CN104328221B - Identify or assist the primer pair composition and application thereof of identifying H6N1 subtype avian influenza virus - Google Patents
Identify or assist the primer pair composition and application thereof of identifying H6N1 subtype avian influenza virus Download PDFInfo
- Publication number
- CN104328221B CN104328221B CN201410652501.8A CN201410652501A CN104328221B CN 104328221 B CN104328221 B CN 104328221B CN 201410652501 A CN201410652501 A CN 201410652501A CN 104328221 B CN104328221 B CN 104328221B
- Authority
- CN
- China
- Prior art keywords
- primer pair
- hypotype
- avian influenza
- influenza virus
- subtype avian
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses and identify or assist the primer pair composition and application thereof identifying H6N1 subtype avian influenza virus.Qualification provided by the present invention or auxiliary identify that the primer pair composition of H6 hypotype and/or N1 subtype avian influenza virus is made up of the two of independent packaging primer pairs, are namely called that the PCR primer pair of H6 and name are called that the PCR primer pair of N1 forms by name；The described H6 two single stranded DNAs shown in SEQ ID No.1 in sequence table and SEQ ID No.2 form；The described N1 two single stranded DNAs shown in SEQ ID No.3 in sequence table and SEQ ID No.4 form.
Description
Technical field
The present invention relates to and biomedical sector is identified or assisted the primer pair composition and application thereof identifying H6N1 subtype avian influenza virus.
Background technology
Bird flu virus (AvianInfluenzaVirus, AIV) according to surface glycoprotein (Hemagglutinin, and neuraminidase (Neuraminidase HA), NA) antigenic specificity is divided into different hypotypes, 16 kinds of HA hypotypes (H1-H16) and 9 kinds of NA hypotypes (N1-N9) are had now been found that, the combination of HA and NA can produce at least 135 kinds of hypotypes, wherein, part combination (H5N1, H7N7 and H7N9 etc.) in H5 and H7 hypotype is called highly pathogenic AIV, can infect the mankind and lethal.Although low pathogenicity AIV infects the Non-typical symptoms gentle, slight without any symptom or performance, the health of poultry and the mankind do not had menace, but when the low pathogenicity AIV strain mixed infection poultry of different subtype, gene can be intercoursed in animal body, thus producing unpredictable pathogenic and communicable new variant, will be there is very big threat by this in birds and human health.
H6 hypotype AIV belongs to low pathogenicity AIV, but have been reported that the highly pathogenic H5N1 virus showing to infect people in Hong Kong outburst 1997, except HA gene, all the other 7 genetic fragments are all highly similar to A/teal/HongKong/W312/97 (H6N1) virus, and therefore H6 hypotype AIV is likely to become the genetic donor of highly pathogenic H5 hypotype AIV.In June, 2013, Taiwan is found that first case people infection type H6N1 hypotype AIV, is a kind of Lowly Pathogenic Avian Influenza Virus, and its HA gene is propped up interior evolution by Taiwan H6 hypotype AIV.
Anseriformes (duck, goose, swan) and shape order (shore bird bird, Larus ridibundus, tern, auk) are the AIV Major Natural hosts hidden, wherein particularly aquatic bird, it it is the storage vault of all hypotype AIV, and pollute water system through feces toxin expelling, by directly propagating or the north and south of migratory bird is migrated to disseminate virus further and come, infect other birds and mammal, therefore aquatic bird is considered as the important sources of the natural reservoirs of influenza virus and new strain, has important function in the genetic evolution and ecologicaI distribution of influenza virus.Low pathogenicity AIV hides in healthy duck group, breeds and toxin expelling, it is possible to caused the outburst of high pathogenic avian influenza, the safety of harm aviculture by gene rearrangement, is also likely to the Human avian flu virus evolved as breaking through species barrier, endangers human health.
Virus purification with identify it is classical influenza test method, namely first by sample inoculation SPF Embryo Gallus domesticus virus of proliferation 2-5 days, regather chick embryo allantoic liquid and carry out hemagglutination test and hemagglutination inhibition test, result accurately and reliably, but the shortcoming that there is detection cycle length.Elisa can detect the antigen of bird flu, but needs specific standard positive serum.RT-PCR, real-time fluorescence quantitative RT-PCR and ring mediated isothermal amplification equimolecular biological method are widely used in the detection of bird flu virus.
Summary of the invention
The technical problem to be solved is how to identify H6N1 subtype avian influenza virus, namely determines that whether HA hypotype is H6 hypotype and whether NA hypotype is N1 hypotype.
For solving above-mentioned technical problem, present invention firstly provides and identify or assist the primer pair composition identifying H6 hypotype and/or N1 subtype avian influenza virus.
Qualification provided by the present invention or auxiliary identify the primer pair composition of H6 hypotype and/or N1 subtype avian influenza virus, are made up of the two of independent packaging primer pairs, are namely called that the PCR primer pair of H6 and name are called that the PCR primer pair of N1 forms by name；
The described H6 two single stranded DNAs shown in SEQ ID No .1 and SEQIDNo.2 form；The described N1 two single stranded DNAs shown in SEQ ID No .3 and SEQIDNo.4 form.
Above-mentioned qualification or auxiliary identify that, in the primer pair composition of H6 hypotype and/or N1 subtype avian influenza virus, described compositions can identify or assist qualification H6N1 subtype avian influenza virus, H6 subtype avian influenza virus or N1 subtype avian influenza virus.
Above-mentioned qualification or auxiliary identify that in the primer pair composition of H6 hypotype and/or N1 subtype avian influenza virus, described H6 and described N1 all can independent packaging.
Wherein, described H6 can H6 subtype avian influenza virus be the DNA fragmentation that template carries out RT-PCR acquisition 447bp；Described N1 can N1 subtype avian influenza virus be the DNA fragmentation that template carries out RT-PCR acquisition 325bp.
Above-mentioned qualification or auxiliary identify that in the primer pair composition of H6 hypotype and/or N1 subtype avian influenza virus, described H6 and described N1 can be used alone and carries out independent RT-PCR respectively, it is also possible to combination use carries out duplex RT-PCR.
When both primer pairs are used alone, the application identifies or the proportioning not requirement of both primer pairs in the primer pair composition of auxiliary qualification H6 hypotype and/or N1 subtype avian influenza virus.When the combination of both primer pairs uses, the mol ratio of described H6 and described N1 is 2:1.
In the application, the mol ratio of two single stranded DNAs in every kind of primer pair is 1:1.
For solving above-mentioned technical problem, present invention also offers PCR primer pair.
