CN104357579B - Method and kit for screening breeding oxen with excellent seminal fluid quality in early stage - Google Patents
Method and kit for screening breeding oxen with excellent seminal fluid quality in early stage Download PDFInfo
- Publication number
- CN104357579B CN104357579B CN201410748811.XA CN201410748811A CN104357579B CN 104357579 B CN104357579 B CN 104357579B CN 201410748811 A CN201410748811 A CN 201410748811A CN 104357579 B CN104357579 B CN 104357579B
- Authority
- CN
- China
- Prior art keywords
- breeding oxen
- semen quality
- primer
- gene
- test kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for screening breeding oxen with excellent seminal fluid quality in an early stage. The method comprises the following steps: extracting a genomic DNA of a breeding ox and determining the SNP site g.478 A>G of a PRM2 gene of the ox; and predicting the seminal fluid quality of the breeding ox according to the allele of 478th basic group of the ox, wherein when the SNP site g.478A A>G of the PRM2 gene of the ox is a GG genotype, the seminal fluid quality of the breeding ox is the best; and when the SNP site g.478 A>G of the PRM2 gene of the ox is an AA genotype, the seminal fluid quality of the breeding ox is the worst. In addition, due to the SNP site g.478 A>G of the PRM2 gene, the amino acid sequence changes and the amino acid at the site is changed from arginine (R) to glycine (G). The invention further provides a primer for screening breeding oxen with excellent seminal fluid quality in the early stage as well as a detection kit containing the primer. According to the invention, the correlation between the SNP site of the PRM2 gene of the ox and the seminal fluid quality of the ox is illuminated for the first time, so that the blindness of breeding oxen feeding is reduced, the cost is lowered and the economic benefit is increased.
Description
Technical field
The present invention relates to a kind of method of the excellent semen quality breeding oxen of early screening and its test kit are and in particular to one kind
The prm2 gene snp site of early screening excellent semen quality breeding oxen, application process and test kit, belong to livestock reproduction breeding
Technical field of molecular biology.
Background technology
Dairy level of development is the important symbol of a national animal husbandry development level height.Accelerate the improvement of milch cow population
It is the Important Action promoting milch cow career development.With becoming increasingly popular of artificial insemination and frozen semen, in modern milch cow colony
In improvement system, breeding oxen is the principal element of impact milk cows hereditary quality.And the good and bad directly shadow of bull semen quality
Ring the reproductive efficiency of cows.The volume of semen of bull, fresh essence vigor, jelly essence solution Frozen semen activity, fresh precision and rate of teratosperm are
The internationally recognized important indicator weighing bull semen quality.The semen quality of bull is important economic characters, is also multiple
Miscellaneous quantitative trait, while being controlled by minor-polygene, is also controlled by one or several major genes, therefore, Screening and Identification
The impact major gene of bull semen quality trait simultaneously illustrates it to the regulating and controlling effect of sperm development and mechanism of action, excellent for screening
The bull of good semen quality has great importance.By marker assisted selection (marker assisted selected, mas)
Breeding, can provide reference for cultivating the high-quality breeding oxen of excellent semen quality.
Protamine (proteomics, prms) is main nucleoprotein in spermatid, is present in sperm head, to sperm
Phenotypic differentiation plays important genetic regulation effect, and the correct parcel to sperm dna and the maintenance of sperm normal function are to closing weight
Will.Research finds, mice prm expression deficiency can lead to chromosomal abnormality parcel and male sterility.Show that prm gene can conduct
Candidate gene is used for selecting the quality of male animal semen quality.But the prm2 gene not still being directed at present breeding oxen studied with
Screening has the report of the breeding oxen of excellent semen quality.
Content of the invention
For above-mentioned prior art, it is an object of the invention to provide a kind of application bull prm2 gene snp molecular marker sieve
Select the good and bad method of semen quality.
It is another object of the present invention to by the relation of this molecular marker and bull semen quality, and then provide a kind of new
Screening high-quality semen quality breeding oxen test kit, early screening can be carried out to the breeding oxen of excellent semen quality.
