CN104328165B - The screening reagent box of the stagnant green gene SGR gene of a kind of early stage non-irrigated stress-inducing Festuca Arundinacea and method - Google Patents

Abstract

The invention discloses screening reagent box and the method for the stagnant green gene SGR gene of a kind of Festuca Arundinacea.The present invention with PEG6000 drought Stress treatment (0h, 6h, 12h, 18h and 24h) Festuca Arundinacea for experiment material, the RNA-seq technology of Illumina/Solexa order-checking platform is utilized to set up Festuca Arundinacea transcript profile database, do you with registered 51 the SGR sequences deriving from 18 species for probe, apply local Blast (Local? Blast) screening in early days drought coerce under Festuca Arundinacea SGR gene.The inventive method can fast, comprehensively screen in early days drought coerce under Festuca Arundinacea SGR candidate gene, to the molecular breeding of seed selection elongating green period of lawn, there is great importance.

Description

The screening reagent box of the stagnant green gene SGR gene of a kind of early stage non-irrigated stress-inducing Festuca Arundinacea and method

Technical field

The invention belongs to biological technical field, be specifically related to a kind of screening reagent box and method of Festuca Arundinacea SGR candidate gene.

Background technology

Stagnant green (staygreen) refers to that plant not to be degraded or degrade unconspicuous phenomenon at aging course Determination of Chlorophyll, and its most significant feature is that the time that plant fertility blade in latter stage keeps green is longer, not yellow even completely.SGR gene is in succession cloned out in high green plants.Early stage research, mainly by classical localization method, namely after genetic analysis, is carried out gene identification by the chromosomal region order-checking of location, then is verified by mutant complementation.These newfound SGR genes are primarily of nuclear gene encoding and by old and feeble special abduction delivering, great majority derive from C type stay-green mutation body, the chlorophyll degradation function of C type stay-green mutation body is because heritable variation and exception, its chlorophyll content can long term maintenance constant, but, be as good as with wild-type in physiological function degeneration, as the mutant nye-1 of Arabidopis thaliana, mutant sgr and nyc3 of paddy rice, the mutant cl of capsicum (Capsicumannuum), the mutant JI2775 of pea (Pisumsativum), the mutant gf of tomato (Solanumlycopersicon), the mutant nan of oranges and tangerines (Citrussinensis), the mutant sgr etc. of M. truncatula (Medicagotruncatula).

Do not comprise any known structural domain in known SGR protein structure, the method that therefore there is no judges the action pathway that SGR is possible.But can it is clear that, compared with chlorophillins associated proteins, SGR cannot in conjunction with chlorophyll, and therefore, SGR is not the enzyme participating in chlorophyll metabolism process.Park etc. have found OsSGR gene by sgr (staygreen) mutant of Study On Rice, and to find in this mutant that Psll catches light-chlorophyll (LHC II-Chl) complex body and has build-up effect, inferring that SGR gene action is in LHCII, is the key factor of regulation and control LHCII complex stability.When plant occurs old and feeble, the SGR being positioned at chloroplast(id) combines and forms SGR-LHCII complex body thus split by LHCII-Chl complex structure, and other decomposition of protein enzymes participated in chloroplast(id) pathways metabolism just can find and be attached to the degraded activity corresponding subunit carrying out next step.Therefore, just current research is inferred, dissociating of LHCII-Chl complex body is the prerequisite of chlorophyll degradation approach, and SGR may be the candidate albumen matter participating in LHC II-Chl dismounting.

Festuca Arundinacea (Festucaarundinacea) is Gramineae festuca per nnial herb, is the fastest-rising grass seeds of the current usage quantity of China, extensively cultivates in China, is southern area green phase the longest cold-season type lawn.Cryogen type turfgrass is the key constraints in Commercial cultivation in " dormancy " phenomenon in summer.People are more prone to the grass seeds of length of green phase when turf grass species is selected.Although SGR mutant can not extend the photosynthesis of plant, character mutation can meet the pursuit that people extend green period, so extending green period is one of major objective of all turfgrass seed selections.Only studies have reported that 1 stagnant green gene SGR candidate gene senescence-induciblechloroplastnon-yellowingprotein1 (GenBank:ADV57294.1) of Festuca Arundinacea at present, the molecular basis of Festuca Arundinacea SGR and regulation mechanism relevant information scarcity.

