CN104447998A - Method for preparing polyclonal antibody of human aspartic transaminase cytoplasm isozymes - Google Patents

Abstract

The invention discloses a method for preparing a polyclonal antibody of human aspartic transaminase cytoplasm isozymes. The method comprises the following steps: acquiring human cAST genes from GENEBANK of NCBI; inserting the human cAST genes into an expression vector and transforming the genes into host cells to be expressed; obtaining human cAST proteins; immunizing adult goats by using the human cAST proteins, and sampling blood and separating the serum after immunizing for 5 times; precipitating the serum by using 33-50 percent saturated ammonium sulfate, and performing cAST antigen affinity column purification, thereby obtaining the goat anti-human cAST antibody. The obtained antibody has the characteristics of high titer, high purity and high specificity.

Description

The preparation method of the polyclonal antibody of people source aspartic transaminase kytoplasm isozyme

Technical field

The present invention relates to biological technical field, be specifically related to the preparation method of the polyclonal antibody (being called for short people source cAST antibody) in a kind of people source aspartic transaminase kytoplasm isozyme (cAST plasmotype aspartate amino transferase).

Background technology

Aspartic transaminase (Aspartate aminotransferase, AST) is extensively present in the various histocyte of human body, especially abundant with liver, heart tissue's cell content, and in normal human serum, AST activity is very low.In human body there are two kinds of isozymes in AST, and one is cAST, is mainly derived from cytoplasm, and another kind is mAST, is present in plastosome.These two kinds of isozymes are variant in genomic constitution, all different in amino acid composition, immunological characteristic and transformation period in vivo etc.

The activity that existing Clinical Laboratory measures AST in serum is the summation of cAST and mAST activity, because AST is widely distributed, inorganizable specificity is not high to diagnostic value, in recent years the isozyme detection of subcellsular level is progressively applied to clinical, comprises the mensuration of serum mAST.When the slight pathology of body, histiocytic permeability of cell membrane increases, and cAST permeate through cell membranes enters in blood system, but mAST has the protection of two-layer mitochondrial membrane, is not easily released into blood; And when body serious disease, there is necrocytosis, plastosome disintegration, the mAST be attached on plastosome can discharge into rapidly in blood.Therefore, serum mAST activity can reflect histiocytic degree of necrosis, if detect high-level mAST in serum, then shows cardiac muscle, liver is badly damaged; The transformation period of mAST in blood is shorter than cAST in addition, and when cell no longer destroys or repairs, in serum, mAST is down to normal level very soon, and therefore mAST is again the evaluation index of cardiac muscle, liver damage prognosis, has important value to the diagnosis of disease, treatment.

At present, in serum, mAST measures and mainly contains electrophoretic method, chromatography and immunodepression etc., especially possesses advantage that is special, accurate, fast and convenient, that can be used for Aulomatizeted Detect with immunodepression, is suitable for the application of clinical extensive sample.Its Cleaning Principle is: in cAST antibody and serum sample, cAST effect forms immunocomplex, make cAST activity inhibited, and mAST activity is unaffected, mAST can with the reaction coupling of malate dehydrogenase (malic acid dehydrogenase) (MDH) catalysis, NADH is made to be oxidized to NAD+, by detecting the speed that certain wave strong point NADH absorbancy declines, can be calculated the activity of mAST.

From above-mentioned reaction principle, cAST antibody is the critical materials of mAST determination of activity system, and can cAST antibody becomes the key of mAST activity in Accurate Measurement human serum sample.The cAST antibody being applicable to mAST determination of activity should have following feature:

(1) specificity is high: cAST in energy specific recognition serum sample, and cross reaction does not occur with mAST;

(2) rejection ability is high: the activity that effectively can suppress cAST in serum sample;

(3) purity is high.

At present, on market, its immunogen source of cAST antibody differs, and the cAST antibody that some cAST deriving from other species obtain then can not specially suppress the cAST in human serum sample active effectively; And its antigen majority of humanized cAST antibody is certain fragment (8 ~ 10 amino acid) of people cAST total length, and this polyclonal antibody produced by small peptide immunity often can only identify certain antigenic determinant, therefore same exist the problem that fully can not suppress human serum sample cAST activity; The antibody obtained by the immunity of people cAST full length sequence is then very rare, and some antigen is then obtain by extracting from human heart or liver, and this just greatly limit its application.