For achieving the above object, the present invention adopts the following technical scheme that
A kind of snp site for early screening excellent semen quality breeding oxen, g.478a described snp site is > g, position
In bull prm2 gene the 478th bit base, bull prm2 gene the 478th is a allele.The numbering of nucleotide position is based on
Genbank call number: genbank accession no nc_007326.5 (11051633-11052382), start codon
Atg conduct+1.
The functional molecular marker g.478 a > g of new bull prm2 gene proposed by the present invention, is to detect bull certainly
In genbank accession no nc_007326.5 (11051633-11052382, start codon atg as+1)
478 deoxyribonucleotides are a or g, and differentiate breeding oxen in this site using molecular biology correlation technique
Genotype.Show that this snp is had with bull semen quality trait using the association analysiss of this snp and bull semen quality trait
Close, select favourable gg genotype individuals to reserve seed for planting.
The snp site of this breeding oxen can apply to prepare the test kit of screening bull semen quality.
A kind of good and bad method of application bull prm2 gene snp molecular marker early screening semen quality, extracts breeding oxen
Genome dna, measures bull prm2 gene snp site g.478 a > g, according to the allele prediction of breeding oxen the 478th base
The semen quality of breeding oxen: when breeding oxen prm2 gene snp site g.478 a > g is gg genotype, bull semen quality
Best；When breeding oxen prm2 gene snp site g.478 a > g is aa genotype, bull semen quality is worst.
A kind of primer for early screening excellent semen quality breeding oxen, has as sequence table seq id no.2 and seq
Base sequence shown in id no.3；Described primer can go out the sequence shown in seq id no.1 containing prm2 gene with specific amplification
Row.
A kind of test kit of the excellent semen quality breeding oxen of early screening, this test kit contains and can go out contain with specific amplification
The primer sequence of prm2 gene.
Described test kit also includes pcr reactant liquor and restricted enzyme；Described pcr reactant liquor is taq pcr
Mastermix, described restricted enzyme is psti.This restricted enzyme psti restriction enzyme site is the side by artificial creation
Method obtains, new generation after the 474th site a is changed into c.
Specifically, for the test kit of early screening breeding oxen motility of sperm height, it is 100 cattle detection dosage, reagent
The storage temperature of box is -20 DEG C, and the composition of test kit is as follows:
The forward primer 20 μ l of 100 μm of ol/l；
The downstream primer 20 μ l of 100 μm of ol/l；
2×taq pcr mastermix 1ml；
ddh2o 1.2ml；
Described upstream primer sequence is the base sequence shown in seq id no.2 in sequence table；
Described downstream primer sequence is the base sequence shown in seq id no.3 in sequence table；
Also include snp site g.478 a > g in prm2 gene in described test kit and pass through Created Restriction Site method the (the 474th
Site a is changed into restricted enzyme psti c) producing.
Present invention also offers a kind of prm2 gene snp site g.478 a > g screens classifying method, comprise the following steps:
(1) collection breeding oxen blood or seminal fluid, using high salt method blood or seminal fluid genome dna, dna sample is dilute
It is interpreted into 50ng/ μ l, standby；
(2) whether there is following single nucleotide polymorphism: g.478 a > g, wherein, nucleotide position in detection amplified production
Numbering is based on genbank call number: genbank accession no nc_007326.5 (11051633-11052382), rises
Beginning codon atg conduct+1).
(3) it is directed to 478 base mononucleotide polymorphic site a/g, design bull prm2 gene-specific primer, carry out pcr
Reaction, obtains the amplified production 1 of specific fragment (as shown in sequence table seq id no:1)；Described gene-specific primer tool
Just like the sequence shown in sequence table seq id no:2 and sequence table seq id no:3, described amplified production length is 241bp.
(4) polymorphism of the psti mononucleotide polymorphic site a/g of detection amplified production 1: restriction endonuclease
Amplified production 1 described in psti enzyme action, if obtaining 216bp and 25bp fragment, its genotype is aa homozygote；If obtain 241bp,
During tri- endonuclease bamhis of 216bp and 25bp, its genotype is ag heterozygote；If obtaining 241bp fragment, its genotype is gg homozygosis
Body.(wherein 25bp fragment fails to display in agarose gel)
Beneficial effects of the present invention:
(1) present invention identifies 1 mutational site for 478 in bull prm2 gene, through international genome database and literary composition
Offer patent retrieval it was demonstrated that being new snp site.