Along with the fast development of high throughput sequencing technologies, transcriptome analysis method is from microarray technology, and the small throughput pattern of SAGE and MPSS technology changes over the high-throughput pattern of RNA-seq.RNA-Seq (RNA gene sequence analysis and the order-checking of full transcript profile), there is obvious advantage, only need less RNA sample, just can detect the overall transcription activity of certain species or particular cell types, disclose more accurately sequence variation, the complete annotation of genetic expression, gene sample room Differential expression analysis and detect alternative splicing etc., whole transcript profile is investigated with high-throughput and quantitative mode.The advantage of these uniquenesses, makes RNA-Seq technology become the strong tools of further investigation organism transcript profile complicacy at present, is also considered to one of a kind of effective means finding new gene.

Digital gene express spectra (DigitalGeneExpressionProfiling, DGE) utilizes high-flux sequence, system, detects the technology of a certain species particular organization expression conditions in a particular state rapidly.DGE has been widely used in basic scientific research field.Studies have reported that and utilized DGE to the genetic expression of relevant difference gene, LPS activated scavenger cell in yellow meat kiwifruit fruit coloring process, tumorous stem mustard root and stem organizes transcript profile to compare and the screening of the high numerous trait related gene of Small-fat-tail sheep and analysis research.

Local Blast (LocalBasicLocalAlignmentSearchTool) is the instrument carrying out similarity gene comparision in the protein or DNA database of localization, has been used to genescreen that is some in a certain species particular organization or family.Studies have reported that and utilized Arabidopis thaliana WRKY transcription factor family gene sequence to be probe, local Blast has been performed to apple whole genome sequence and searches for, screen apple WRKY transcription factor family gene in conjunction with bioinformatics method; Perform local Blast with Arabidopis thaliana and paddy rice ANK family gene sequence and search for ' gold hat ' apple whole genome sequence, the bioinformatics methods such as binding domains research tool CD (conserveddonmain), perl program, resolve apple ankyrin Gene A NK family gene.

Summary of the invention

The present invention is intended to the scarcity for current Festuca Arundinacea SGR molecular mechanism relevant information, provides a kind of screening reagent box and method of Festuca Arundinacea SGR gene.

In order to achieve the above object, technical scheme provided by the invention is:

The screening reagent box of described Festuca Arundinacea SGR candidate gene, described test kit comprises the probe (totally 51) described in table 1:

Table 1

Above-mentioned probe can for the preparation of the screening reagent of Festuca Arundinacea SGR candidate gene.

Present invention also offers a kind of screening method of Festuca Arundinacea SGR candidate gene, described method comprises the steps:

(1) take mass percent concentration as 20%PEG6000 drought Stress treatment 50d Festuca Arundinacea in age root system 0h, 6h, 12h, 18h and 24h; Wherein, 0h is control group, and 6h, 12h, 18h and 24h are treatment group;

(2) RNA of the Festuca Arundinacea blade after step (1) non-irrigated Stress treatment is extracted respectively by Trizol method, the samples sources that the mixing RNA of each process and control group checks order as total transcript profile; Adopt high throughput sequencing technologies platform IlluminahiSeq ^tM2000 carry out the order-checking of the transcript profile degree of depth, obtain the some section of reading raw data, the section of reading of gained raw data are filtered, and filter principle to be: 1. remove joint sequence SEQIDNO.1 and SEQIDNO.2 used when the section of reading comprising joint is filtered; 2. the section of reading containing unknown base ratio more than 10% is removed; 3. remove the section of reading that inferior quality and base are greater than 50%, shown inferior quality refers to the section of reading that mass value is less than 5; 4. the section of reading that average mass values is less than 15 is removed, obtain the available section of reading, then after carrying out denovo splicing to the available section of reading, assembling obtains Festuca Arundinacea mixing transcript profile storehouse, and in Festuca Arundinacea mixing transcript profile storehouse, the mean length of separate gene is 691bp, N50 length is 1279bp;

(3) probe described in employing table 1 carries out LocalBlast analysis to Festuca Arundinacea mixing transcript profile storehouse, and the Output rusults e-value threshold value arranging LocalBlast analysis is 1e-5, filters out the SGR gene of predominant expression;

(4) 4 treatment group described in step (1) are carried out digital gene expression pattern analysis with control group respectively; The statistical study of separate gene expression amount uses RPKM method, and calculate the differential gene database embodying gene expression amount, its calculation formula is:

$\mathrm{RPKM}=\frac{{10}^{6}C}{\mathrm{NL}/{10}^3}$

If RPKM is the expression amount of separate gene, C is that unique comparison reads hop count to separate gene, and N is that unique comparison always reads hop count to all separate gene, and L is the base number of separate gene; RPKM method can eliminate mrna length and order-checking amount difference to the impact calculating genetic expression, and the gene expression amount calculated can be directly used in the gene expression difference of more different sample room;

(5) the SGR separate gene that the differential gene database analysis step (3) of each process obtained with step (4) obtains, screening drought further coerces the SGR gene of lower specifically expressing.