PCR primer pair provided by the present invention, in order to identify or to assist the primer pair H6 identifying H6 subtype avian influenza virus or qualification or auxiliary to identify, the primer pair N1, described H6 of N1 subtype avian influenza virus two single stranded DNAs shown in SEQ ID No .1 and SEQIDNo.2 form；The described N1 two single stranded DNAs shown in SEQ ID No .3 and SEQIDNo.4 form.
For solving above-mentioned technical problem, present invention also offers and identify or assist the reagent or test kit identifying H6 hypotype and/or N1 subtype avian influenza virus.
It is provided by the present invention that to identify or assist the reagent identifying H6 hypotype and/or N1 subtype avian influenza virus or test kit be following R or S or T:
R, reagent containing described primer pair composition or test kit；
S, reagent containing described H6 or test kit；
T, reagent containing described N1 or test kit.
In mentioned reagent or test kit, described reagent or test kit also include reverse transcription.
In mentioned reagent or test kit, described reagent or test kit also include 2 × 1StepBuffer and PrimeScript1StepEnzymeMix.
In mentioned reagent or test kit, described R also includes recording following R1) and description R2):
R1) in same PCR reaction system, with the nucleic acid (RNA or DNA) of biological sample to be measured for template, select the annealing temperature of 50-57 DEG C, carry out pcr amplification by described primer pair composition and obtain PCR primer；
R2) detecting step R1) size of PCR primer that obtains, if the DNA fragmentation containing 447bp in described PCR primer, bird flu virus that described testing sample contains H6 hypotype or candidate contain the bird flu virus of H6 hypotype；If not containing the DNA fragmentation of 447bp in described PCR primer, described testing sample does not contain the bird flu virus of H6 hypotype or candidate does not contain the bird flu virus of H6 hypotype；If containing the DNA fragmentation of 325bp in described PCR primer, bird flu virus that described testing sample contains N1 hypotype or candidate contain the bird flu virus of N1 hypotype；If not containing the DNA fragmentation of 325bp in described PCR primer, described testing sample does not contain the bird flu virus of N1 hypotype or candidate does not contain the bird flu virus of N1 hypotype.
In mentioned reagent or test kit, R1) in RT-PCR system, every 25 μ LRT-PCR reaction systems contain: 2 × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L, single stranded DNA shown in SEQIDNo.1 and 3, single stranded DNA shown in SEQIDNo.2 and 4, concentration is the viral RNA to be measured 1 μ L of 10ng/ μ L, 25 μ L are supplied with the ultra-pure water without RNase, the final concentration making single stranded DNA shown in SEQIDNo.1 and 2 is 0.4 μM, makes the final concentration of single stranded DNA shown in SEQIDNo.3 and 4 be 0.2 μM.
The response procedures of described RT-PCR is as follows: 50 DEG C of 30min, 94 DEG C of 2min；94 DEG C of 30s, 50-57 DEG C of 30s, 72 DEG C of 30s, 30 circulations；72 DEG C of 10min.
In mentioned reagent or test kit, described 50-57 DEG C concretely 53 DEG C.
In mentioned reagent or test kit, described S also includes recording following S1) and description S2):
S1) in same PCR reaction system, with the nucleic acid (RNA or DNA) of biological sample to be measured for template, select the annealing temperature of 50-57 DEG C, carry out pcr amplification with described H6 and obtain PCR primer；
S2) detecting step S1) size of PCR primer that obtains, if the DNA fragmentation containing 447bp in described PCR primer, bird flu virus that described testing sample contains H6 hypotype or candidate contain the bird flu virus of H6 hypotype；If not containing the DNA fragmentation of 447bp in described PCR primer, described testing sample does not contain the bird flu virus of H6 hypotype or candidate does not contain the bird flu virus of H6 hypotype.
In mentioned reagent or test kit, S1) in RT-PCR system, every 25 μ LRT-PCR reaction systems contain: 2 × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L, single stranded DNA shown in SEQIDNo.1, single stranded DNA shown in SEQIDNo.2, concentration is the viral RNA to be measured 1 μ L of 10ng/ μ l, supply 25 μ L with the ultra-pure water without RNase, make the final concentration of single stranded DNA shown in SEQIDNo.1 and 2 be 0.4 μM.
The response procedures of described RT-PCR is as follows: 50 DEG C of 30min, 94 DEG C of 2min；94 DEG C of 30s, 50-57 DEG C of 30s, 72 DEG C of 30s, 30 circulations；72 DEG C of 10min.
In mentioned reagent or test kit, described 50-57 DEG C concretely 53 DEG C.
In mentioned reagent or test kit, described T also includes recording following T1) and description T2):
T1) in same PCR reaction system, with the nucleic acid (RNA or DNA) of biological sample to be measured for template, select the annealing temperature of 50-57 DEG C, carry out pcr amplification with described N1 and obtain PCR primer；
T2) detecting step T1) size of PCR primer that obtains, if the DNA fragmentation containing 325bp in described PCR primer, bird flu virus that described testing sample contains N1 hypotype or candidate contain the bird flu virus of N1 hypotype；If not containing the DNA fragmentation of 325bp in described PCR primer, described testing sample does not contain the bird flu virus of N1 hypotype or candidate does not contain the bird flu virus of N1 hypotype.
In mentioned reagent or test kit, T1) in RT-PCR system, every 25 μ LRT-PCR reaction systems contain: 2 × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L, single stranded DNA shown in SEQIDNo.3, single stranded DNA shown in SEQIDNo.4, concentration is the viral RNA to be measured 1 μ L of 10ng/ μ l, supply 25 μ L with the ultra-pure water without RNase, make the final concentration of single stranded DNA shown in SEQIDNo.3 and 4 be 0.2 μM.
The response procedures of described RT-PCR is as follows: 50 DEG C of 30min, 94 DEG C of 2min；94 DEG C of 30s, 50-57 DEG C of 30s, 72 DEG C of 30s, 30 circulations；72 DEG C of 10min.
In mentioned reagent or test kit, described 50-57 DEG C concretely 53 DEG C.
For solving above-mentioned technical problem, the preparation method that present invention also offers primer pair composition.
In the preparation method of primer pair composition provided by the present invention, described primer pair composition is above-mentioned primer pair composition；The preparation method of described primer pair composition includes the step individually packed by described two single stranded DNAs of primer pair each in described primer pair composition.
For solving above-mentioned technical problem, the preparation method that present invention also offers PCR primer pair.
In the preparation method of PCR primer pair provided by the present invention, described PCR primer pair is described H6 or described N1；The preparation method of described PCR primer pair includes the step individually packed by described two single stranded DNAs of described S or described T.