(2) through by semen quality individual for g.478 a > g and 500, above-mentioned snp site Chinese Holstein breeding oxen
Shape carries out correlation analysiss, and the bull semen quality trait of gg genotype individuals is higher than other genotype individuals, therefore permissible
For the early screening of breeding oxen, thus lowering feeding cost, increase value-added content of product.
(3) the snp site g.478 a > g of bull prm2 gene, leads to aminoacid sequence to change, this site amino acids
Glycine is changed into from arginine.
(4) present invention also offers a kind of new application test kit, using the 478th snp position of bull prm2 gene
Point screens to the height of breeding oxen motility of sperm, can be used for the early detection of breeding oxen, improves detection efficiency, reduces
Testing cost, reduces the blindness that breeding oxen is raised.
Brief description
Fig. 1 bull prm2 gene snp site g.478 a > g amplified production is through psti enzyme action result；
Fig. 2 bull prm2 gene snp site g.478 a > g aminoacid result of variations, this mutation leads to the smart ammonia of original encoding
Acid mutation is glycine.
Specific embodiment
The present invention is further illustrated in conjunction with the embodiments it should explanation, and the description below is merely to explain this
Invention, is not defined to its content.
The experimental technique of unreceipted actual conditions in the following example, generally according to normal condition, such as sambrook et al.,
Molecular cloning: described in laboratory manual (new york:cold spring harbor laboratory press, 1989)
Condition or according to the condition proposed by manufacturer.
Embodiment 1: the determination in mutational site
The present invention carries out examination using pcr sequencing and pcr-rflp technology to milch cow prm2 gene mutation, by enzyme action electricity
Swimming band and sequencing result compare it is determined that the 478th mutational site.
1.1 collection bull semens
Bull semen used in the present invention take from Beijing Milk Cow Center, Guangming Hesitan Livestocks Co., Ltd. Shanghai,
Shandong AUX Breeding bull station etc., according to high salt method seminal fluid genome dna, it is standby that dna sample is diluted into 50ng/ μ l.
Experiment cattle totally 500.
1.2 design of primers
The gene order of the prm2 being nc_007326.5 (11051633-11052382) according to the genbank number of logging in, uses
Primer premier5.0 software Design primers, with bull semen dna as template, the coding region of amplification prm2 gene.Designed
The sequence of primer is as follows
F:gatgaggaggaggaggaggagctgc (as shown in seq id no.2 in sequence table)
R:cccgtggggaacagaagcta (as shown in seq id no.3 in sequence table)
1.3pcr amplification
The reaction system of 25 μ l: template (50ng/ μ l) 1 μ l, 10 μm of ol/l upstream and downstream primers each 1 μ l, 2 × taq pcr
Mastermix 12.5 μ l, ddh2o 4.5μl.
Pcr reaction condition: 94 DEG C of degeneration 5min, 94 DEG C of degeneration 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 14s, 35 are followed
Ring；72 DEG C of extension 10min, 4 DEG C of preservations.
The detection of 1.4snp and typing
After pcr product is purified, carries out the interpretation of sequence with abi 3730 dna sequenator and snp confirms.By creating
Restriction enzyme site method (the 474th site a is changed into c), the a/g mutation in 478 sites produces psti mononucleotide polymorphic.Endonuclease reaction system
For: pcr amplified production 5 μ l；10×fastdigest buffer 2μl；Fastdigest restriction enzyme psti 1 μ l；ddh2o 12
μ l, endonuclease reaction condition is: 37 DEG C of digestion 30min.The psti mononucleotide polymorphic in 478 sites finds 3 kinds of genotype, respectively
Aa (216bp+25bp) type, ag (241bp+216bp+25bp) type and gg (241bp) type.
Using 3.5% agarose gel electrophoresiies detection, carry out gene type with the detection of uvp gel imaging system, according to
Band that agarose gel electrophoresiies obtain distinguishes different genotype, and result is as shown in figure 1, the polymorphic implementations of site of analysis
(wherein 25bp fragment is less, does not show in agarose gel).