The application's integrated use RNA-Seq technology and LocalBlast technology screening Festuca Arundinacea SGR gene.When using these technology, design 20%PEG6000 coerces 0h, 6h, 12h, the Festuca Arundinacea blade of 18h and 24h is the RNA source of transcript profile order-checking, object is the Festuca Arundinacea transcript profile under acquisition early stage (in 24h) drought is coerced, and when LocalBlast technology uses, utilize with SGR sequence as probe, screening Festuca Arundinacea SGR gene, and screen the SGR gene of specifically expressing under the non-irrigated stress time of difference further according to DGE, to realize comprehensively, to carry out fast the screening of Festuca Arundinacea SGR gene.

The present invention is by PEG6000 drought Stress treatment (6h, 12h, 18h and 24h) Festuca Arundinacea, and untreated (0h) plant is contrast.The RNA-seq technology of Illumina/Solexa order-checking platform is adopted to obtain the mixing transcript profile that early stage drought coerces Festuca Arundinacea first, and the differential gene (differentexpressiongenes of the different non-irrigated stress time of statistical study, DEGs) and expression level, last LocalBlast screens Festuca Arundinacea SGR candidate gene.LocalBlast analyzes discovery, similarity (Identity) is set to >=80% time, obtain reliable 5 Festuca Arundinacea SGR (unigene_121952, unigene_39265, unigene_151572, unigene_131561, unigene_81392), the SGR gene of screening may be used for the molecular breeding of seed selection elongating green period of lawn.

Embodiment

1, Festuca Arundinacea drought coerces sample preparation

The previous experiments result of the Resistant index such as the seedling chlorophyll fluorescence kinetics parameters of coercing according to PEG and relative conductivity, determines to coerce 0h with 20%PEG6000 respectively, 6h, 12h, and the Festuca Arundinacea blade of 18h and 24h is transcript profile sequence rna source.

2, high-throughput transcript profile sequencing analysis

Conveniently Trizol method extracts the Festuca Arundinacea blade RNA after above-mentioned non-irrigated Stress treatment, the samples sources that the mixing RNA of each process and control group checks order as total transcript profile, utilizes routine high-throughput sequencing technologies platform IlluminahiSeq ^tM2000 carry out the order-checking of the transcript profile degree of depth, carry out denovo splicing with Trinity software, and to checking order, the short section of reading (reads) obtained is spliced into a transcript profile, in this, as the reference sequences of subsequent analysis.Then unigene sequence is obtained to assembling the transcript cluster obtained.The software that Raw data quality controls to use is

FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/), fastqc software adopts the using method of order line to be under linux: fastqc-osample-FastQCsample_1.fq.gzsample_2.fq.gz.Data filter principle is: 1) removing the joint sequence 5 ' joint sequence used when the section of reading comprising joint (adaptor) is filtered is: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (SEQIDNO.1), and 3 ' joint sequence is: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (SEQIDNO.2); 2) remove the section of reading of unknown base (N) ratio more than 10%, in the section of reading, the ratio of unknown base is more than 10%, represents the second-rate section of reading; 3) section of reading that the base removing inferior quality (mass value is less than 5) is greater than 50%; 4) remove average mass values and be less than the section of reading of 15 according to statistics, quantity statistics data (cleandata) ratio is good, raw data is filtered and is obtained filtering rear sequencing sequence (the available section of reading, cleanreads) 57023248, (unigene is the english abbreviation of UniversalGene to assemble the Festuca Arundinacea mixing transcript profile storehouse unigene obtaining 158385 separate gene, mean extensively general gene database, by computer, formation nonredundant gene database is gathered to compiling of homologous genes seat (Locus).), mean length is 691bp, N50 length is 1279bp.

3, the choosing of SGR sequence probes

That keyword is at NCBI protein pool (http://www.ncbi.nlm.nih.gov/protein/ with SGR? term=DREB2+Transcription+factor) search sequence in, chooses probe sequence table 1 as aforesaid in file.