Summary of the invention

The present invention is directed to the above-mentioned deficiency of prior art, there is provided a kind of efficiently to prepare people source cAST full length sequence and be prepared the antibody of height of tiring, high specificity by this antigen, to meet the preparation method of the polyclonal antibody of the people source aspartic transaminase kytoplasm isozyme of the demand of clinical in vitro diagnosis in vitro reagent.This preparation method is with low cost, simple to operate, success ratio is high, and the antibody titer prepared is high, purity is high, the feature of high specificity.

In order to solve the problems of the technologies described above, the technical solution adopted in the present invention is: the preparation method of the polyclonal antibody of a kind of people source cAST, and preparation process comprises:

(1) from NCBI ( american National Biotechnology Information center) GENEBANK on obtain the complete genome sequence of people cAST, through codon optimized and synthesize introduce the nucleotide sequence of 6 ~ 30bp at two ends after; People cAST gene order after synthesis is the nucleotide sequence shown in SEQ ID NO.1;

(2) the people source cAST gene after synthesis is inserted in expression vector, and is transformed in host cell and expresses;

(3) culturing step (2) obtain containing the host cell of goal gene, obtain people source cAST albumen, and after affinity purification, must this albumen sterling;

(4) get people source cAST sterling 1 ~ 10mg that step (3) obtains, adopt the adult sheep of subcutaneous multi-point injection method immunity, every 2 weeks once, altogether immunity 5 times; First immunisation adds the Freund's complete adjuvant with antigen equivalent, adds the Freund's incomplete adjuvant with antigen equivalent for 4 times afterwards, final immunization 10d (my god) take a blood sample afterwards, separation of serum;

(5) goat-anti people cAST serum mass percent step (4) obtained is the saturated ammonium sulphate solution precipitation of 33% ~ 50%, and the precipitation buffer A collected dissolves, and obtains the crude extract of goat-anti people cAST antibody;

(6) cAST antigen affinity column is balanced with buffer A, then the crude extract upper prop absorption that step (5) is obtained, terminate rear buffer B and carry out wash-out, and collect elutriant;

(7) elutriant step (6) collected loads in dialysis tubing also uses buffer A dialysis 12 ~ 24h, can obtain goat-anti people cAST antibody sterling and people source cAST polyclonal antibody.

The above-mentioned preparation process of the present invention also comprises the steps: the goat-anti people cAST antibody sterling obtained to adopt Elisa method (enzyme-linked immunosorbent assay, industry ordinary method) measure it and tire, utilize people mAST antigen in contrast simultaneously, the above-mentioned goat-anti people cAST antibody titer prepared is greater than 1:60000 after testing, control group is then without color reaction, and namely through the known the present invention's acquisition of above-mentioned steps is people source cAST polyclonal antibody.

Wherein, the people cAST gene order in step (1) after codon optimized is the nucleotide sequence shown in SEQ ID NO.1; The described Nucleotide introducing 6 ~ 30bp at people cAST gene order two ends, the major function introducing these Nucleotide is: 1. add restriction enzyme site, facilitates the connection of goal gene and carrier; 2. add suitable label, be convenient to the separation and purification in later stage, preferably histidine-tagged;

Described expression vector is prokaryotic expression carrier, preferred PET series, further preferred PET22b+; Described host cell is prokaryotic host cell, preferred strain Escherichia coli, further preferred Rosetta (DE3);

Affinity purification described in step (3) is the people cAST specific binding that can go out with host cell expression and the method be separated by particular elutriated, preferred nickel post affinity purification;

Described buffer A comprises 0.01 ~ 0.1mol/L, the one in the phosphate buffered saline buffer of pH7.0 ~ 8.0, Tri(Hydroxymethyl) Amino Methane Hydrochloride damping fluid (Tris-Hcl), 4-hydroxyethyl piperazine ethanesulfonic acid damping fluid (Hepes).

Described buffer B comprises 0.01 ~ 0.25mol/L, the glycine-HCI damping fluid of pH2.0 ~ 4.0, Trisodium Citrate-hydrochloride buffer; Or the one in the sodium carbonate-sodium hydrate buffer solution of 0.01 ~ 0.25mol/L, pH 10.0 ~ 12.5, Sodium Tetraborate-sodium hydrate buffer solution, Sodium phosphate dibasic-sodium hydrate buffer solution.