Embodiment 2prm2 gene snp molecular marker g.478 a > g and the correlation analysiss of bull semen quality trait
Test bull be respectively provided with complete semen quality testing result, Testing index includes: fresh essence vigor, fresh precision,
Frozen semen activity and rate of teratosperm etc..
Using sas 9.0 statistical software, call glm program, with least square fitting linear model, compare bull base
Dependency because of type and seminal fluid character (fresh precision, fresh essence vigor, Frozen semen activity).Its model is:
yijk=μ+gi+yj+hk+eijk
yijkObserved value for the various character of bull sperm；μ is community average；gi: the fixed effect of genotype；hk: field
Secondary fixed effect；yj: the fixed effect in season；eijk: random residual effect.
Snp site g.478 a > the g different genotype of prm2 gene is associated analyzing with bull semen quality trait,
The results are shown in Table 1, result shows: the fresh essence vigor of g.478 a > g site aa genotype individuals, Frozen semen activity and fresh precision are notable
Less than gg and ag (p ＜ 0.05), gg genotype abnormal rate is substantially less than aa and ag (p ＜ 0.05), and gg genotype is semen quality
Superior genotypes.
The least square average of semen quality of table 1prm2 gene different genotype and standard error
Note: between the meansigma methodss of different lower cases, difference is extremely notable (p ＜ 0.05).
As shown in Table 1, the breeding oxen individuality semen quality character with prm2 gene gg genotype is significantly higher than and has it
The individuality (p ＜ 0.05) of his genotype.This has potential using value in breeding oxen selection-breeding and breed improvement.By to kind
Bull prm2 gene g.478 a > g site carries out genetic typing, if finding, certain individuality carries gg genotype, this individuality with take
Individuality with other genotype is compared and is expected to have more excellent semen quality character.Accordingly, breeder can instruct the morning of cattle
Phase screens, thus reducing feeding cost, increases value-added content of product.It can be seen that, bull prm2 gene molecule marker is in the mark of bull
There is important application prospect in note auxiliary seed selection and apolegamy.
Embodiment 3 detection kit
Based on the test kit of prm2 gene snp molecular marker screening breeding oxen, as described in Example 1, in nc_007326.5
G.478 a > g mutation closely related with the semen quality character of breeding oxen.Therefore, prm2 can be designed based on this snp site
Gene-specific primer is expanded and is detected.
Prepare the test kit (100 times) for the good and bad detection of bull semen quality trait, further elements are as shown in table 2:
Table 2 detection kit forms
Collection breeding oxen blood or seminal fluid, extract total dna, are reacted by embodiment 1 methods described.By in test kit
Pcr primer is diluted to 10 μm of ol/l, carries out pcr reaction for template with above-mentioned test kit with the dna being extracted.Pcr reaction condition:
94 DEG C of degeneration 5min, 94 DEG C of degeneration 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 14s, 35 circulations；72 DEG C of extension 10min, 4 DEG C of guarantors
Deposit.The reaction system of 25 μ l: template (50ng/ μ l) 1 μ l, 10 μm of ol/l upstream and downstream primers each 1 μ l, 2 × taq pcr
Mastermix 12.5 μ l, ddh2o 4.5μl.
Carry out enzyme action typing by embodiment 1 methods described to pcr amplified production to confirm.Pcr amplified production 5 μ l；10
×fastdigest buffer 2μl；Fastdigest restriction enzyme psti 1 μ l；ddh2o 12μl.Endonuclease reaction condition is: 37
DEG C digestion 30min.The psti mononucleotide polymorphic in 478 sites finds 3 kinds of genotype, respectively aa (216bp+25bp)
Type, ag (241bp+216bp+25bp) type and gg (241bp) type.Using 3.5% agarose gel electrophoresiies detection, coagulated with uvp
The detection of glue imaging system carries out gene type, distinguishes different genotype, analysis according to the band that agarose gel electrophoresiies obtain
The polymorphic implementations (wherein 25bp fragment is less, does not show in agarose gel) in site.Further press and surveyed kind of public affairs
The genotype of cattle, finally judges that the semen quality character of surveyed breeding oxen is good and bad, determines whether to reserve seed for planting.
The labeling method being provided according to the present invention, if direct Sequencing can also detect the 478th in nc_007326.5
A → g is mutated.But by the high cost of direct Sequencing, operation is partial to complexity, is only suitable for the detection of small lot sample.This enforcement
The test kit that example is invented then can be very good to solve this problem.