For solving above-mentioned technical problem, present invention also offers the preparation method identifying or assisting reagent or the test kit identifying H6 hypotype and/or N1 subtype avian influenza virus.
Qualification provided by the present invention or auxiliary are identified in H6 hypotype and/or the reagent of N1 subtype avian influenza virus or the preparation method of test kit, and described to identify or assist the reagent identifying H6 hypotype and/or N1 subtype avian influenza virus or test kit be above-mentioned R or S or T；Described qualification or auxiliary identify that H6 hypotype and/or the reagent of N1 subtype avian influenza virus or the preparation method of test kit include the step individually packed by described two single stranded DNAs of each primer pair.
2 × 1StepBuffer and PrimeScript1StepEnzymeMix in the application is in PrimeScriptOneStepRT-PCRKitVer.2 reagent, PrimeScriptOneStepRT-PCRKitVer.2 is precious biological engineering (Dalian) company limited product, and article No. is RR055A.
Experiment proves, by the primer pair composition of the present invention with the bird flu virus RNA of the H6N1 hypotype RT-PCR carried out for template, all can amplify and be sized to 447bp, the band of 325bp, by the primer pair composition of the present invention with the bird flu virus RNA of H6Nx (x ≠ 1) the hypotype RT-PCR carried out for template, the band being sized to 447bp can only be amplified, by the primer pair composition of the present invention with the bird flu virus RNA of HxN1 (x ≠ 6) the hypotype RT-PCR carried out for template, the band being sized to 325bp can only be amplified, by the primer pair composition of the present invention with HxNy (x ≠ 6, y ≠ 1) bird flu virus RNA or the RT-PCR that carries out for template of other virus, all can not amplify band, show that the primer pair composition of the present invention can be used to identify H6 hypotype and/or N1 subtype avian influenza virus.
H6N1 hypotype AIV is had higher sensitivity and specificity by the primer pair composition of the present invention: the primer pair composition of the present invention can detect the H6N1 hypotype AIV of 500 copy/25 μ L；The primer pair composition of the present invention can detect H6N1 subtype avian influenza virus, H6 subtype avian influenza virus and N1 subtype avian influenza virus simultaneously specifically.
Compare traditional virus isolation procedure, utilize the primer pair composition of the present invention to carry out the method that duplex RT-PCR identifies H6 hypotype and/or N1 subtype avian influenza virus, saved detectable, simplified response procedures, and result is consistent with Virus Isolation.Therefore, it is a kind of simplicity, fast and effectively detection technique that the primer pair composition utilizing the present invention carries out the method for duplex RT-PCR qualification H6 hypotype and/or N1 subtype avian influenza virus.
Accompanying drawing explanation
Fig. 1 is the sensitivity experiments result of the primer pair composition of the present invention.Wherein, swimming lane M is DL1000Marker, and swimming lane 1 is H6N1RNA final concentration of 5 × 106Copy/25 μ L, swimming lane 2 is H6N1RNA final concentration of 5 × 105Copy/25 μ L, swimming lane 3 is H6N1RNA final concentration of 5 × 104Copy/25 μ L, swimming lane 4 is H6N1RNA final concentration of 5 × 103Copy/25 μ L, swimming lane 5 is final concentration of 500 copy/25 μ L of H6N1RNA, and swimming lane 6 is final concentration of 50 copy/25 μ L of H6N1RNA, and swimming lane 7 is negative control.
Fig. 2 is the specificity experiments result of the primer pair composition of the present invention.Wherein, swimming lane M is DL1000Marker, swimming lane 1 is H6N1, swimming lane 2 is H6N1, swimming lane 3 is H6N2, swimming lane 4 is H6N2, swimming lane 5 is H6N5, swimming lane 6 is H6N6, swimming lane 7 is H6N8, swimming lane 8 is H1N1, swimming lane 9 is H2N3, swimming lane 10 is H3N2, swimming lane 11 is H4N5, swimming lane 12 is H5N1, swimming lane 13 is H7N2, swimming lane 14 is H8N4, swimming lane 15 is H9N2, swimming lane 16 is H10N3, swimming lane 17 is H11N9, swimming lane 18 is H12N5, swimming lane 19 is H13N5, swimming lane 20 is H15N8, swimming lane 21 is NDV, swimming lane 22 is IBV, swimming lane 23 is ILTV, swimming lane 24 is negative control.
Fig. 3 is the duplex RT-PCR result of the primer pair composition of the present invention and primer pair composition N.Wherein, swimming lane M is DL1000Marker；Swimming lane 1-5 is the duplex RT-PCR result of primer pair composition N, the final concentration of H6-N, H6-R is 0.2 μM, the final concentration of N1-N2 and N1-N3 is 0.6 μM, wherein the template of swimming lane 1 is H6N1RNA, the template of swimming lane 2 is H6N2RNA, the template of swimming lane 3 is H6N6RNA, and the template of swimming lane 4 is H5N1RNA, and swimming lane 5 is negative control；Swimming lane 6-10 is the duplex RT-PCR result of primer pair composition N, the final concentration of H6-N, H6-R is 0.2 μM, the final concentration of N1-N2 and N1-N3 is 0.4 μM, wherein the template of swimming lane 6 is H6N1RNA, the template of swimming lane 7 is H6N2RNA, the template of swimming lane 8 is H6N6RNA, and the template of swimming lane 9 is H5N1RNA, and swimming lane 10 is negative control；Swimming lane 11-15 is the duplex RT-PCR result of the primer pair composition of the present invention, and wherein the template of swimming lane 11 is H6N1RNA, and the template of swimming lane 12 is H6N2RNA, and the template of swimming lane 13 is H6N6RNA, and the template of swimming lane 14 is H5N1RNA, and swimming lane 15 is negative control.
Fig. 4 is the result of each primer pair substance RT-PCR.Wherein, swimming lane is DL1000Marker；Swimming lane 1 is the substance RT-PCR result of the primer pair being made up of H6-F and H6-R；Swimming lane 2 is the substance RT-PCR result of the primer pair being made up of H6-N and H6-R；Swimming lane 3 is the substance RT-PCR result of the primer pair being made up of N1-F and N1-R；Swimming lane 4 is the substance RT-PCR result of the primer pair being made up of N1-N1 and N1-R；Swimming lane 5 is the substance RT-PCR result of the primer pair being made up of N1-N2 and N1-N3.
Detailed description of the invention
Below in conjunction with detailed description of the invention, the present invention being further described in detail, the embodiment provided is only for illustrating the present invention, rather than in order to limit the scope of the present invention.
Experimental technique in following embodiment, if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, all commercially obtain.