Described cAST antigen affinity column comprises cAST and is cross-linked one in NHS-activated Sepharose 4fast Flow, CNBr-activated Sepharose 4fast Flow or epoxy-activated sepharose 6B.

Described people mAST antigen to refer to by genetic engineering means by people mAST gene clone in protokaryon or carrier for expression of eukaryon, and is converted in Host Strains and realizes correction and obtain.

Advantage of the present invention and beneficial effect:

1, the people cAST antibody prepared by the present invention is the polyclonal antibody of sheep gained of growing up based on people source cAST full-length proteins epi sequence, and whole preparation flow is simple, easy to operate.Wherein, people cAST albumen as antigenic substance utilizes genetic engineering means, successfully achieve complete sequence high expression in vitro, and the way of purification adopted is " a step affinity purification ", compared with traditional direct method extracting this albumen from human internal organ, this technique is not only simple to operate, and preparation cost is low, and the finished product yield of gained is high, purity is high, biological activity is high, large-scale application of being more convenient for.In addition, above-mentioned antigen is utilized to carry out immunity to adult sheep, the goat-anti people cAST antiserum(antisera) obtained is after ammonium sulfate precipitation and cAST antigen affinity column two-step purifying, not only yield is high, purity is high for gained antibody, height of tiring, and with people mAST no cross reaction, possessed the high degree of specificity to people cAST.

2, be applied to mAST detection kit with above-mentioned goat-anti people cAST antibody, antibody amount used is few, and atopic is high, is suitable for the Synthesis and applications of test kit, can be widely used in clinical detection.

Embodiment

Below in conjunction with embodiment, the present invention is further described in detail, but is not limited to this.

A preparation method for people source cAST polyclonal antibody, comprises following operation steps:

(1) complete genome sequence of people cAST is obtained from the GENEBANK of NCBI, according to intestinal bacteria preference codon table, carry out codon modify to remove intestinal bacteria rare codon to people cAST gene order, the people cAST gene order after optimization is the nucleotide sequence shown in SEQ ID NO.1;

(2) people cAST gene order 5 ' end after optimization adds restriction enzyme site Nde I, 3 ' and holds to remove after terminator codon and add restriction enzyme site Xho I, and carry out complete sequence synthesis afterwards, concrete synthetic method is as follows:

1) design length is the oligonucleotide sequence 22 of the covering whole people source cAST gene of 80mer, and as primer, two often adjacent oligonucleotide sequences have the repetition of 20 bases, and the primer of design is as follows:

P1：80mer

CATATGGCACCTCCGAGCGTGTTTGCCGAGGTGCCGCAGGCACAACCTGTTCTGGTGTTCAAGCTGACAGCCGACTTCCG

P2：80mer

CAGTCATCTGTGCGATAGGCACCAACGCCCAGATTCACTTTACGAGGGTCAGGGTCCTCACGGAAGTCGGCTGTCAGCTT

P3：80mer

GCCTATCGCACAGATGACTGCCATCCGTGGGTGCTGCCGGTTGTGAAAAAAGTTGAGCAGAAGATCGCAAACGATAACAG

P4：80mer

CGGCTTGCACAGCTGCGGAATTCGGCTAAGCCCAGGATCGGCAGGTACTCGTGGTTCAGGCTGTTATCGTTTGCGATCTT

P5：80mer

TTCCGCAGCTGTGCAAGCCGCTTAGCACTGGGTGACGACAGCCCGGCATTAAAGGAAAAGCGCGTTGGCGGCGTTCAAAG

P6：80mer

CCGTTATACCAGCGGGCTAAAAAGTCGGCGCCGATACGTAATGCGCCTGTGCCACCCAGGCTTTGAACGCCGCCAACGCG

P7：80mer

TTAGCCCGCTGGTATAACGGCACCAACAACAAGAACACCCCGGTGTACGTGAGTAGTCCGACATGGGAAAACCACAACGC

P8：80mer

TTCTCTGCGTCCCAATAGCGGTAGCTACGGATGTCCTTGAAGCCGGCGGCGCTGAAAACGGCGTTGTGGTTTTCCCATGT

P9：80mer

CGCTATTGGGACGCAGAGAAGCGTGGCCTGGACTTACAAGGTTTCCTGAACGACCTGGAGAACGCACCTGAGTTCAGCAT

P10：80mer

AATACCGGTCGGATTGTGGGCGCATGCATGCAGCACCACAATGCTGAACTCAGGTGCGTTCTCCAGGTCGTTCAGGAAAC

P11：80mer

CCCACAATCCGACCGGTATTGACCCGACCCCTGAACAGTGGAAGCAGATCGCAAGCGTGATGAAACACCGTTTCCTGTTC

P12：80mer

CTAACGAAGTAGCGGATTGCCCATGCGTCACGCTCTAAGTTGCCACTGGCGAAGCCCTGGTAGGCGCTATCGAAGAACGG

P13：80mer

GCAATCCGCTACTTCGTTAGCGAGGGCTTCGAGTTCTTCTGCGCCCAGAGCTTCAGCAAGAACTTCGGCCTGTACAACGA

P14：80mer

CTCAGCACTTGTAAGATGCTTTCCGGTTCTTTGCCCACAACGGTCAGGTTGCCCACGCGCTCGTTGTACAGGCCGAAGTT

P15：80mer

AGCATCTTACAAGTGCTGAGTCAGATGGAGAAGATCGTGCGCATCACCTGGAGCAACCCGCCGGCCCAAGGTGCACGTAT

P16：80mer

GTCTTCACGTTGCCTGTCCACTCCTCGAACAGCTCCGGATTACTCAGGGTGCTTGCCACAATACGTGCACCTTGGGCCGG

P17：80mer

TGGACAGGCAACGTGAAGACCATGGCCGACCGCATTCTGACAATGCGTAGTGAGCTGCGTGCCCGTTTAGAGGCCTTAAA

P18：80mer

AGGCCGGTGAAGCTGAACATGCCGATCTGATCGGTGATGTGGTTCCATGTGCCCGGGGTTTTTAAGGCCTCTAAACGGGC

P19：80mer

ATGTTCAGCTTCACCGGCCTGAACCCTAAGCAAGTGGAGTATCTGGTGAACGAGAAGCACATCTACCTGTTACCGAGCGG

P20：80mer

TGGATACTGGTGGCCACGTAGTCCAGATTCTTGGTGGTCAGACCACTCACGTTGATACGGCCGCTCGGTAACAGGTAGAT

P21：40mer

TACGTGGCCACCAGTATCCATGAGGCCGTGACCAAGATCC

P22：28mer

CTCGAGCTGGATCTTGGTCACGGCCTCA

2) utilize PCR to carry out the cAST gene amplification of people source, in 100uL reaction system, the addition of P2 ~ P21 totally 20 primers is 3ng, and Outside primer P1 and P22 addition are 32ng, and amplification condition is: 95 DEG C of preheating 5min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 10min, the Taq archaeal dna polymerase of use is TaKaRaEx Taq enzyme (TAKARA company, Japan), totally 30 circulations;

(3) the people source cAST gene after synthesis is inserted in Pet22b+ expression vector, and is transformed into express in bacterium Rosetta (DE3) and expresses;

(4) with the Rosetta bacterial strain containing people cAST gene that LB culture medium culturing step (3) obtains, 37 DEG C of long bacterium, adding final concentration when OD 0.6 ~ 0.8 is 0.1mmol/L IPTG (isopropylthiogalactoside), and after 25 DEG C of induction 6h, centrifugal (6000rmp effect is centrifugal) collects thalline;

(5) thalline is resuspended in protein extract buffer that (protein extract buffer is 0.05mol/L potassiumphosphate, pH7.5,0.5mol/L sodium-chlor, 0.015mol/L imidazoles), (300w, 30s are ultrasonic in ultrasonication, 15s suspends, continue 30min) and centrifugal after, collect supernatant liquor, obtain people cAST protein crude extract;

(6) with the protein extract buffer balance nickel affinity column of step (5), afterwards people cAST is slightly put on the upper above-mentioned nickel post absorption of clear liquid (people cAST protein crude extract), wash-out is carried out with 300mM imidazole solution after terminating, the elutriant collected is through 0.05mol/L, after pH7.5 potassium phosphate buffer 2 ~ 8 DEG C dialysis 24h, people cAST albumen sterling can be obtained;

