1, in this system, and the restructuring between the homology loxP sequence of Cre recombinase catalysis two 34bp.FLP/FRT is then the recombinase system coming from yeast saccharomyces cerevisiae, and the FRT sequence of 34bp is the specific action site of recombinase FLP.

Summary of the invention

The object of this invention is to provide the two-way expression plant expression vector system of a kind of pair of recombination site, be made up of with cloning vector p-FRT, p-loxp of special recombination site respectively two recombination site two-way expression plant expression vector pRGFL and two.

Provided by the present invention couple of recombination site two-way expression plant expression vector pRGFL is with the recombinant expression vector containing, for example lower DNA molecular of pBI121 basis transformation:

From 5 ' end successively containing NoS terminator, SalI enzyme recognition sequence, inverted-F RT sequence, red fluorescent protein gene, inverted-F RT sequence, SpeI enzyme recognition sequence, bidirectional promoter, BamHI enzyme recognition sequence, oppositely loxP sequence, green fluorescence protein gene, oppositely loxP sequence, KpnI enzyme recognition sequence, NoS terminator.

The nucleotides sequence of described DNA molecular is classified as sequence 1 in sequence table from 5 ' end 4356-7983 position.

Two provided by the present invention is the recombinant vectors inserting specific DNA molecular in the multiple clone site of the carrier PMD18T-Vector that sets out respectively with the cloning vector of special recombination site respectively.

Cloning vector p-FRT inserts following DNA molecular in multiple clone site: from 5 ' end successively containing forward FRT sequence, XcmI enzyme recognition sequence, SpeI enzyme recognition sequence, EcorV enzyme recognition sequence, forward FRT sequence.

Cloning vector p-loxp inserts following DNA molecular in multiple clone site: from 5 ' end successively containing reverse loxP sequence, XcmI enzyme recognition sequence, SpeI enzyme recognition sequence, EcorV enzyme recognition sequence, oppositely loxP sequence.

The XcmI enzyme recognition sequence comprised in cloning vector p-FRT and p-loxp is as follows: ccacccttattctgg

Above-described DNA molecular also belongs to protection scope of the present invention.

Cloning vector p-FRT of the present invention, cloning vector p-loxp form the carrier with T end or flat end after XcmI enzyme or EcorV enzymic digestion, directly can be connected with the PCR primer of goal gene the object reaching clone.Goal gene on cloning vector p-FRT, cloning vector p-loxp is under the mediation of the recombinase of correspondence, respectively by specific site restructuring, the fluorescent protein report gene on two-way for two recombination site expression plant expression vector can be replaced, reach object goal gene being transferred to plant expression vector, only recombinase-mediated is needed in process, do not need that other enzyme is cut, attended operation, simple and easy to do and do not limit by restriction endonuclease recognition sequence.

Accompanying drawing explanation

Fig. 1 is Gm resistance gene sequences pcr amplification figure.M is GeneRuler 100 bp Plus DNA Ladder; 1 is Gm resistance gene sequences pcr amplification product.

Fig. 2 is positive colony bacterium colony PCR proof diagram.M is GeneRuler 100 bp Plus DNA Ladder; 1,2,3 is positive colony PCR checking amplified production.

Fig. 3 be Xcm I enzyme cut publish in instalments body connect design sketch.Left: ammonia benzyl resistant panel; Right: ammonia benzyl and the Double flat board of gentamicin.

Fig. 4 is Gm resistance gene sequences pcr amplification figure.M is GeneRuler 100 bp Plus DNA Ladder; 1 is Gm resistance gene sequences pcr amplification product.

Fig. 5 is positive colony bacterium colony PCR proof diagram.M is GeneRuler 100 bp Plus DNA Ladder; 1,2,3 is positive colony PCR checking amplified production.

Fig. 6 be EcoR V enzyme cut publish in instalments body connect design sketch.Left: ammonia benzyl resistant panel; Right: ammonia benzyl and the Double flat board of gentamicin.

Fig. 7 is GusA gene order pcr amplification figure.M is GeneRuler 100 bp Plus DNA Ladder; 1 is GusA gene order pcr amplification product.

Fig. 8 is positive colony bacterium colony PCR proof diagram.M is GeneRuler 100 bp Plus DNA Ladder; 1,2,3 is positive colony PCR checking amplified production.

Fig. 9 is bacterium colony PCR proof diagram.M is GeneRuler 100 bp Plus DNA Ladder; 1 for carry out PCR the result with GusA1, GusA2 primer; 2 for carry out PCR the result with GFP2, GFP2 primer; 3 for carry out PCR the result with RED1, RED2 primer; A is for reassembling into merit plasmid template PCR the result; B is control plasmid template PCR the result.

Figure 10 is Agrobacterium transient expression result figure.A is that Agrobacterium infects blade; B is contrast.

Figure 11 is GusA gene order pcr amplification figure.M is GeneRuler 100 bp Plus DNA Ladder; 1 is GusA gene order pcr amplification product.

Figure 12 is bacterium colony PCR proof diagram.M is GeneRuler 100 bp Plus DNA Ladder; 1,2,3 is positive colony PCR checking amplified production.