MiniBESTViralRNA/DNAExtraction test kit (MiniBESTViralRNA/DNAExtractionKitVer.4.0) in following embodiment is precious biological engineering (Dalian) company limited product, and article No. is 9766.
2 × 1StepBuffer and PrimeScript1StepEnzymeMix in following embodiment is in PrimeScriptOneStepRT-PCRKitVer.2 reagent, PrimeScriptOneStepRT-PCRKitVer.2 is precious biological engineering (Dalian) company limited product, and article No. is RR055A.
H6N8 subtype avian influenza virus in following embodiment, H1N1 subtype avian influenza virus, H2N3 subtype avian influenza virus, H3N2 subtype avian influenza virus, H5N1 subtype avian influenza virus, H7N2 subtype avian influenza virus, H8N4 subtype avian influenza virus, H9N2 subtype avian influenza virus, H12N5 subtype avian influenza virus and H15N8 subtype avian influenza virus, Avian pneumo-encephalitis virus (NDV), avian infectious bronchitis virus (IBV), avian infectious laryngotracheitis virus (ILTV) (YiPeng.etal.VisualdetectionofH3subtypeavianinfluenzaviru sesbyreversetranscriptionloop-mediatedisothermalamplific ationassay.VirologyJournal, 2011, 8:337.) public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region (i.e. applicant), this biomaterial only attach most importance to duplicate invention related experiment used by, can not use as other purposes.
H6N1 subtype avian influenza virus in following embodiment, H6N2 subtype avian influenza virus, H6N5 subtype avian influenza virus and H6N6 subtype avian influenza virus (Zhou Chenyu, the research of H6 subtype avian influenza virus pathogenic surveillance and method for quick, Guangxi University's master's thesis in 2012,2012-06-01.) public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region (i.e. applicant), this biomaterial only attach most importance to duplicate invention related experiment used by, can not use as other purposes.
H4N5 subtype avian influenza virus in following embodiment, H10N3 subtype avian influenza virus and H11N9 subtype avian influenza virus (Luo Sisi, Xie Zhixun, Liu Jiabo, foundation [J] Deng .H7N9 hypotype AIV dual real-time fluorescence quantitative RT-PCR detecting method. animal medicine is in progress, 2013,34 (12): 1-5.) public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region (i.e. applicant), this biomaterial only attach most importance to duplicate invention related experiment used by, can not use as other purposes.
H13N5 subtype avian influenza virus (XieZ in following embodiment, PangYS, LiuJ, etal.AmultiplexRT-PCRfordetectionoftypeainfluenzavirusan ddifferentiationofavianH5, H7andH9hemagglutininsubtypes [J] .MolCellProbes, 2006,20 (3-4): 245-249.) public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region (i.e. applicant), this biomaterial only attach most importance to duplicate invention related experiment used by, can not use as other purposes.
PGEMT-easy carrier in following embodiment is Promega company (U.S.) product, and article No. is A3600.
Embodiment 1, preparation are identified or assist the primer pair composition identifying H6N1 subtype avian influenza virus
Identify or assist the primer pair composition identifying H6N1 subtype avian influenza virus (AIV), name being called that the PCR primer pair of H6 and name are called that the PCR primer pair of N1 forms；Described H6 single stranded DNA (H6-F) shown in SEQ ID No .1 and the single stranded DNA (H6-R) shown in SEQIDNo.2 form, and can amplify the band being sized to 447bp from the bird flu virus of H6 hypotype；Described N1 single stranded DNA (N1-F) shown in SEQ ID No .3 and the single stranded DNA (N1-R) shown in SEQIDNo.4 form, and can amplify the band being sized to 325bp from the bird flu virus of N1 hypotype.
Above-mentioned qualification or auxiliary are identified in the primer pair composition of H6N1 subtype avian influenza virus, described H6 and described N1 independent packaging.The mol ratio of two single stranded DNAs in every kind of primer pair is 1:1.
Embodiment 2, embodiment 1 identify or auxiliary identifies the sensitivity experiments of primer pair composition of H6N1 subtype avian influenza virus
According to MiniBESTViralRNA/DNAExtraction test kit description, obtain, from H6N1 subtype avian influenza virus extracting, the H6N1 subtype avian influenza virus total serum IgE (being called for short H6N1RNA) that concentration is 10ng/ μ l.
Use document HoffmannE respectively, StechJ, GuanY, etal.Universalprimersetforthefull-lengthamplificationofa llinfluenzaAviruses [J] .ArchVirol, 2001, HA and NA gene primer in 146:2275 2289, RT-PCR amplification is carried out for template with H6N1RNA, reaction system is as follows: 2 × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L, forward primer (25 μMs) the 0.5 μ L of HA or NA gene, downstream primer (25 μMs) the 0.5 μ L of HA or NA gene, H6N1RNA (10ng/ μ L) 1 μ L, 25 μ L are supplied with the ultra-pure water without RNase；Response procedures is as follows: 94 DEG C of 5min, 94 DEG C of 1min, 52 DEG C of 1.5min, 72 DEG C of 1.5min, 35 circulations, 72 DEG C of 8min, and 10 DEG C terminate reaction.RT-PCR amplification respectively obtains the HA genetic fragment of 1744bp and the NA genetic fragment of 1458bp after terminating, the two genetic fragment is respectively connecting on pGEMT-easy carrier, by the recombinant vector called after T-H6 of the correct sequence containing HA genetic fragment, it is T-N1 by the recombinant vector called after of the correct sequence containing NA genetic fragment.
Utilize restricted enzyme SpeI enzyme action recombinant vector T-H6, obtain linearisation T-H6, with RNA in vitro transcription test kit (Promega company of the U.S., article No. is P1280) transcription linear T-H6, and utilize RNA purification kit (precious biological engineering (Dalian) company limited product, article No. is 9767) purification transcription product, obtain the T-H6RNA of purification.
According to the method described above, T-H6 being replaced with T-N1, other steps are all constant, obtain the T-N1RNA of purification.
Utilize NanoDropND-1000 trace dna detector that T-H6RNA and T-N1RNA is carried out Concentration Testing, copy number is calculated according to molecular weight and nucleic acid concentration, undertaken T-H6RNA and T-N1RNA waiting copy number mixing, and be diluted, the concentration respectively obtaining T-H6RNA and T-N1RNA is 5 × 106The 5 × 10 of copy/μ L6Copy/μ LRNA, T-H6RNA and T-N1RNA concentration be 5 × 105The 5 × 10 of copy/μ L5Copy/μ LRNA, T-H6RNA and T-N1RNA concentration be 5 × 104The 5 × 10 of copy/μ L4Copy/μ LRNA, T-H6RNA and T-N1RNA concentration be 5 × 103The 5 × 10 of copy/μ L3Copy/μ LRNA, T-H6RNA and T-N1RNA concentration be the 500 copy/μ LRNA of 500 copies/μ L, the concentration of T-H6RNA and T-N1RNA is the 50 copy/μ LRNA of 50 copies/μ L.