(7) get the people cAST sterling 3mg that step (6) obtains, adopt the adult sheep of subcutaneous multi-point injection method immunity, every 2 weeks once, altogether immunity 5 times; First immunisation adds the Freund's complete adjuvant with antigen equivalent, adds the Freund's incomplete adjuvant with antigen equivalent for 4 times afterwards, takes a blood sample after final immunization 10d, separation of serum;

(8) the saturated ammonium sulphate solution precipitation of the goat-anti people cAST serum 35% step (7) obtained, the precipitation buffer A collected dissolves, and obtains the crude extract of goat-anti people cAST antibody;

(9) cAST antigen affinity column is balanced with buffer A, then the crude extract upper prop absorption that step (8) is obtained, terminate rear buffer B and carry out wash-out, and collect elutriant;

(10) elutriant step (9) collected loads in dialysis tubing also uses buffer A dialysis 12 ~ 24h, can obtain goat-anti people cAST antibody sterling;

(11) the goat-anti people cAST antibody obtained adopts Elisa method to measure it and tires, and utilize people mAST antigen in contrast, the above-mentioned goat-anti people cAST antibody titer prepared is greater than 1:60000 after testing, and control group is then without color reaction simultaneously; Confirmation obtains goat-anti people cAST antibody and people source of the present invention cAST polyclonal antibody.

Described buffer A is the sodium phosphate buffer of 0.05mol/L, pH 7.5.

Described buffer B is the glycine-HCI damping fluid of 0.05mol/L, pH2.0 ~ 4.0.

Described cAST antigen affinity column is that cAST is cross-linked CNBr-activated Sepharose 4fast Flow.

Described people mAST antigen to refer to by genetic engineering means by people mAST gene clone in pet22b+ expression vector, and is converted into and realizes correction in Rosetta bacterial strain and obtain.

People source cAST polyclonal antibody the present invention prepared is applied in following test kit, comprises reagent 1 and reagent 2, wherein:

Reagent 1:

Reagent 2:

Below the specific performance of embodiment of the present invention gained reagent is described.

Mentioned reagent is placed on automatic clinical chemistry analyzer, location parameter is set in accordance with the following methods: temperature of reaction 37 DEG C, test predominant wavelength 340nm, test commplementary wave length 405nm, tested sample/blank with reagents ratio is: sample/contrast: reagent 1: reagent 2=18uL:240uL:60uL, reacts for falling reaction.Testing method is: sample/contrast first mixes with reagent 1 hatches 5min, add reagent 2 afterwards, reading is started after in 1.5min, and under mensuration wavelength, monitor the change of sample absorbancy in 3min continuously, calculate the absorbancy changing value △ A/min of average minute clock, and according to following formulae discovery mAST activity value: mAST activity (U/L)=(△ A _measure/ min-△ A _blank/ min) × F (2840.3).

Get people source cAST and mAST after purifying, the activity both measuring by mentioned reagent (mAST kit) and method; Meanwhile, utilize Detection reagent for aspartate aminotransferase box (tAST kit, purchased from Ningbo Meikang Biotechnology Co., Ltd.) to measure both activities with in contrast, acquired results is as shown in table 1.

Table 1 mAST detection kit atopic energy

As can be seen from table 1 result, mAST test kit to mAST pure enzyme unrestraint ability, and reaches more than 93% to the rejection ability of the pure enzyme of cAST, shows that the present invention prepares the antibody response specificity of gained high, meets test kit and prepare requirement.

The above embodiment of the present invention can not be used for limiting the present invention to explanation of the present invention, and any change in the implication suitable with claims of the present invention and scope, all should think to be included in the scope of claims.