4, SGR sequence probes localBLAST is utilized to screen Festuca Arundinacea SGR gene

Utilize the SGR probe sequence obtained to carry out LocalBlast (ftp: //ftp.ncbi.nlm.nih.gov/blast/executables/LATEST-BLAST/) to Festuca Arundinacea mixing transcript profile storehouse (step 2 builds) to analyze, arranging Output rusults e-value threshold value is that 1e-5 is used for specific filtration resistance to poor result, the SGR gene of screening predominant expression.E-Value and identity two numerical value are as evaluation condition similar between sequence and sequence.Nonredundant (Nr) albumen database of valuable Festuca Arundinacea SGR candidate gene and NCBI carries out Blast comparison.

5, digital gene expression pattern analysis

The sample of 4 Festuca Arundinacea PEG Stress treatments (6h, 12h, 18h and 24h) contrasts with 0h respectively and carries out digital gene expression pattern analysis (DigitalGeneExpressionTagProfiling, DGE).The statistical study of Unigene expression amount uses RPKM method (ReadsPerkbperMillionreads) to calculate the differential gene database embodying gene expression amount, and its calculation formula is:

$\mathrm{RPKM}=\frac{{10}^{6}C}{\mathrm{NL}/{10}^3}$

If RPKM is the expression amount of separate gene (Unigene), C is unique comparison to the section of reading (reads) number of separate gene, and N is that unique comparison always reads hop count to all separate gene, and L is the base number of separate gene.RPKM method can eliminate mrna length and order-checking amount difference to the impact calculating genetic expression, and the gene expression amount calculated can be directly used in the gene expression difference of more different sample room.Make multiple hypothesis test to the p value (pvalue) of difference test to correct, decided the thresholding of pvalue by control FDR (FalseDiscoveryRate).Difference expression gene is defined as false discovery rate (FDR)≤0.001 and the gene of fold difference more than 2 times.

6, according to DGE screen further in early days drought coerce under SGR gene

Blast data results (step 4) is analyzed according to DGE result (step 5), concrete operations are that the Festuca Arundinacea SGR gene screened by LocalBlast is searched for respectively in DGE database, judge whether each gene exists in DGE, screen the Festuca Arundinacea SGR gene of early stage non-irrigated stress-inducing specifically expressing further.If be present in DGE, then determine the expression level of the SGR gene at the non-irrigated stress time of difference (0h, 6h, 12h, 18h and 24h) further according to DGE.The digital gene expression pattern analysis of integrating step 5 and gene ontology (geneontology, GO) function significance enrichment analysis, capital of a country gene and genome encyclopedia (KEGG, KyotoEncyclopediaofGenesandGenomes) signal path significance enrichment, expression is lowered in the upper mediation analyzing Festuca Arundinacea SGR gene.

The selection result is as follows:

LocalBLAST is carried out to Festuca Arundinacea mixing transcript profile storehouse and analyzes discovery, obtain 12 SGR separate gene.Wherein there are 5 in 0h storehouse: unigene_131561, unigene_137660, unigene_149535, unigene_61693 and unigene_81392.

6hDEGs (0hvs.6h), 12hDEGs (0hvs.12h), 18hDEGs (0hvs.18h) and 24hDEGs (0hvs.24h) have 7 respectively, 6,4 and 4 SGR genes, wherein raise SGR gene and be respectively 6 in above-mentioned 4 stages, 6,4 and 3, and lower SGR gene in above-mentioned 4 stages and be respectively 1,0,0 and 1 (table 2).Wherein 6 SGR genes up-regulated expression in 6hDEGs (0hvs.6h) and 12hDEGs (0hvs.12h) storehouse; Unigene_121952 and unigene_91763 is up-regulated expression in 4 DGE storehouses; Unigene_39265 does not express in 18hDEGs (0hvs.18h) storehouse, in other 3 storehouses, have up-regulated expression; Only downward expressing gene is unigene_26994.

The SGR gene of differential expression in a table 24 DGE storehouse

	0h vs.6h	0h vs.12h	0h vs.18h	0h vs.24h
					Up-regulated gene	unigene_39265	unigene_39265	unigene_121952	unigene_39265
	unigene_121952	unigene_121952	unigene_151572	unigene_121952
						unigene_151572	unigene_151572	unigene_147319	unigene_91763
	unigene_147319	unigene_147319	unigene_91763
						unigene_23338	unigene_23338
	unigene_91763	unigene_91763
Down-regulated gene	unigene_26994			unigene_26994

In these 12 separate gene, similarity (Identity) >=80% only have 5, match 12 known SGR sequences (see table 3) of barley, Arabidopis thaliana, alfalfa and paddy rice etc. respectively.In these 5 separate gene, unigene_131561 and unigene_81392 derives from contrast storehouse (0h storehouse); Unigene_151572 is up-regulated expression in 0hvs.6h, 0hvs.12h and 0hvs.18h; Unigene_39265 is up-regulated expression in 0hvs.6h, 0hvs.12h and 0hvs.24h; Unigene_121952 has up-regulated expression in 4 storehouses, and expression level is in table 4.