Figure 13 is bacterium colony PCR proof diagram.M is GeneRuler 100 bp Plus DNA Ladder; 1 for carry out PCR the result with GusA1, GusA2 primer; 2 for carry out PCR the result with GFP2, GFP2 primer; 3 for carry out PCR the result with RED1, RED2 primer; A is for reassembling into merit plasmid template PCR the result; B is control plasmid template PCR the result

Figure 14 is Agrobacterium transient expression result figure.A is that Agrobacterium infects blade; B is contrast.

Embodiment

Be further described below in conjunction with the two-way expression plant expression vector system of embodiment to a kind of pair of recombination site of the present invention.

embodiment 1, application cloning vector p-FRT is by XcmI enzymic digestion and clone goal gene

By cloning vector p-FRT plasmid through XcmI enzymic digestion, condition is 37 DEG C, and product reclaims by 12h.

With the pPH1JI plasmid with gentamicin resistance gene for template, with G1, G2 for primer, use taqenzyme pcr amplification obtains the gentamicin resistance gene sequence with 3 ' A end:

G1: aattgacataagcctgttcggt，

G2: tgacaatttaccgaacaactcc。

Pcr amplification condition is: 95 DEG C of denaturation 5mins; 95 DEG C of 30s; 58 DEG C of 30s; 72 DEG C of 1min; 28 circulations; 72 DEG C of 10mins; 4 DEG C of preservations, as shown in Figure 1, in Fig. 1,1 is amplified production to PCR primer electrophoresis result, is about 800bp fragment.

PCR primer is connected with the p-FRT digested after reclaiming, and linked system is prepared according to the mole number of carrier and exogenous sequences 1:3.Connection product conversion E.coli is coated on the dull and stereotyped enterprising row filter of LA containing ammonia benzyl and gentamicin, and coating simultaneously only adds up a joint efficiency containing the flat board of ammonia benzyl.

On ammonia benzyl and gentamicin twin antibiotic flat board, picking colony adopts G1, G2 primer to carry out PCR checking, and as shown in Figure 2, in Fig. 2,1,2,3 is colony PCR amplification product to electrophoresis result, is about 800 fragments, conforms to expection.

Be successfully be connected exogenous sequences to obtain gentamicin resistance bacterium colony containing ammonia benzyl and colony number on the flat board of gentamicin, only containing the colony number of the flat board of ammonia benzyl then for containing carrier from the colony number connected, statistics joint efficiency,

Joint efficiency=containing the flat-plate bacterial colony number/only containing the colony number of the flat board of ammonia benzyl of ammonia benzyl and gentamicin

Flat-plate bacterial colony growing state, as Fig. 3, calculates joint efficiency=51/388=13.14%

embodiment 2, application cloning vector p-loxp is by EcorV enzymic digestion and clone goal gene

By cloning vector p-loxp plasmid through EcorV enzymic digestion, condition is 37 DEG C, and product reclaims by 12h.

With the pPH1JI plasmid with gentamicin resistance gene for template, be that primer is used with G1, G2 pfuenzyme pcr amplification obtains the gentamicin resistance gene sequence with flat end:

G1: aattgacataagcctgttcggt，

G2: tgacaatttaccgaacaactcc。

Pcr amplification condition is: 95 DEG C of denaturation 5mins; 95 DEG C of 30s; 58 DEG C of 30s; 72 DEG C of 1min; 28 circulations; 72 DEG C of 10mins; 4 DEG C of preservations, as shown in Figure 4, in Fig. 4,1 is amplified production to PCR primer electrophoresis result, is about 800bp fragment.

PCR primer is connected with the p-loxp digested after reclaiming, and linked system is prepared according to the mole number of carrier and exogenous sequences 1:3.Connection product conversion E.coli is coated on the dull and stereotyped enterprising row filter of LA containing ammonia benzyl and gentamicin, and coating simultaneously only adds up a joint efficiency containing the flat board of ammonia benzyl.

On ammonia benzyl and gentamicin twin antibiotic flat board, picking colony adopts G1, G2 primer to carry out PCR checking, and as shown in Figure 5, in Fig. 5,1,2,3 is colony PCR amplification product to electrophoresis result, is about 800 fragments, conforms to expection.

Be successfully be connected exogenous sequences to obtain gentamicin resistance bacterium colony containing ammonia benzyl and colony number on the flat board of gentamicin, only containing the colony number of the flat board of ammonia benzyl then for containing carrier from the colony number connected, statistics joint efficiency,

Joint efficiency=containing the flat-plate bacterial colony number/only containing the colony number of the flat board of ammonia benzyl of ammonia benzyl and gentamicin

Flat-plate bacterial colony growing state, as Fig. 6, calculates joint efficiency=91/1296=7.02%

red fluorescent protein gene is replaced in the restructuring of embodiment 3, recombinase FLP mediation gus gene

By cloning vector p-FRT plasmid through XcmI enzymic digestion, condition is 37 DEG C, and product reclaims by 12h.

With the pBI121 plasmid with gus gene for template, with Gus1, Gus2 for primer, obtain the gus gene sequence with 3 ' A end with Taq enzyme pcr amplification:

GUS1: atgttacgtcctgtagaaacc，

GUS2: tcattgtttgcctccctg。

Pcr amplification condition is: 95 DEG C of denaturation 5mins; 95 DEG C of 30s; 58 DEG C of 30s; 72 DEG C of 2min; 28 circulations; 72 DEG C of 10mins; 4 DEG C of preservations, as shown in Figure 7, in Fig. 7,1 is amplified production to PCR primer electrophoresis result, is about 1800bp fragment.