Claims (10)

1. a preparation method for the polyclonal antibody of people source aspartic transaminase kytoplasm isozyme, is characterized in that: preparation process comprises:

(1) obtain the complete genome sequence of people cAST from the GENEBANK of NCBI, through codon optimized and synthesize introduce the nucleotide sequence of 6 ~ 30bp at two ends after, the people cAST gene order after synthesis is the nucleotide sequence shown in SEQ ID NO.1;

(2) the people source cAST gene after synthesis is inserted in expression vector, and is transformed in host cell and expresses;

(3) culturing step (2) obtain containing the host cell of goal gene, obtain people source cAST albumen, and after affinity purification, must this albumen sterling;

(4) get people source cAST albumen sterling 1 ~ 10mg that step (3) obtains, adopt the adult sheep of subcutaneous multi-point injection method immunity, every 2 weeks once, altogether immunity 5 times; First immunisation adds the Freund's complete adjuvant with antigen equivalent, adds the Freund's incomplete adjuvant with antigen equivalent for 4 times afterwards, final immunization 10d (my god) take a blood sample afterwards, separation of serum;

(5) goat-anti people cAST serum mass percent step (4) obtained is the saturated ammonium sulphate solution precipitation of 33% ~ 50%, and the precipitation bufferA collected dissolves, and obtains the crude extract of goat-anti people cAST antibody;

(6) cAST antigen affinity column is balanced with bufferA, then the crude extract upper prop absorption that step (5) is obtained, terminate rear buffer B and carry out wash-out, and collect elutriant;

(7) elutriant step (6) collected to load in dialysis tubing and to dialyse 12 ~ 24h with bufferA, can obtain goat-anti people cAST antibody sterling and people source cAST polyclonal antibody.

2. the preparation method of the polyclonal antibody of people source according to claim 1 aspartic transaminase kytoplasm isozyme, it is characterized in that: preparation process also comprises and adopts Elisa method to measure it goat-anti people cAST antibody sterling of acquisition to tire, utilize people mAST antigen in contrast simultaneously, the above-mentioned goat-anti people cAST antibody titer prepared is greater than 1:60000 after testing, and control group is then without color reaction.

3. the preparation method of the polyclonal antibody of people source according to claim 2 aspartic transaminase kytoplasm isozyme, is characterized in that: the expression vector described in step (2) is prokaryotic expression carrier.

4. the preparation method of the polyclonal antibody of people source according to claim 3 aspartic transaminase kytoplasm isozyme, is characterized in that: described prokaryotic expression carrier is PET22b+.

5. the preparation method of the polyclonal antibody of people source according to claim 2 aspartic transaminase kytoplasm isozyme, is characterized in that: the host cell described in step (3) is prokaryotic host cell.

6. the preparation method of the polyclonal antibody of people source according to claim 5 aspartic transaminase kytoplasm isozyme, is characterized in that: described host cell is Rosetta (DE3).

7. the preparation method of the polyclonal antibody of people source according to claim 2 aspartic transaminase kytoplasm isozyme, it is characterized in that: described bufferA is the one in the phosphate buffered saline buffer of 0.01 ~ 0.1mol/L, pH7.0 ~ 8.0, Tri(Hydroxymethyl) Amino Methane Hydrochloride damping fluid (Tris-Hcl), 4-hydroxyethyl piperazine ethanesulfonic acid damping fluid (Hepes).

8. the preparation method of the polyclonal antibody of people source according to claim 2 aspartic transaminase kytoplasm isozyme, it is characterized in that: described buffer B is the glycine-HCI damping fluid of 0.01 ~ 0.25mol/L, pH2.0 ~ 4.0, Trisodium Citrate-hydrochloride buffer; Or the one in the sodium carbonate-sodium hydrate buffer solution of 0.01 ~ 0.25mol/L, pH 10.0 ~ 12.5, Sodium Tetraborate-sodium hydrate buffer solution, Sodium phosphate dibasic-sodium hydrate buffer solution.

9. the preparation method of the polyclonal antibody of people source according to claim 2 aspartic transaminase kytoplasm isozyme, is characterized in that: described cAST antigen affinity column comprises cAST and is cross-linked one in NHS-activated Sepharose 4 fast Flow, CNBr-activated Sepharose 4 fast Flow or epoxy-activated sepharose 6B.

10. the preparation method of the polyclonal antibody of people source according to claim 2 aspartic transaminase kytoplasm isozyme, it is characterized in that: described people mAST antigen to refer to by genetic engineering means by people mAST gene clone in protokaryon or carrier for expression of eukaryon, and be converted in Host Strains and realize correction and obtain.