Duplex RT-PCR is carried out: 2 × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L according to the One step RT-PCR reaction system of following 25 μ L, single stranded DNA shown in SEQIDNo.1 and 3, single stranded DNA shown in SEQIDNo.2 and 4,5 × 106Copy/μ LRNA1 μ L, supplies 25 μ L with the ultra-pure water without RNase, makes the final concentration of single stranded DNA shown in SEQIDNo.1 and 2 be 0.4 μM, makes the final concentration of single stranded DNA shown in SEQIDNo.3 and 4 be 0.2 μM and obtains 5 × 106The reaction system of copy RNA.
According to the method described above, by " 5 × 106Copy/μ LRNA " replace with " 5 × 10 respectively5Copy/μ LRNA ", " 5 × 104Copy/μ LRNA ", " 5 × 103Copy/μ LRNA ", " 5 × 102Copy/μ LRNA " or " 5 × 101Copy/μ LRNA " respectively obtain 5 × 105Copy the reaction system of RNA, 5 × 104Copy the reaction system of RNA, 5 × 103The copy reaction system of RNA, 500 reaction systems and 50 copying H6N1RNA copy the reaction system of RNA.
According to the method described above, by 5 × 106Copy/μ LRNA replaces with without RNA ultra-pure water, obtains the reaction system of negative control.
Response procedures is: 50 DEG C of 30min, 94 DEG C of 2min；94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 30s, 30 circulations；72 DEG C of 10min.
The product obtained by each duplex RT-PCR carries out agarose gel electrophoresis (Fig. 1) respectively, and result shows, and 5 × 106All having 2 obvious amplified bands to occur in the reaction system of copy～500 copy RNA, clip size is 447bp, 325bp respectively；All without band in the reaction system of 50 copy RNA and the reaction system of negative control.Therefore, the most mental retardation of the primer pair composition of the present invention detects the H6N1 hypotype AIV of final concentration of 500 copy/25 μ L.
Embodiment 3, embodiment 1 identify or auxiliary identifies the specificity experiments of primer pair composition of bird flu virus
1, the preparation of sample is detected
The virus used in experiment is H6N1 subtype avian influenza virus respectively, H6N2 subtype avian influenza virus, H6N5 subtype avian influenza virus, H6N6 subtype avian influenza virus, H6N8 subtype avian influenza virus, H1N1 subtype avian influenza virus, H2N3 subtype avian influenza virus, H3N2 subtype avian influenza virus, H4N5 subtype avian influenza virus, H5N1 subtype avian influenza virus, H7N2 subtype avian influenza virus, H8N4 subtype avian influenza virus, H9N2 subtype avian influenza virus, H10N3 subtype avian influenza virus, H11N9 subtype avian influenza virus, H12N5 subtype avian influenza virus, H13N5 subtype avian influenza virus and H15N8 subtype avian influenza virus, Avian pneumo-encephalitis virus (NDV), infectious bronchitis virus (IBV) and infectious laryngotracheitis virus (ILTV).
The nucleic acid of virus is carried out duplex RT-PCR by the primer pair composition 2, utilizing embodiment 1
1) extraction of viral RNA
According to MiniBESTViralRNA/DNAExtraction test kit description, extracting obtains the total serum IgE of bird flu virus in step 1 (H6N1, H6N2, H6N5, H6N6, H6N8, H1N1, H2N3, H3N2, H4N5, H5N1, H7N2, H8N4, H9N2, H10N3, H11N9, H12N5, H13N5 and H15N8 hypotype), NDV, IBV respectively, extracts the DNA obtaining ILTV.
2) duplex RT-PCR reaction and electrophoresis detection
Respectively with above-mentioned steps 1) in the RNA of each virus for template, with without RNA ultra-pure water for negative control, utilize H6 and the N1 in embodiment 1 to carry out duplex RT-PCR.
Each duplex RT-PCR is the One step RT-PCR reaction system of 25 μ L: 2 × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L, single stranded DNA shown in SEQIDNo.1 and 3, single stranded DNA shown in SEQIDNo.2 and 4, concentration is the viral nucleic acid of 10ng/ μ L or without RNA ultra-pure water 1 μ L, 25 μ L are supplied with the ultra-pure water without RNase, the final concentration making single stranded DNA shown in SEQIDNo.1 and 2 is 0.4 μM, makes the final concentration of single stranded DNA shown in SEQIDNo.3 and 4 be 0.2 μM.
Response procedures is: 50 DEG C of 30min, 94 DEG C of 2min；94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 30s, 30 circulations；72 DEG C of 10min.
The product obtained by each duplex RT-PCR carries out agarose gel electrophoresis (Fig. 2) respectively, and result shows, H6N1 subtype avian influenza virus (swimming lane 1 and 2) amplifies the band of size respectively 325bp, 447bp；H6N2 subtype avian influenza virus (swimming lane 3 and 4), H6N5 subtype avian influenza virus (swimming lane 5), H6N6 subtype avian influenza virus (swimming lane 6) and H6N8 subtype avian influenza virus (swimming lane 7) all only amplify the band being sized to 447bp；H1N1 subtype avian influenza virus (swimming lane 8) and H5N1 subtype avian influenza virus (swimming lane 12) all only amplify the band being sized to 325bp；H2N3 subtype avian influenza virus (swimming lane 9), H3N2 subtype avian influenza virus (swimming lane 10), H4N5 subtype avian influenza virus (swimming lane 11), H7N2 subtype avian influenza virus (swimming lane 13), H8N4 subtype avian influenza virus (swimming lane 14), H9N2 subtype avian influenza virus (swimming lane 15), H10N3 subtype avian influenza virus (swimming lane 16), H11N9 subtype avian influenza virus (swimming lane 17), H12N5 subtype avian influenza virus (swimming lane 18), H13N5 subtype avian influenza virus (swimming lane 19), H15N8 subtype avian influenza virus (swimming lane 20), NDV (swimming lane 21), IBV (swimming lane 22), ILTV (swimming lane 23) and negative control (swimming lane 24) all do not amplify any band.Result is consistent with expection, it was shown that the primer pair composition of the present invention can be used to identify the HA hypotype of bird flu virus and NA hypotype: if there being the band of size respectively 325bp, 447bp in RT-PCR product, it was shown that this virus is H6N1 subtype avian influenza virus；If RT-PCR product only having the band being sized to 325bp, it was shown that this virus is HxN1 (x ≠ 6) subtype avian influenza virus；If RT-PCR product only having the band being sized to 447bp, it was shown that this virus is H6Nx (x ≠ 1) subtype avian influenza virus；If without any band in RT-PCR product, it was shown that this virus is HxNy subtype avian influenza virus (x ≠ 6, y ≠ 1) or non-bird flu virus.This experimental result illustrates identifying or assisting the primer pair composition identifying bird flu virus can detect H6N1 subtype avian influenza virus, H6 subtype avian influenza virus and N1 subtype avian influenza virus specifically of embodiment 1.