The present invention has an illustration of practicality:
1) detection method of the prm2 gene pleiomorphism of the present invention can be used on the prm2 gene of analysis No. 25 chromosomes of cattle
1 snp site, be applied to the early diagnosiss of bull semen quality, be beneficial to cultivate prolificacy breeding oxen.
2) nucleotide sequence of the detection prm2 gene pleiomorphism that the present invention sets up is related with bull semen quality
Site, can high sensitivity, be specifically applied to bull semen quality trait related gene diagnosis test kit.
As mentioned above it was therefore concluded that, the polymorphism of prm2 gene snp site g.478 a > g is excellent with bull semen quality
Bad tool significant correlation.Therefore, according to the present invention, measure this polymorphism and can be used for carrying out gene diagnosises.
Invention describes the related new mutation site of prm2 gene bull semen quality, and provide a kind of survey
The method determining prm2 gene pleiomorphism.And, according to the present invention it is only necessary to a small amount of dna sample is just many enough to measure prm2 gene
State property.As a result, the invention provides a kind of measure bull semen quality correlation snp molecular marker gene diagnosises side
Method.
Although the above-mentioned accompanying drawing that combines is described to the specific embodiment of the present invention, not model is protected to the present invention
The restriction enclosed, one of ordinary skill in the art should be understood that on the basis of technical scheme, and those skilled in the art are not
Need to pay the various modifications that creative work can make or deformation still within protection scope of the present invention.
Claims (6)
1. a kind of primer for early screening excellent semen quality breeding oxen is it is characterised in that the sequence of primer is sequence table
Base sequence shown in seq id no.2 and seq id no.3, described primer is directed to cattle prm2 gene the 478th base monokaryon glycosides
Sour polymorphic site a/g design, can go out the sequence shown in seq id no.1 containing prm2 gene with specific amplification.
2. a kind of test kit for early screening bull semen quality is it is characterised in that contain in described test kit
The primer for early screening excellent semen quality breeding oxen described in claim 1.
3. as claimed in claim 2 a kind of test kit for early screening bull semen quality it is characterised in that
Described test kit also includes pcr reactant liquor and restricted enzyme；Described pcr reactant liquor is taq pcr mastermix, described
Restricted enzyme is restricted enzyme psti.
4. as claimed in claim 2 a kind of test kit for early screening bull semen quality it is characterised in that
Described test kit is that 100 cattle detect dosage, and the composition of test kit is as follows:
The forward primer 20 μ l of 100 μm of ol/l；
The downstream primer 20 μ l of 100 μm of ol/l；
2×taq pcr mastermix 1ml；
ddh2o 1.2ml；
Described upstream primer sequence is the base sequence shown in seq id no.2 in sequence table；
Described downstream primer sequence is the base sequence shown in seq id no.3 in sequence table.
5. as claimed in claim 4 a kind of test kit for early screening bull semen quality it is characterised in that
Snp site in prm2 gene is also included g.478a in described test kit > restriction enzyme that produced by Created Restriction Site method of g
Enzyme psti.