According to NR albumen database annotation result, unigene_131561 and unigene_151572 belongs to Lyeopene synthetic enzyme and red chlorophyll degradation product reductase enzyme genoid respectively; And unigene_39265, unigene_121952 and unigene_81392 belong to predicted protein (table 5).

The SGR gene (Identity >=70%) of table 3LocalBlast Festuca Arundinacea mixing drought stress transcript profile screening

SGR gene up-regulated expression level in 4 DGE storehouses of table 4 similarity >=70%

	0hvs.6h	0hvs.12h	0hvs.18h	0hvs.24h
					unigene_121952	8	5	3	2
unigene_151572	4	3	2	0
					unigene_39265	12	9	0	6

The albumen annotation result of the SGR gene of table 5 similarity >=80%

Claims (1)

1. a screening method for the stagnant green gene SGR candidate gene of early stage non-irrigated stress-inducing Festuca Arundinacea, it is characterized in that, described method comprises the steps:

(1) take mass percent concentration as 20%PEG6000 drought Stress treatment 50d Festuca Arundinacea in age root system 0h, 6h, 12h, 18h and 24h; Wherein, 0h is control group, and 6h, 12h, 18h and 24h are treatment group;

(2) RNA of the Festuca Arundinacea blade after step (1) non-irrigated Stress treatment is extracted respectively by Trizol method, the samples sources that the mixing RNA of each process and control group checks order as total transcript profile; Adopt high throughput sequencing technologies platform IlluminahiSeq ^tM2000 carry out the order-checking of the transcript profile degree of depth, obtain the some section of reading raw data, the section of reading of gained raw data are filtered, and filter principle to be: 1. remove joint sequence SEQIDNO.1 and SEQIDNO.2 used when the section of reading comprising joint is filtered; 2. the section of reading containing unknown base ratio more than 10% is removed; 3. remove the section of reading that inferior quality and base are greater than 50%, shown inferior quality refers to the section of reading that mass value is less than 5; 4. the section of reading that average mass values is less than 15 is removed, obtain the available section of reading, then after carrying out denovo splicing to the available section of reading, assembling obtains Festuca Arundinacea mixing transcript profile storehouse, and in Festuca Arundinacea mixing transcript profile storehouse, the mean length of separate gene is 691bp, N50 length is 1279bp;

(3) adopt the probe of following accession number to carry out LocalBlast analysis to Festuca Arundinacea mixing transcript profile storehouse, the Output rusults e-value threshold value arranging LocalBlast analysis is 1e-5, filters out the SGR gene of predominant expression:

AT4G22920.1

AT5G13800.1

AT5G13800.2

gi:332659281

gi:51538011

gi:58866297

gi:564742972

gi:162135178

gi:170947249

gi:171903868

gi:194239854

gi:106880178

gi:58866287

gi:58866291

gi:58866293

gi:318136968

gi:351721214

gi:351725005

gi:58866283

gi:332079483

gi:332079481

gi:355512512

gi:355512513

gi:357481783

gi:357481785

gi:301072303

gi:58866281

gi:215740722

gi:252971792

gi:156713217

gi:156713219

gi:157888391

gi:157888393

gi:345846659

gi:68510418

gi:171903870

gi:350535753

gi:350537597

gi:59506606

gi:241926095

gi:242049948

gi:58866285

gi:162463742

gi:162463900

gi:195611290

gi:195626196

gi:195639472

gi:226499550

gi:414590047

gi:414591272

gi:414886436

(4) 4 treatment group described in step (1) are carried out digital gene expression pattern analysis with control group respectively; The statistical study of separate gene expression amount uses RPKM method, and calculate the differential gene database embodying gene expression amount, its calculation formula is:

$\mathrm{RPKM}=\frac{{10}^{6}C}{\mathrm{NL}/{10}^3}$

If RPKM is the expression amount of separate gene, C is that unique comparison reads hop count to separate gene, and N is that unique comparison always reads hop count to all separate gene, and L is the base number of separate gene; RPKM method can eliminate mrna length and order-checking amount difference to the impact calculating genetic expression, and the gene expression amount calculated can be directly used in the gene expression difference of more different sample room;

(5) the SGR separate gene that the differential gene database analysis step (3) of each process obtained with step (4) obtains, screening drought further coerces the SGR gene of lower specifically expressing.