Embodiment 4, duplex RT-PCR identify H6N1 subtype avian influenza virus
1, sample collecting
Chicken, duck pharynx anus cotton swab 305 parts is gathered from live-bird market, respectively with containing antibiotic PBS solution, (in PBS solution, the concentration of penicillin is 0.8 ten thousand units/mL, the concentration of streptomycin sulfate is 1.0 ten thousand units/mL, the concentration of gentamycin is 0.5mg/mL, the concentration of nystatin is 0.5mg/mL) fully soak cotton swab (about 4 hours), extruding and cleaning cotton swab repeatedly, 8000rpm/min is centrifuged 5min, obtains the supernatant of 305 parts of cotton swabs.
2, duplex RT-PCR determines the hypotype of H6N1 subtype avian influenza virus
Take the supernatant (sample 1-305) of 305 parts of cotton swabs of step 1, according to MiniBESTViralRNA/DNAExtraction test kit description, extract and obtain the total serum IgE of 305 parts of samples respectively, adjust the concentration of every part of sample total serum IgE respectively, make the concentration of the total serum IgE of these 305 parts of samples be 10ng/ μ L.By the following method, respectively the total serum IgE of every part of sample is carried out duplex RT-PCR:
Each duplex RT-PCR is the One step RT-PCR reaction system of 25 μ L: 2 × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L, single stranded DNA shown in SEQIDNo.1 and 3, single stranded DNA shown in SEQIDNo.2 and 4, viral RNA 10ng/ μ L1 μ L, supply 25 μ L with the ultra-pure water without RNase, make the final concentration of single stranded DNA shown in SEQIDNo.1 and 2 be 0.4 μM, make the final concentration of single stranded DNA shown in SEQIDNo.3 and 4 be 0.2 μM.
Response procedures is: 50 DEG C of 30min, 94 DEG C of 2min；94 DEG C of 30s, 52 DEG C of 30s, 72 DEG C of 30s, 30 circulations；72 DEG C of 10min.
The product obtained by each duplex RT-PCR carries out agarose gel electrophoresis (table 1) respectively, result shows, in sample 1-15, sample 1-2 all can amplify the band being sized to 447bp and 325bp, show to be H6 hypotype containing HA hypotype in sample 1-2, NA hypotype is the bird flu virus of N1 hypotype, is namely H6N1 subtype avian influenza virus in sample 1-2；In sample 1-15, sample 3-9 all can only amplify the band being sized to 447bp, it was shown that being, containing HA hypotype, the bird flu virus that H6 hypotype, NA hypotype are not all N1 hypotype in sample 3-9, namely the bird flu virus in sample 3-9 is H6Nx (x ≠ 1)；Sample 10-15 all can only amplify the band being sized to 325bp, it was shown that be all the bird flu virus of N1 hypotype in sample 10-15 for H6 hypotype, NA hypotype containing HA hypotype, namely the bird flu virus in sample 10-15 is HxN1 (x ≠ 6).Sample 16-305 in 305 parts of samples all can not expand band, illustrates that sample 16-305 is all without H6 hypotype and N1 subtype avian influenza virus.
3, conventional method determines bird flu virus and hypotype thereof
AIV in the supernatant of cotton swab is identified: the supernatant (sample 1-305) taking 305 parts of cotton swabs of step 1 inoculates SPF Embryo Gallus domesticus respectively according to following virus isolation procedure, collect the lethal chick embryo allantoic liquid of 24-96h and the not lethal chick embryo allantoic liquid of more than 96h, take allantoic fluid and carry out hemagglutination test.Result shows (table 1), and sample 1-43 is respectively provided with coagulation, it was shown that sample 1-43 all contains bird flu virus.
The sample (sample 1-43) taking HA-HI test carries out hemagglutination inhibition test, it is determined that the HA hypotype (table 1) of the AIV of infection.Result shows, the HA hypotype of the bird flu virus in sample 1-9 is H6 hypotype, the HA hypotype of the bird flu virus in sample 10-15 is H1 hypotype, the HA hypotype of the bird flu virus in sample 16-26 is H9 hypotype, the HA hypotype of the bird flu virus in sample 27-35 is H3 hypotype, and the HA hypotype of the bird flu virus in sample 36-43 is H4 hypotype.
By document (HoffmannE, StechJ, GuanY, etal.Universalprimersetforthefull-lengthamplificationofa llinfluenzaAviruses [J] .ArchVirol, 2001,146:2275 2289) in the method for colony assay, it is determined that the NA hypotype (table 1) of the AIV in sample 1-43.Result shows, the NA hypotype of the bird flu virus in sample 1-2,10-15 is N1 hypotype, the NA hypotype of the bird flu virus in sample 3-5,16-25,27-39 is N2 hypotype, the NA hypotype of the bird flu virus in sample 6-7 and 40-43 is N6 hypotype, the NA hypotype of the bird flu virus in sample 8 is N5 hypotype, and the NA hypotype of the bird flu virus in sample 9 and 26 is N8 hypotype.
Result shows, detect H6 hypotype and N1 subtype avian influenza virus result and the bird flu virus that Virus Isolation, hemagglutination inhibition test and sequencing methods are determined and H6 hypotype thereof by the primer pair composition of the present invention and N1 hypotype is consistent, cross reaction is not occurred for other HA hypotypes (H3, H4 and H9 etc.) and NA hypotype (N2, N5, N6 and N8 etc.).Therefore, whether whether the duplex RT-PCR of the present invention and primer pair composition may be used to determine HA hypotype be H6 hypotype, NA hypotype is the bird flu virus of N1 hypotype.
The qualification of bird flu virus HA hypotype and NA hypotype in 1,305 parts of cotton swabs of table
Note: "×" represents the qualification not carrying out HA hypotype or NA hypotype；" a " represents is not bird flu virus；" b " expression is not N1 subtype avian influenza virus and is not H6 subtype avian influenza virus；"+", represents containing purpose band；"-" represents without purpose band；X ≠ 6, y ≠ 1.