PCR primer is connected with the p-FRT digested after reclaiming, and linked system is prepared according to the mole number of carrier and exogenous sequences 1:3.Connect product conversion E.coli to be coated on containing the dull and stereotyped enterprising row filter of ammonia benzyl LA, picking colony adopts the sequencing primer M13-47 primer in multiple clone site downstream on GUS1 and carrier to carry out PCR checking, and object selects the correct recombinant vectors of direction of insertion.As shown in Figure 8, in Fig. 8,1,2,3 is colony PCR amplification product to electrophoresis result, is about 1800 fragments, conforms to expection.

By the two recombination sites two-way expression plant expression vector pRGFL after purifying and the p-FRT carrier 1:2 preparation in molar ratio reaction system with gus gene, by the FLP albumen of purifying and above-mentioned substrate at reaction buffer (2mM MgCl2,70mM NaCl, 50mMTris-HCl, pH7.5) in, 30 DEG C of reaction 1h, reaction product Transformed E .coli coatings receive the LA plate screening of mycin containing card.

Random choose bacterium colony Gus1, Gus2 primer carries out PCR checking, successful carrier of recombinating should increase and obtain about 1800 gus gene fragments, the carrier of unsuccessful restructuring then increases less than object fragment, use RED1, RED2 primer to verify simultaneously, the carrier of unsuccessful restructuring should increase the red fluorescent protein gene fragment of about 800bp, and successful carrier of recombinating can not increase and obtains object fragment

RED1：ctaggttagtggtgg

RED2：atgaagcttgcctcc

Checking electrophoresis result such as a in Fig. 9, figure is the carrier reassembling into merit, and b is contrast.

According to PCR the result statistics recombination fraction:

Recombination fraction=positive colony number/verify total colony number=2/768=0.26%

Recombinant plasmid imports Agrobacterium LBA4404, recombinational agrobacterium is infected tobacco leaf and carry out transient expression, tobacco leaf fluorescence microscope after infecting is detected the expression of fluorescin, GUS tissue staining detects the expression of gus gene simultaneously, not infect tobacco in contrast.

Result is if Figure 10, a are for infecting blade, and b is contrast.Observe green fluorescent protein and GUS color reaction infecting in blade, but do not observe red fluorescent protein.Illustrate and successfully recombinate on pRGFL by gus gene according to method of the present invention, replaced original red fluorescent protein gene, and gus gene can normal expression, recombination fraction is 0.26%.

embodiment 4, recombinase CRE mediate gus gene restructuring and replace green fluorescence protein gene

By cloning vector p-loxp plasmid through XcmI enzymic digestion, condition is 37 DEG C, and product reclaims by 12h.

With the pBI121 plasmid with gus gene for template, with Gus1, Gus2 for primer, obtain the gus gene sequence with 3 ' A end with Taq enzyme pcr amplification:

GUS1: atgttacgtcctgtagaaacc，

GUS2: tcattgtttgcctccctg。

Pcr amplification condition is: 95 DEG C of denaturation 5mins; 95 DEG C of 30s; 58 DEG C of 30s; 72 DEG C of 2min; 28 circulations; 72 DEG C of 10mins; 4 DEG C of preservations, as shown in figure 11, in Figure 11,1 is amplified production to PCR primer electrophoresis result, is about 1800bp fragment.

PCR primer is connected with the p-loxp digested after reclaiming, and linked system is prepared according to the mole number of carrier and exogenous sequences 1:3.Connect product conversion E.coli to be coated on containing the dull and stereotyped enterprising row filter of ammonia benzyl LA, picking colony adopts the sequencing primer M13-47 primer in multiple clone site downstream on GUS1 and carrier to carry out PCR checking, and object selects the correct recombinant vectors of direction of insertion.As shown in figure 12, Tu12Zhong, 1,2,3 is colony PCR amplification product to electrophoresis result, is about 1800 fragments, conforms to expection.

By the two recombination sites two-way expression plant expression vector pRGFL after purifying and the p-loxp carrier 1:2 preparation in molar ratio reaction system with gus gene, by the CRE albumen of purifying and above-mentioned substrate at reaction buffer (2mM MgCl2,70mM NaCl, 50mMTris-HCl, pH7.5) in, 30 DEG C of reaction 1h, reaction product Transformed E .coli coatings receive the LA plate screening of mycin containing card.

Random choose bacterium colony Gus1, Gus2 primer carries out PCR checking, successful carrier of recombinating should increase and obtain about 1800 gus gene fragments, the carrier of unsuccessful restructuring then increases less than object fragment, use GFP1, GFP2 primer to verify simultaneously, the carrier of unsuccessful restructuring should increase the green fluorescence protein gene fragment of about 800bp, and successful carrier of recombinating can not increase and obtains object fragment

GFP1：atggtgagcaagg

GFP2：ttacttgtacagctc

Checking electrophoresis result such as a in Figure 13, figure is the carrier reassembling into merit, and b is contrast.

According to PCR the result statistics recombination fraction:

Recombination fraction=positive colony number/verify total colony number=11/384=2.86%

Recombinant plasmid imports Agrobacterium LBA4404, recombinational agrobacterium is infected tobacco leaf and carry out transient expression, tobacco leaf fluorescence microscope after infecting is detected the expression of fluorescin, GUS tissue staining detects the expression of gus gene simultaneously, not infect tobacco in contrast.