6. the method for the excellent semen quality breeding oxen of a kind of early screening, it is not used in the diagnosis of disease and treatment, and its feature exists
In, extraction breeding oxen genome dna, measure bull prm2 gene snp site g.478a > g, according to breeding oxen the 478th base
Allele predicts the semen quality of breeding oxen: when breeding oxen prm2 gene snp site g.478a > g be gg genotype when, plant public
Cattle semen quality is best；When breeding oxen prm2 gene snp site g.478a > g be aa genotype when, bull semen quality is
Difference；
Determine concretely comprising the following steps of breeding oxen the 478th bit base genotype:
(1) extract breeding oxen genome dna, dna sample is diluted into 50ng/ μ l, standby；
(2) whether there is following single nucleotide polymorphism: g.478a > g in detection amplified production；
(3) it is directed to 478 base mononucleotide polymorphic site a/g, design bull prm2 gene-specific primer, carry out pcr reaction,
The sequence of amplified production is as shown in sequence table seq id no:1；Described gene-specific primer has as sequence table seq id
Sequence shown in no:2 and seq id no:3, described amplified production length is 241bp；
(4) polymorphism of the psti mononucleotide polymorphic site a/g of detection amplified production: restriction endonuclease psti enzyme action
Described amplified production, if obtaining 216bp and 25bp fragment, its genotype is aa homozygote；If obtaining 241bp, 216bp and 25bp
During three endonuclease bamhis, its genotype is ag heterozygote；If obtaining 241bp fragment, its genotype is gg homozygote.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410748811.XA CN104357579B (en) | 2014-12-09 | 2014-12-09 | Method and kit for screening breeding oxen with excellent seminal fluid quality in early stage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410748811.XA CN104357579B (en) | 2014-12-09 | 2014-12-09 | Method and kit for screening breeding oxen with excellent seminal fluid quality in early stage |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104357579A CN104357579A (en) | 2015-02-18 |
| CN104357579B true CN104357579B (en) | 2017-01-18 |
Family
ID=52524885
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410748811.XA Expired - Fee Related CN104357579B (en) | 2014-12-09 | 2014-12-09 | Method and kit for screening breeding oxen with excellent seminal fluid quality in early stage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104357579B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104152575B (en) * | 2014-08-29 | 2016-01-06 | 山东省农业科学院奶牛研究中心 | For screening the HIBADH gene SNP site of breeding oxen motility of sperm, method and test kit |
-
2014
- 2014-12-09 CN CN201410748811.XA patent/CN104357579B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104357579A (en) | 2015-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108410994B (en) | SNP marker influencing Hu sheep lambing traits and application thereof | |
| CN110029178A (en) | SNP marker relevant to the more lamb characters of sheep list tire and its detection primer group, detection kit and application | |
| CN110004236B (en) | SNP molecular marker related to sheep multi-lamb traits and primer group, kit and application for detecting ESR1 genotyping | |
| CN104099330B (en) | Sheep lambing number trait related molecular marker and application thereof | |
| CN107779516B (en) | It is a kind of influence pig birth weight character SNP marker and its application | |
| CN111996262B (en) | Method for obtaining SNP (Single nucleotide polymorphism) related to milk production traits of dairy buffalo and application of SNP | |
| CN109337987A (en) | Molecular labeling relevant to Nubia goat yeaning traits and combinations thereof application | |
| EP3882360B1 (en) | Genomic selection method of huaxi cattle | |
| CN108103208A (en) | A kind of SNP marker for influencing sheep Fecundity Trait and its application | |
| CN105087820A (en) | FSHR (follicle stimulating hormone receptor) gene based molecular marker related to porcine reproduction traits as well as detection method and application of molecular marker | |
| Shin et al. | Genome-association analysis of Korean Holstein milk traits using genomic estimated breeding value | |
| CN112501311B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to pig nipple number character and application thereof | |
| CN108950008B (en) | Breeding method for analyzing multi-site aggregation effect for improving number of lambs born by Hu sheep | |
| CN103421771B (en) | Genetic marker for character of litter size of pig utilizing WIF1 gene | |
| CN105039567B (en) | One group for screen and the SNP marker of/detection breeding oxen ejaculation amount and fresh essence vigor height | |
| CN104357579B (en) | Method and kit for screening breeding oxen with excellent seminal fluid quality in early stage | |
| CN113817841B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to swine nipple number traits and application thereof | |
| CN112760387B (en) | SNP molecular marker related to total nipple number of pigs and application | |
| CN109439766B (en) | Application of ATG10 gene as bovine superovulation trait molecular marker | |
| CN104878005B (en) | Influence FAK gene molecule markers and its application of breeding oxen reproductive performance | |
| CN108707678A (en) | With the relevant PACSIN2 gene molecule markers of pig kind reproductive trait and application | |
| CN109207611A (en) | One kind SNP marker relevant to sheep heat character and its detection kit and application | |
| CN110257527A (en) | Genetic marker and application of the FLT1 gene pleiomorphism as pig number born character | |
| CN112592984B (en) | SNP molecular marker affecting swine nipple number character and application thereof | |
| CN113943821B (en) | Insertion deletion marker related to FGF7 gene and goat growth traits and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170118 Termination date: 20171209 |