Comparative example 1, other primers identify bird flu virus effect
Applicant is also prepared for name and is called that H6-N's identifies that whether bird flu virus HA hypotype is the primer of H6 hypotype: GATGTTTCCCAAAAGTACAT, H6-N can amplify, with the H6-R in embodiment 1, the band being sized to 279bp in theory.
Applicant is also prepared for identifying that whether bird flu virus NA hypotype is the primer of N1 hypotype: name is called that the primer sequence of N1-N1 is AGTGGATGGGCCATATACAG；Name is called that the primer sequence of N1-N2 is GCTTGGTCDGCAAGTGCTTG；Name is called that the primer sequence of N1-N3 is CTGCATATGTAYCCTATYTGATA.In theory, N1-N1 and the N1-R in embodiment 1 can amplify the band being sized to 575bp, and N1-N2 and N1-N3 can amplify the band being sized to 425bp.
1, substance RT-PCR
The primer pair of the N1-F in the primer pair of N1-R composition in the primer pair, the primer pair of the H6-F in the embodiment 1 and H6-R in embodiment 1 composition, N1-N1 and the embodiment 1 that are formed by the H6-R in H6-N and embodiment 1, the primer pair of N1-N2 and N1-N3 composition and embodiment 1 and the N1-R composition in embodiment 1 carries out substance RT-PCR amplification with the RNA of H6N1 for template respectively, without the ultra-pure water of RNA as negative control.
The One step RT-PCR reaction system 1:2 of 25 μ L × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L, the primer pair of the H6-F in the primer pair of the H6-R composition in H6-N and embodiment 1 or embodiment 1 and the H6-R composition in embodiment 1, RNA (10ng/ μ L) the 1 μ L of the H6N1 in embodiment 2, supply 25 μ L with the ultra-pure water without RNase, make the final concentration of in primer pair two primers be 0.5 μM.
The One step RT-PCR reaction system of 25 μ L: 2 × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L, the primer pair 2 of the N1-F in primer pair, the primer pair of N1-N2 and N1-N3 composition or embodiment 1 that the N1-R in N1-N1 and embodiment 1 forms and the N1-R composition in embodiment 1, RNA (10ng/ μ L) the 1 μ L of the H6N1 in embodiment 2, supply 25 μ L with the ultra-pure water without RNase, make the final concentration of in primer pair two primers be 0.5 μM.
Response procedures is: 50 DEG C of 30min, 94 DEG C of 2min；94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 30s, 30 circulations；72 DEG C of 10min.
The product that each substance RT-PCR obtains is carried out agarose gel electrophoresis (Fig. 4) respectively, result shows, the product of H6-F and H6-R primer pair amplifies is 447bp, the product of H6-N and H6-R primer pair amplifies is 279bp, the product of N1-F and N1-R primer pair amplifies is 325bp, the product of N1-N2 and N1-N3 primer pair amplifies is 425bp, and the primer pair amplifies efficiency of N1-N1 and N1-R composition is low, without purpose band (575bp).Illustrate that N1-N1 and the N1-R primer pair formed is not suitable for for identifying N1 subtype avian influenza virus.
2, duplex RT-PCR
According to MiniBESTViralRNA/DNAExtraction test kit description, the H5N1RNA that extracting obtains concentration to be the H6N2RNA of 10ng/ μ L, concentration be the H6N6RNA of 10ng/ μ L, concentration is 10ng/ μ L.
Primer pair composition called after primer pair composition N by the primer pair of H6-N and H6-R composition, the primer pair the two primer pair composition of N1-N2 and N1-N3 composition.
The primer pair composition of primer pair composition N and embodiment 1 is carried out respectively duplex RT-PCR.
The duplex RT-PCR of the primer pair composition of embodiment 1 is the One step RT-PCR reaction system of 25 μ L: 2 × 1StepBuffer12.5 μ L, PrimeScript1StepEnzymeMix1 μ L, single stranded DNA shown in SEQIDNo.1 and 3, single stranded DNA shown in SEQIDNo.2 and 4, the RNA (10ng/ μ L) of the H6N1 in embodiment 2, concentration is the H6N2RNA of 10ng/ μ L, concentration is the H6N6RNA of 10ng/ μ L, concentration is the H5N1RNA of 10ng/ μ L or without RNA ultra-pure water 1 μ L, 25 μ L are supplied with the ultra-pure water without RNase, the final concentration making single stranded DNA shown in SEQIDNo.1 and 2 is 0.4 μM, the final concentration making single stranded DNA shown in SEQIDNo.3 and 4 is 0.2 μM.
The duplex RT-PCR of primer pair composition N is the One step RT-PCR reaction system 1:2 × 1StepBuffer12.5 μ L of 25 μ L, PrimeScript1StepEnzymeMix1 μ L, H6-N, H6-R in embodiment 1, N1-N2 and N1-N3, the RNA (10ng/ μ L) of the H6N1 in embodiment 2, concentration is the H6N2RNA of 10ng/ μ L, concentration is the H6N6RNA of 10ng/ μ L, concentration is the H5N1RNA of 10ng/ μ L or without RNA ultra-pure water 1 μ L, 25 μ L are supplied with the ultra-pure water without RNase, make H6-N, the final concentration of H6-R is 0.2 μM, the final concentration making N1-N2 and N1-N3 is 0.6 μM.
The duplex RT-PCR of primer pair composition N is the One step RT-PCR reaction system 2:2 × 1StepBuffer12.5 μ L of 25 μ L, PrimeScript1StepEnzymeMix1 μ L, H6-N, H6-R in embodiment 1, N1-N2 and N1-N3, the RNA (10ng/ μ L) of the H6N1 in embodiment 2, concentration is the H6N2RNA of 10ng/ μ L, concentration is the H6N6RNA of 10ng/ μ L, concentration is the H5N1RNA of 10ng/ μ L or without RNA ultra-pure water 1 μ L, 25 μ L are supplied with the ultra-pure water without RNase, make H6-N, the final concentration of H6-R is 0.2 μM, the final concentration making N1-N2 and N1-N3 is 0.4 μM.
Response procedures is: 50 DEG C of 30min, 94 DEG C of 2min；94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 30s, 30 circulations；72 DEG C of 10min.