Result is if Figure 14, a are for infecting blade, and b is contrast.Observe red fluorescent protein and GUS display reaction infecting in blade, but do not observe green fluorescent protein.Illustrate and successfully recombinate on pRGFL by gus gene according to method of the present invention, replaced original green fluorescent protein gene, and gus gene can normal expression, recombination fraction is 2.86%.

Sequence 1

1 tgagcgtcgc aaaggcgctc ggtcttgcct tgctcgtcgg tgatgtactt caccagctcc

61 gcgaagtcgc tcttcttgat ggagcgcatg gggacgtgct tggcaatcac gcgcaccccc

121 cggccgtttt agcggctaaa aaagtcatgg ctctgccctc gggcggacca cgcccatcat

181 gaccttgcca agctcgtcct gcttctcttc gatcttcgcc agcagggcga ggatcgtggc

241 atcaccgaac cgcgccgtgc gcgggtcgtc ggtgagccag agtttcagca ggccgcccag

301 gcggcccagg tcgccattga tgcgggccag ctcgcggacg tgctcatagt ccacgacgcc

361 cgtgattttg tagccctggc cgacggccag caggtaggcc gacaggctca tgccggccgc

421 cgccgccttt tcctcaatcg ctcttcgttc gtctggaagg cagtacacct tgataggtgg

481 gctgcccttc ctggttggct tggtttcatc agccatccgc ttgccctcat ctgttacgcc

541 ggcggtagcc ggccagcctc gcagagcagg attcccgttg agcaccgcca ggtgcgaata

601 agggacagtg aagaaggaac acccgctcgc gggtgggcct acttcaccta tcctgcccgg

661 ctgacgccgt tggatacacc aaggaaagtc tacacgaacc ctttggcaaa atcctgtata

721 tcgtgcgaaa aaggatggat ataccgaaaa aatcgctata atgaccccga agcagggtta

781 tgcagcggaa aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg

841 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt

901 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag

961 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt

1021 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta

1081 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt

1141 cagtgagcga ggaagcggaa gagcgccaga aggccgccag agaggccgag cgcggccgtg

1201 aggcttggac gctagggcag ggcatgaaaa agcccgtagc gggctgctac gggcgtctga

1261 cgcggtggaa agggggaggg gatgttgtct acatggctct gctgtagtga gtgggttgcg

1321 ctccggcagc ggtcctgatc aatcgtcacc ctttctcggt ccttcaacgt tcctgacaac

1381 gagcctcctt ttcgccaatc catcgacaat caccgcgagt ccctgctcga acgctgcgtc

1441 cggaccggct tcgtcgaagg cgtctatcgc ggcccgcaac agcggcgaga gcggagcctg

1501 ttcaacggtg ccgccgcgct cgccggcatc gctgtcgccg gcctgctcct caagcacggc

1561 cccaacagtg aagtagctga ttgtcatcag cgcattgacg gcgtccccgg ccgaaaaacc

1621 cgcctcgcag aggaagcgaa gctgcgcgtc ggccgtttcc atctgcggtg cgcccggtcg

1681 cgtgccggca tggatgcgcg cgccatcgcg gtaggcgagc agcgcctgcc tgaagctgcg

1741 ggcattcccg atcagaaatg agcgccagtc gtcgtcggct ctcggcaccg aatgcgtatg

1801 attctccgcc agcatggctt cggccagtgc gtcgagcagc gcccgcttgt tcctgaagtg

1861 ccagtaaagc gccggctgct gaacccccaa ccgttccgcc agtttgcgtg tcgtcagacc

1921 gtctacgccg acctcgttca acaggtccag ggcggcacgg atcactgtat tcggctgcaa

1981 ctttgtcatg cttgacactt tatcactgat aaacataata tgtccaccaa cttatcagtg

2041 ataaagaatc cgcgcgttca atcggaccag cggaggctgg tccggaggcc agacgtgaaa

2101 cccaacatac ccctgatcgt aattctgagc actgtcgcgc tcgacgctgt cggcatcggc

2161 ctgattatgc cggtgctgcc gggcctcctg cgcgatctgg ttcactcgaa cgacgtcacc

2221 gcccactatg gcattctgct ggcgctgtat gcgttggtgc aatttgcctg cgcacctgtg

2281 ctgggcgcgc tgtcggatcg tttcgggcgg cggccaatct tgctcgtctc gctggccggc

2341 gccagatctg gggaaccctg tggttggcat gcacatacaa atggacgaac ggataaacct

2401 tttcacgccc ttttaaatat ccgattattc taataaacgc tcttttctct taggtttacc

2461 cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatctga

2521 tcatgagcgg agaattaagg gagtcacgtt atgacccccg ccgatgacgc gggacaagcc

2581 gttttacgtt tggaactgac agaaccgcaa cgttgaagga gccactcagc cgcgggtttc

2641 tggagtttaa tgagctaagc acatacgtca gaaaccatta ttgcgcgttc aaaagtcgcc

2701 taaggtcact atcagctagc aaatatttct tgtcaaaaat gctccactga cgttccataa

2761 attcccctcg gtatccaatt agagtctcat attcactctc aatccaaata atctgcaccg

2821 gatctggatc gtttcgcatg attgaacaag atggattgca cgcaggttct ccggccgctt

2881 gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg

2941 ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc gacctgtccg

3001 gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg

3061 ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg

3121 gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca

3181 tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc

3241 accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt cttgtcgatc

3301 aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca

3361 aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc tgcttgccga

3421 atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg

3481 cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg

3541 aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg

3601 ccttctatcg ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga

3661 ccaagcgacg cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag

3721 gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct

3781 catgctggag ttcttcgccc acgggatctc tgcggaacag gcggtcgaag gtgccgatat

3841 cattacgaca gcaacggccg acaagcacaa cgccacgatc ctgagcgaca atatgatcgg

3901 gcccggcgtc cacatcaacg gcgtcggcgg cgactgccca ggcaagaccg agatgcaccg

3961 cgatatcttg ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggatgatccc

4021 cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc

4081 gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg

4141 catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata

4201 cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc

4261 tatgttacta gatcgggcct cctgtcaatg ctggcggcgg ctctggtggt ggttctggtg

4321 gcggctctga gggtggtggc tctgagggtg gcggttctga gggtggcggc tctgagggag

4381 gcggttccgg tggtggctct ggttccggtg attttgatta tgaaaagatg gcaaacgcta

4441 ataagggggc tatgaccgaa aatgccgatg aaaacgcgct acagtctgac gctaaaggca

4501 aacttgattc tgtcgctact gattacggtg ctgctatcga tggtttcatt ggtgacgttt

4561 ccggccttgc taatggtaat ggtgctactg gtgattttgc tggctctaat tcccaaatgg

4621 ctcaagtcgg tgacggtgat aattcacctt taatgaataa tttccgtcaa tatttacctt

4681 ccctccctca atcggttgaa tgtcgccctt ttgtctttgg cccaatacgc aaaccgcctc

4741 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag

4801 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt

4861 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca

4921 caggaaacag ctatgaccat gattacgcca gggttgtcac tggattttgg ttttaggaat

4981 tagaaatttt attgatagaa gtattttaca aatacaaata catactaagg gtttcttata

5041 tgctcaacac atgagcgaaa ccctataaga accctaattc ccttatctgg gaactactca

5101 cacattattc tggagaaaaa tagagagaga tagatttgta gagagagact ggtgattttt

5161 gcggacggtc gacgaagttc ctatactttc tagagaatag gaacttccta ggttagtggt

5221 ggtggtggtg gtgctcgaga tctcaggaac aggtggtggc ggccctcggt gcgctcgtac

5281 tgctccacga tggtgtagtc ctcgttgtgg gaggtgatgt ccagcttggc gtccacgtag

5341 tagtagccgg gcagctgcac gggcttcttg gccatgtaga tggacttgaa ctccaccagg

5401 tagtggccgc cgtccttcag cttcagggcc ttgtgggtct cgcccttcag cacgccgtcg

5461 cgggggtaca ggcgctcggt ggaggcctcc cagcccatgg tcttcttctg catcacgggg

5521 ccgtcggagg ggaagttcac gccgatgaac ttcaccttgt agatgaagca gccgtcctgc

5581 agggaggagt cctgggtcac ggtcgccacg ccgccgtcct cgaagttcat cacgcgctcc

5641 cacttgaagc cctcggggaa ggacagcttc ttgtagtcgg ggatgtcggc ggggtgcttc

5701 acgtacacct tggagccgta ctggaactgg ggggacagga tgtcccaggc gaagggcagg

5761 gggccgccct tggtcacctt cagcttcacg gtgttgtggc cctcgtaggg gcggccctcg

5821 ccctcgccct cgatctcgaa ctcgtggccg ttcacggtgc cctccatgcg caccttgaag

5881 cgcatgaact cggtgatgac gttctcggag gaggcaagct tcatgaagtt cctatacttt

5941 ctagagaata ggaacttcac tagtctagtc tcgaggtcct ctccaaatga aatgaacttc

6001 cttatataga ggaagggtct tgcgaagggc aagctagctt gcatgcctgc aggtccccag

6061 attagccttt tcaatttcag aaagaatgct aacccacaga tggttagaga ggcttacgca

6121 gcaggtctca tcaagacgat ctacccgagc aataatctcc aggaaatcaa ataccttccc

6181 aagaaggtta aagatgcagt caaaagattc aggactaact gcatcaagaa cacagagaaa

6241 gatatatttc tcaagatcag aagtactatt ccagtatgga cgattcaagg cttgcttcac

6301 aaaccaaggc aagtaataga gattggagtc tctaaaaagg tagttcccac tgaatcaaag

6361 gccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa

6421 cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg

6481 gagcacgaca cacttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg

6541 gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca

6601 gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat

6661 cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat

6721 ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag

6781 caagtggatt gatgtgatat ctccactgac gtaagggatg acgcacaatc ccactatcct

6841 tcgcaagacc cttcctctat ataaggaagt tcatttcatt tggagagaac acgggggact

6901 ctagagggat ccataacttc gtataatgta tgctatacga agttatatgg tgagcaaggg

6961 cgaggagctg ttcaccgggg tggtgcccat cctggtcgag ctggacggcg acgtaaacgg

7021 ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc acctacggca agctgaccct

7081 gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg cccaccctcg tgaccaccct

7141 gacctacggc gtgcagtgct tcagccgcta ccccgaccac atgaagcagc acgacttctt

7201 caagtccgcc atgcccgaag gctacgtcca ggagcgcacc atcttcttca aggacgacgg

7261 caactacaag acccgcgccg aggtgaagtt cgagggcgac accctggtga accgcatcga

7321 gctgaagggc atcgacttca aggaggacgg caacatcctg gggcacaagc tggagtacaa

7381 ctacaacagc cacaacgtct atatcatggc cgacaagcag aagaacggca tcaaggtgaa

7441 cttcaagatc cgccacaaca tcgaggacgg cagcgtgcag ctcgccgacc actaccagca

7501 gaacaccccc atcggcgacg gccccgtgct gctgcccgac aaccactacc tgagcaccca

7561 gtccgccctg agcaaagacc ccaacgagaa gcgcgatcac atggtcctgc tggagttcgt

7621 gaccgccgcc gggatcactc tcggcatgga cgagctgtac aagtaaataa cttcgtataa

7681 tgtatgctat acgaagttat ggtacccgag ctcgaatttc cccgatcgtt caaacatttg

7741 gcaataaagt ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt

7801 tctgttgaat tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag

7861 atgggttttt atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat

7921 atagcgcgca aactaggata aattatcgcg cgcggtgtca tctatgttac tagatcggga

7981 attcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta

8041 atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg

8101 atcgcccttc ccaacagttg cgcagcctga atggcgcccg ctcctttcgc tttcttccct

8161 tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta

8221 gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgattt gggtgatggt

8281 tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg

8341 ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat ctcgggctat

8401 tcttttgatt tataagggat tttgccgatt tcggaaccac catcaaacag gattttcgcc

8461 tgctggggca aaccagcgtg gaccgcttgc tgcaactctc tcagggccag gcggtgaagg

8521 gcaatcagct gttgcccgtc tcactggtga aaagaaaaac caccccagta cattaaaaac

8581 gtccgcaatg tgttattaag ttgtctaagc gtcaatttgt ttacaccaca atatatcctg

8641 ccaccagcca gccaacagct ccccgaccgg cagctcggca caaaatcacc actcgataca

8701 ggcagcccat cagtccggga cggcgtcagc gggagagccg ttgtaaggcg gcagactttg

8761 ctcatgttac cgatgctatt cggaagaacg gcaactaagc tgccgggttt gaaacacgga

8821 tgatctcgcg gagggtagca tgttgattgt aacgatgaca gagcgttgct gcctgtgatc

8881 aaatatcatc tccctcgcag agatccgaat tatcagcctt cttattcatt tctcgcttaa

8941 ccgtgacagg ctgtcgatct tgagaactat gccgacataa taggaaatcg ctggataaag

9001 ccgctgagga agctgagtgg cgctatttct ttagaagtga acgttgacga tatcaactcc

9061 cctatccatt gctcaccgaa tggtacaggt cggggacccg aagttccgac tgtcggcctg

9121 atgcatcccc ggctgatcga ccccagatct ggggctgaga aagcccagta aggaaacaac

9181 tgtaggttcg agtcgcgaga tcccccggaa ccaaaggaag taggttaaac ccgctccgat

9241 caggccgagc cacgccaggc cgagaacatt ggttcctgta ggcatcggga ttggcggatc

9301 aaacactaaa gctactggaa cgagcagaag tcctccggcc gccagttgcc aggcggtaaa

9361 ggtgagcaga ggcacgggag gttgccactt gcgggtcagc acggttccga acgccatgga

9421 aaccgccccc gccaggcccg ctgcgacgcc gacaggatct agcgctgcgt ttggtgtcaa

9481 caccaacagc gccacgcccg cagttccgca aatagccccc aggaccgcca tcaatcgtat

9541 cgggctacct agcagagcgg cagagatgaa cacgaccatc agcggctgca cagcgcctac

9601 cgtcgccgcg accccgcccg gcaggcggta gaccgaaata aacaacaagc tccagaatag

9661 cgaaatatta agtgcgccga ggatgaagat gcgcatccac cagattcccg ttggaatctg

9721 tcggacgatc atcacgagca ataaacccgc cggcaacgcc cgcagcagca taccggcgac

9781 ccctcggcct cgctgttcgg gctccacgaa aacgccggac agatgcgcct tgtgagcgtc

9841 cttggggccg tcctcctgtt tgaagaccga cagcccaatg atctcgccgt cgatgtaggc

9901 gccgaatgcc acggcatctc gcaaccgttc agcgaacgcc tccatgggct ttttctcctc

9961 gtgctcgtaa acggacccga acatctctgg agctttcttc agggccgaca atcggatctc

10021 gcggaaatcc tgcacgtcgg ccgctccaag ccgtcgaatc tgagccttaa tcacaattgt

10081 caattttaat cctctgttta tcggcagttc gtagagcgcg ccgtgcgtcc cgagcgatac

10141 tgagcgaagc aagtgcgtcg agcagtgccc gcttgttcct gaaatgccag taaagcgctg

10201 gctgctgaac ccccagccgg aactgacccc acaaggccct agcgtttgca atgcaccagg

10261 tcatcattga cccaggcgtg ttccaccagg ccgctgcctc gcaactcttc gcaggcttcg

10321 ccgacctgct cgcgccactt cttcacgcgg gtggaatccg atccgcacat gaggcggaag

10381 gtttccagct tgagcgggta cggctcccgg tgcgagctga aatagtcgaa catccgtcgg

10441 gccgtcggcg acagcttgcg gtacttctcc catatgaatt tcgtgtagtg gtcgccagca

10501 aacagcacga cgatttcctc gtcgatcagg acctggcaac gggacgtttt cttgccacgg

10561 tccaggacgc ggaagcggtg cagcagcgac accgattcca ggtgcccaac gcggtcggac

10621 gtgaagccca tcgccgtcgc ctgtaggcgc gacaggcatt cctcggcctt cgtgtaatac

10681 cggccattga tcgaccagcc caggtcctgg caaagctcgt agaacgtgaa ggtgatcggc

10741 tcgccgatag gggtgcgctt cgcgtactcc aacacctgct gccacaccag ttcgtcatcg

10801 tcggcccgca gctcgacgcc ggtgtaggtg atcttcacgt ccttgttgac gtggaaaatg

10861 accttgtttt gcagcgcctc gcgcgggatt ttcttgttgc gcgtggtgaa cagggcagag

10921 cgggccgtgt cgtttggcat cgctcgcatc gtgtccggcc acggcgcaat atcgaacaag

10981 gaaagctgca tttccttgat ctgctgcttc gtgtgtttca gcaacgcggc ctgcttggcc

11041 tcgctgacct gttttgccag gtcctcgccg gcggtttttc gcttcttggt cgtcatagtt

11101 cctcgcgtgt cgatggtcat cgacttcgcc aaacctgccg cctcctgttc gagacgacgc

11161 gaacgctcca cggcggccga tggcgcgggc agggcagggg gagccagttg cacgctgtcg

11221 cgctcgatct tggccgtagc ttgctggacc atcgagccga cggactggaa ggtttcgcgg

11281 ggcgcacgca tgacggtgcg gcttgcgatg gtttcggcat cctcggcgga aaaccccgcg

11341 tcgatcagtt cttgcctgta tgccttccgg tcaaacgtcc gattcattca ccctccttgc

11401 gggattgccc cgactcacgc cggggcaatg tgcccttatt cctgatttga cccgcctggt

11461 gccttggtgt ccagataatc caccttatcg gcaatgaagt cggtcccgta gaccgtctgg

11521 ccgtccttct cgtacttggt attccgaatc ttgccctgca cgaataccag cgaccccttg

11581 cccaaatact tgccgtgggc ctcggcctga gagccaaaac acttgatgcg gaagaagtcg

11641 gtgcgctcct gcttgtcgcc ggcatcgttg cgccacatct aggtactaaa acaattcatc

11701 cagtaaaata taatatttta ttttctccca atcaggcttg atccccagta agtcaaaaaa

11761 tagctcgaca tactgttctt ccccgatatc ctccctgatc gaccggacgc agaaggcaat

11821 gtcataccac ttgtccgccc tgccgcttct cccaagatca ataaagccac ttactttgcc

11881 atctttcaca aagatgttgc tgtctcccag gtcgccgtgg gaaaagacaa gttcctcttc

11941 gggcttttcc gtctttaaaa aatcatacag ctcgcgcgga tctttaaatg gagtgtcttc

12001 ttcccagttt tcgcaatcca catcggccag atcgttattc agtaagtaat ccaattcggc

12061 taagcggctg tctaagctat tcgtataggg acaatccgat atgtcgatgg agtgaaagag

12121 cctgatgcac tccgcataca gctcgataat cttttcaggg ctttgttcat cttcatactc

12181 ttccgagcaa aggacgccat cggcctcact catgagcaga ttgctccagc catcatgccg

12241 ttcaaagtgc aggacctttg gaacaggcag ctttccttcc agccatagca tcatgtcctt

12301 ttcccgttcc acatcatagg tggtcccttt ataccggctg tccgtcattt ttaaatatag

12361 gttttcattt tctcccacca gcttatatac cttagcagga gacattcctt ccgtatcttt

12421 tacgcagcgg tatttttcga tcagtttttt caattccggt gatattctca ttttagccat

12481 ttattatttc cttcctcttt tctacagtat ttaaagatac cccaagaagc taattataac

12541 aagacgaact ccaattcact gttccttgca ttctaaaacc ttaaatacca gaaaacagct

12601 ttttcaaagt tgttttcaaa gttggcgtat aacatagtat cgacggagcc gattttgaaa

12661 ccacaattat gggtgatgct gccaacttac tgatttagtg tatgatggtg tttttgaggt

12721 gctccagtgg cttctgtgtc tatcagctgt ccctcctgtt cagctactga cggggtggtg

12781 cgtaacggca aaagcaccgc cggacatcag cgctatctct gctctcactg ccgtaaaaca

12841 tggcaactgc agttcactta caccgcttct caacccggta cgcaccagaa aatcattgat

12901 atggccatga atggcgttgg atgccgggca acagcccgca ttatgggcgt tggcctcaac

12961 acgattttac gtcacttaaa aaactcaggc cgcagtcggt aacctcgcgc atacagccgg

13021 gcagtgacgt catcgtctgc gcggaaatgg acgaacagtg gggctatgtc ggggctaaat

13081 cgcgccagcg ctggctgttt tacgcgtatg acagtctccg gaagacggtt gttgcgcacg

13141 tattcggtga acgcactatg gcgacgctgg ggcgtcttat gagcctgctg tcaccctttg

13201 acgtggtgat atggatgacg gatggctggc cgctgtatga atcccgcctg aagggaaagc

13261 tgcacgtaat cagcaagcga tatacgcagc gaattgagcg gcataacctg aatctgaggc

13321 agcacctggc acggctggga cggaagtcgc tgtcgttctc aaaatcggtg gagctgcatg

13381 acaaagtcat cgggcattat ctgaacataa aacactatca ataagttgga gtcattaccc

13441 aattatgata gaatttacaa gctataaggt tattgtcctg ggtttcaagc attagtccat

13501 gcaagttttt atgctttgcc cattctatag atatattgat aagcgcgctg cctatgcctt

13561 gccccctgaa atccttacat acggcgatat cttctatata aaagatatat tatcttatca

13621 gtattgtcaa tatattcaag gcaatctgcc tcctcatcct cttcatcctc ttcgtcttgg

13681 tagcttttta aatatggcgc ttcatagagt aattctgtaa aggtccaatt ctcgttttca

13741 tacctcggta taatcttacc tatcacctca aatggttcgc tgggtttatc gcacccccga

13801 acacgagcac ggcacccgcg accactatgc caagaatgcc caaggtaaaa attgccggcc

13861 ccgccatgaa gtccgtgaat gccccgacgg ccgaagtgaa gggcaggccg ccacccaggc

13921 cgccgccctc actgcccggc acctggtcgc tgaatgtcga tgccagcacc tgcggcacgt

13981 caatgcttcc gggcgtcgcg ctcgggctga tcgcccatcc cgttactgcc ccgatcccgg

14041 caatggcaag gactgccagc gctgccattt ttggggtgag gccgttcgcg gccgaggggc

14101 gcagcccctg gggggatggg aggcccgcgt tagcgggccg ggagggttcg agaagggggg

14161 gcacccccct tcggcgtgcg cggtcacgcg cacagggcgc agccctggtt aaaaacaagg

14221 tttataaata ttggtttaaa agcaggttaa aagacaggtt agcggtggcc gaaaaacggg

14281 cggaaaccct tgcaaatgct ggattttctg cctgtggaca gcccctcaaa tgtcaatagg

14341 tgcgcccctc atctgtcagc actctgcccc tcaagtgtca aggatcgcgc ccctcatctg

14401 tcagtagtcg cgcccctcaa gtgtcaatac cgcagggcac ttatccccag gcttgtccac

14461 atcatctgtg ggaaactcgc gtaaaatcag gcgttttcgc cgatttgcga ggctggccag

14521 ctccacgtcg ccggccgaaa tcgagcctgc ccctcatctg tcaacgccgc gccgggtgag

14581 tcggcccctc aagtgtcaac gtccgcccct catctgtcag tgagggccaa gttttccgcg

14641 aggtatccac aacgccggcg gccgcggtgt ctcgcacacg gcttcgacgg cgtttctggc

14701 gcgtttgcag ggccatagac ggccgccagc ccagcggcga gggcaaccag cccgg

 

Sequence 2

1 gaagttccta ttctctagaa agtataggaa cttcgccacc cttattctgg actagtgata

61 tccgaagttc ctattctcta gaaagtatag gaacttcg

 

Sequence 3

1 ataacttcgt ataatgtatg ctatacgaag ttatccaccc ttattctgga ctagtgatat

61 ccataacttc gtataatgta tgctatacga agttat

 

 

 

Claims (8)

1. a DNA molecular, from 5 ' end successively containing containing NoS terminator, SalI enzyme recognition sequence, inverted-F RT sequence, red fluorescent protein gene, inverted-F RT sequence, SpeI enzyme recognition sequence, bidirectional promoter, BamHI enzyme recognition sequence, oppositely loxP sequence, green fluorescence protein gene, oppositely loxP sequence, KpnI enzyme recognition sequence, NoS terminator.

2. DNA molecular according to claim 1, is characterized in that nucleotide sequence is that in sequence table, sequence 1 holds 4356-7983 position from 5 '.

3. one kind is inserted the DNA molecular of following sequence in the multiple clone site of the carrier that sets out: from 5 ' end successively containing forward FRT sequence, XcmI enzyme recognition sequence, SpeI enzyme recognition sequence, EcorV enzyme recognition sequence, forward FRT sequence.

4. DNA molecular according to claim 3, is characterized in that nucleotide sequence comprises sequence 2 in sequence table.

5. one kind is inserted the DNA molecular of following sequence in the multiple clone site of the carrier that sets out: from 5 ' end successively containing reverse loxP sequence, XcmI enzyme recognition sequence, SpeI enzyme recognition sequence, EcorV enzyme recognition sequence, oppositely loxP sequence.

6. DNA molecular according to claim 3, is characterized in that nucleotide sequence comprises sequence 3.

7. the DNA molecular according to claim 3,4, is characterized in that XcmI enzyme recognition sequence is as follows: ccacccttattctgg.

8. the application of described carrier in expression of plants of claim 1,3,4.