The product obtained by each duplex RT-PCR carries out agarose gel electrophoresis (Fig. 3) respectively, result shows, when different primers concentration, utilize primer pair composition N that the RNA of H6N2 and H6N6 all can be amplified the purpose band of H6 hypotype 279bp, the RNA of H5N1 can be amplified the purpose band of N1 hypotype 425bp, but the RNA of H6N1 can only be amplified the band of H6 hypotype 279bp order, and the RNA of H6N1 should also have the purpose band of 425bp of N1 hypotype, but result lacks this band, namely when amplification template is H6N1, the band of H6 hypotype can only be amplified, but the band of N1 hypotype can not be amplified.Result shows that primer pair composition N can not identify H6 hypotype and the N1 hypotype of bird flu virus simultaneously.
The RNA of the H6N1 duplex RT-PCR carried out can be amplified the band being sized to 447bp and 325bp by the primer pair composition utilizing the present invention, the RNA of H6N2 and the H6N6 duplex RT-PCR carried out can be amplified the band being sized to 447bp by primer pair composition, the RNA of the H5N1 duplex RT-PCR carried out can be amplified the band being sized to 325bp by primer pair composition, result is consistent with actual, it was shown that the primer pair composition of the present invention can be used to identify H6 hypotype and N1 subtype avian influenza virus.
Claims (5)
1. identify or assist the primer pair composition identifying H6 hypotype and N1 subtype avian influenza virus, being made up of the two of independent packaging primer pairs, be namely called that the PCR primer pair of H6 and name are called that the PCR primer pair of N1 forms by name；
The described H6 two single stranded DNAs shown in SEQ ID No .1 and SEQIDNo.2 form；The described N1 two single stranded DNAs shown in SEQ ID No .3 and SEQIDNo.4 form.
2. identify or assist the test kit identifying H6 hypotype and N1 subtype avian influenza virus, it is characterised in that: described test kit contains the primer pair composition described in claim 1.
3. test kit according to claim 2, it is characterised in that: described test kit also includes reverse transcription.
4. the test kit according to Claims 2 or 3, it is characterised in that: described test kit also includes PrimeScriptTM2 × 1StepBuffer and PrimeScript1StepEnzymeMix in OneStepRT-PCRKitVer.2 test kit.
5. the preparation method of the primer pair composition described in claim 1 or the test kit described in Claims 2 or 3 or 4, including the step individually packed by described two single stranded DNAs of primer pair each in the primer pair composition described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410652501.8A CN104328221B (en) | 2014-11-17 | 2014-11-17 | Identify or assist the primer pair composition and application thereof of identifying H6N1 subtype avian influenza virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410652501.8A CN104328221B (en) | 2014-11-17 | 2014-11-17 | Identify or assist the primer pair composition and application thereof of identifying H6N1 subtype avian influenza virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104328221A CN104328221A (en) | 2015-02-04 |
| CN104328221B true CN104328221B (en) | 2016-06-29 |
Family
ID=52403026
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410652501.8A Active CN104328221B (en) | 2014-11-17 | 2014-11-17 | Identify or assist the primer pair composition and application thereof of identifying H6N1 subtype avian influenza virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104328221B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107326103B (en) * | 2017-08-28 | 2021-06-15 | 聊城大学 | Triple RT-PCR specific amplification primer group and triple-identification RT-PCR detection method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102071263B (en) * | 2010-12-07 | 2013-05-15 | 中华人民共和国珠海出入境检验检疫局 | Nested fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection reagent for avian influenza virus (AIV) H5 subtype and detection kit |
-
2014
- 2014-11-17 CN CN201410652501.8A patent/CN104328221B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104328221A (en) | 2015-02-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Identification and subtyping of avian influenza viruses by reverse transcription-PCR | |
| Slomka et al. | Validated RealTime reverse transcriptase PCR methods for the diagnosis and pathotyping of Eurasian H7 avian influenza viruses | |
| El Zowalaty et al. | Avian influenza: virology, diagnosis and surveillance | |
| Qiu et al. | A reverse transcription-PCR for subtyping of the neuraminidase of avian influenza viruses | |
| Hurt et al. | Isolation of avian influenza viruses from two different transhemispheric migratory shorebird species in Australia | |
| Zheng et al. | Comparative analysis of MicroRNA expression in dog lungs infected with the H3N2 and H5N1 canine influenza viruses | |
| CN103103291A (en) | Multiple identification and detection method of H4 and H9 subtypes of avian influenza virus | |
| KR20200050872A (en) | Method for influenza a virus and influenza b virus detection | |
| Manzoor et al. | Phylogenic analysis of the M genes of influenza viruses isolated from free-flying water birds from their Northern Territory to Hokkaido, Japan | |
| CN106636473B (en) | Complete set of reagents and method for detecting H5 subtype avian influenza virus and chicken parvovirus | |
| CN104328221B (en) | Identify or assist the primer pair composition and application thereof of identifying H6N1 subtype avian influenza virus | |
| CN103820571B (en) | Primer, probe and kit for detection method of influenza A virus one-step reverse transcription quantitive PCR | |
| CN102304591B (en) | PCR (polymerase chain reaction) primer pair for identifying H3 subtype avian influenza virus and application thereof | |
| CN108611438A (en) | Differentiate H9 and H10 subtype avian influenza virus duplex RT-PCR detection primers group, kit and its application simultaneously | |
| CN104531899B (en) | The GeXP rapid detection kit of avian influenza virus and its H6 hypotypes and N1 hypotypes | |
| CN104017903A (en) | H3 avian influenza virus two-temperature type RT-PCR detection kit and primer pair thereof | |
| CN102329891B (en) | RT-LAMP (reverse transcription-loop-mediated isothermal amplification) primer group for detecting H9 subtype avian influenza virus as well as detection method and application thereof | |
| Jindal et al. | Amplification of four genes of influenza A viruses using a degenerate primer set in a one step RT-PCR method | |
| CN111518954A (en) | Primer group, kit and method for double nano PCR detection of H5 and N8 subtype avian influenza virus | |
| RU2439149C1 (en) | Strain of influenza virus of a /herring gull/mongolia/454/08/ h13n8-subtype used in obtaining antigen-containing substrate and serum for diagnostic purposes | |
| CN110669872A (en) | Triple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group, kit and method for H9 and H10 subtype avian influenza viruses | |
| CN103866047B (en) | Primer for detecting H7N9 subtype influenza virus combines and detection kit | |
| CN107858454A (en) | H1N6 subtype avian influenza virus double RT PCR detection primers group, kit and its application | |
| CN111518953A (en) | Primer group, kit and method for double nano PCR detection of H7 and N2 subtype avian influenza virus | |
| CN104313190A (en) | Primer pair combination and application thereof for identifying or helping identifying avian influenza virus and H6N1 subtype thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |