CN104312989A - Glucose oxidase with improved oxidative resistance - Google Patents
Glucose oxidase with improved oxidative resistance Download PDFInfo
- Publication number
- CN104312989A CN104312989A CN201410589628.XA CN201410589628A CN104312989A CN 104312989 A CN104312989 A CN 104312989A CN 201410589628 A CN201410589628 A CN 201410589628A CN 104312989 A CN104312989 A CN 104312989A
- Authority
- CN
- China
- Prior art keywords
- glucose oxidase
- enzyme
- seq
- genetic engineering
- engineering bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/26—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving oxidoreductase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
- C12Y101/03004—Glucose oxidase (1.1.3.4)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses glucose oxidase with improved oxidative resistance, belonging to the technical field of enzyme engineering. Methionine on a locus 556 of glucose oxidase is respectively mutated to be leucine by adopting a gene recombination technology and converted into pichia pastoris GS115, and a bacterial strain which is improved in oxidization resistance in comparison with the original bacterial strain is obtained by screening and identification. Compared with the controlled enzyme, the oxidization resistance and the residual enzyme activity treated by H2O2 with different concentrations of the glucose oxidase expressed by the bacterial strain are improved in varying degrees by twice in the presence of 100mmol.L<-1> and 500mmol.L<-1> H2O2.
Description
Technical field
The present invention relates to the glucose oxidase that a kind of scale resistance improves, belong to technical field of enzyme engineering.
Background technology
Glucose oxidase (Glucose Oxidase, be called for short GOD) be one of topmost toolenzyme in biological field, to be fixed on by GOD since Clark oxygen electrode surface is applied to blood sugar detection from Updike and Hicks in 1967, GOD is widely used in the association areas such as food and feed medicine.The research of glucose oxidase is mainly concentrated to the screening of the new strains producing this enzyme both at home and abroad, the aspects such as the orderly improvement of bacterial strain and the optimization of zymotechnique.
In the food industry, the existence due to oxygen causes many chemical reactions being unfavorable for quality product, and creates condition for many microorganism growth.GOD is widely used in various food and food processing technology as the safe oxidation inhibitor of generally acknowledging by current many countries.Although purposes is various, the effect of GOD is mainly glucose oxidase to form hydrogen peroxide and gluconic acid.Utilize its single-minded oxidasic principle to make glucose oxidase assay instrument and quick and precisely can measure glucose content Instructing manufacture in various food simply.In medicine industry, GOD is as the Quantitative in vitro analysis for glucose in serum (slurry) urine and cerebrospinal fluid such as test kit enzyme electrodes; The zymin that GOD makes also can be used for the formation removing or alleviate dental plaque tartar and carious tooth, prevents the generation of oral disease and odontopathy.In addition due to catalysis H can be generated
2o
2, also can be used for H
2o
2the treatment of responsive lymphadenomatous target goal.GOD or a kind of novel enzyme feed additive, can improve animal intestinal environmental modulation feed digestion and promote growth of animal.Mixed fodder additive containing glucose oxidase lactic acid superoxide and lactoferrin can be used for preventing livestock gastrointestinal tract infection to suffer from diarrhoea and have to promote growth of animal effect.From animal vegetable tissue, extract GOD have certain limitation, enzyme amount is not also enriched; Bacterium GOD yield of enzyme is few; General employing aspergillus niger and Penicillium bacterial strain produce bacterium as GOD.China and the U.S. all adopt a mould and Penicllium chrysogenum to produce GOD, and the conventional strange mould of Buddhist nun of Japan, Russia uses life mould.In recent years report that the mould genus of glue (Clioctadium), paecilomyces (Paecilomyces) and the mould genus of broom (Scopulariopsis) also can produce GOD.Glucose oxidase main source is aspergillus niger, because the malaga carbohydrate oxidase enzyme work of aspergillus niger institute is low, catalytic efficiency is low and foreign protein is more and make it have certain limitation in actual applications.
Produce hydrogen peroxide in GOD reaction process, make this enzyme have the effect of antibiotic and sterilizing, but the accumulation of hydrogen peroxide can suppress the activity of GOD and affect itself catalytic efficiency.Research finds, will produce restraining effect when concentration of hydrogen peroxide reaches 30mM to GOD activity.Therefore GOD is improved to the current problem demanding prompt solution of tolerance sexual behavior of oxygen.
Summary of the invention
The invention provides the glucose oxidase that a kind of scale resistance improves, it is characterized in that, the aminoacid sequence of described glucose oxidase of encoding is the sequence shown in SEQ ID NO.3.
The nucleotide sequence of described glucose oxidase of encoding is the sequence shown in SEQ ID NO.4.
Described glucose oxidase be with the aminoacid sequence shown in SEQ ID NO.1 for sequence of setting out, the methionine(Met) M of the 556th is sported leucine L; Gained sudden change glucose oxidase called after M556L respectively.
The nucleotide sequence of the aminoacid sequence shown in coding SEQ ID NO.1 is as shown in SEQ ID NO.2.
The described methionine(Met) of the 556th of undergoing mutation is positioned at the catalytic active center of glucose oxidase.
The present invention also provides a kind of genetic engineering bacterium of expressing described glucose oxidase.
Described genetic engineering bacterium, in one embodiment of the invention, being be host with pichia spp (Pichia pastoris) GS115, take pPIC9K as carrier, expresses the engineering bacteria of the gene of sequence shown in SEQ ID NO.4.
The construction process of described genetic engineering bacterium, in one embodiment of the invention, be the nucleotide fragments of sequence as shown in SEQ ID NO.4 is connected on Expression vector pPIC9K form recombinant vectors, recombinant vectors is transformed P.pastoris GS115, namely obtain genetic engineering bacterium.
The present invention also provides a kind of method utilizing described engineering bacteria fermentation to produce glucose oxidase, it is characterized in that, comprising: (1) is cultured to OD after being activated by genetic engineering bacterium
600=1.6-1.7, as seed liquor; (2) seed liquor is inoculated in basal fermentation medium, is cultured to OD in 28 DEG C-30 DEG C
600=1.2-1.5; (3) collect thalline, thalline is proceeded to inducing culture and cultivate, induction is laid eggs white.
Described basic fermention medium is BMGY substratum in one embodiment of the invention.
Described inducing culture is, is BMMY substratum in one embodiment of the invention.
The present invention also provides a kind of method measuring the scale resistance of glucose oxidase described in claim 1, it is characterized in that, is to be adopted by glucose oxidase after carrier free is cross-linked being fixed of immobilization technology, by the H of immobilized enzyme in different concns
2o
2middle process, centrifugal, supernatant discarded after process, washes precipitation until cannot H be detected in supernatant with damping fluid
2o
2, calculate through H
2o
2process with without H
2o
2the enzyme ratio alive of the immobilized glucose oxidase of process.
Beneficial effect of the present invention: the glucose oxidase M556L that this bacterial strain is expressed is compared to contrast enzyme, and scale resistance is at the H of different concns
2o
2the residual enzyme raising all had in various degree alive after process, through 50-500mmolL
-1h
2o
2after process, the enzyme of mutant enzyme M556L is lived and is about 2 times of contrast enzyme.Glucose oxidase provided by the invention, its oxidative stability significantly improves, and industrially has major application and is worth.
Accompanying drawing explanation
Fig. 1: glucose oxidase protein electrophoresis (SDS-PAGE); M: protein molecular weight standard; After 1: mutant strain M556L product enzyme purification; 2: after control strain produces enzyme purification;
Fig. 2: contrast enzyme compares with the scale resistance of mutant enzyme.
Embodiment
Glucose oxidase enzyme activity determination method: GOD determination of activity adopts o-(two) methyl oxyaniline spectrophotometry.Under the condition of aerobic, GOD catalysis glucose dehydro produces H
2o
2, under peroxidase (POD) effect, oxygen donor o-(two) methyl oxyaniline (DH2) is oxidized to brown product.Survey the change of 540nm place absorbancy, the result according to typical curve calculates glucose oxidase enzyme activity unit.1 glucose oxidase enzyme activity (1U) is defined as: 30 DEG C, under the condition of pH6.0, the β-D-Glucose of 1 μm of ol is oxidized to maltonic acid and H by 1min
2o
2required enzyme amount is a glucose oxidase enzyme activity unit.
The structure of embodiment 1 recombinant bacterium and qualification
The gene fragment of nucleotide sequence as shown in SEQ ID NO.2 is connected to pPIC9K and forms recombinant plasmid, with this recombinant plasmid for template, rite-directed mutagenesis obtains the recombinant vectors pPIC9K-GOD containing the GOD gene of sequence as shown in SEQ ID NO.4.Rite-directed mutagenesis primer used is M556L-F (sequence is as shown in SEQ ID NO.5), M556L-R (sequence is as shown in SEQ ID NO.6):
M556L-F：5'CCTCCTACGCAACTGTCGTCCCATG3'；
M556L-R：5'GTACCCTGCTGTCAACGCATCCTCC3'；
PCR reaction system: be sequentially added into following reagent in 0.2mLPCR pipe: 5 × FD PCR buffer 5 μ l; DNTP Mixture 2 μ l; Template DNA 1 μ l; The each 1 μ l of upstream primer; Phusion enzyme 0.5 μ l; Adding distilled water to final volume is 25 μ l.5 × FD PCR buffer 5 μ l; DNTP Mixture 2 μ l; Template DNA 1 μ l; The each 1 μ l of downstream primer; Phusion enzyme 0.5 μ l; It is 25 μ l that DMSO 1.5 μ l adds distilled water to final volume.After reacting 5 circulations, by corresponding PCR reaction solution mixing, continue reaction 25 circulation.Pcr amplification condition: 98 DEG C of denaturation 3min; 98 DEG C of sex change 15s; 53 DEG C of annealing 30s; 72 DEG C extend 11min (5 circulations); 72 DEG C extend 10min.Amplification condition after mixing: 98 DEG C become denaturation 3min; 98 DEG C of sex change 15s; 53 DEG C of annealing 30s; 72 DEG C extend 11min (25 circulations); 72 DEG C extend 10min.
After restriction enzyme DpnI digests, chemical transformation transforms Host Strains JM109, and transformed bacteria liquid is coated on the LB flat board containing penbritin, 37 DEG C of incubated overnight.The carrier pPIC9K-GOD of final acquisition respectively containing mutating acid GOD gene.
Or directly adopt the method for chemosynthesis to obtain the gene fragment of sequence as shown in SEQ ID NO.4, and connect Expression vector pPIC9K formation recombinant plasmid pPIC9K-GOD.
After recombinant plasmid linearizing, electricity proceeds to Pichia pastorisGS115 competent cell.Concrete method for transformation is: the conversion of pichia spp adopts electric robin: P.Pastoris GS115 is cultured to OD in 50mL YPD
600=1.2-1.5 centrifugal collecting cell; Aseptic washing twice cell using 400mL ice-cold successively, then the sorb alcohol wash cell of the 1mol/L using 40mL ice-cold, re-suspended cell is in the sorbyl alcohol of 1mL 1mol/L.100 μ L protoplastiss mix with 5-10 μ g linearization plasmid DNA (MSSI cuts) to proceed to after ice-cold 1mol/L sorbyl alcohol dilutes thalline coats solid MD substratum.Cultivate picking mono-clonal after 4-6 days for 30 DEG C.Screen correct transformant and be recombination engineering bacteria.
The screening of embodiment 2 high expression level bacterial strain
Preparation is dull and stereotyped containing the YPD of 0mg/mL, 1mg/mL, 1.5mg/mL, 2mg/mL, 2.5mg/mL Geneticin respectively, mono-clonal on MD substratum to be put successively on plate to the YPD flat board of different concns cultivation after 48 hours, the bacterium colony that picking form is larger carries out next step fermentation culture.
The purifying of embodiment 3 recombinant bacterium malaga carbohydrate oxidase and protein electrophoresis qualification
Adopt the Yeast engineering bacteria obtained in embodiment 2 for producing bacterial strain, after activation will 30 DEG C, cultivate OD at YPD growth medium (liquid amount 50mL) under 200rpm condition
600the seed of=1.6-1.7 proceeds to basic fermention medium (liquid amount 50mL) with the inoculum size of 10% (v/v), in 30 DEG C, the cultivation of 200rpm condition bottom fermentation.OD is cultured in basic fermention medium
600during=1.2-1.5, the whole thalline of collected by centrifugation, brine 2 times, thalline is all proceeded in 50mL (500mL triangular flask) liquid inducing culture BMMY, be placed in 30 DEG C, the cultivation of 200r/min shaking table, every 24h adds the methyl alcohol of fermentating liquid volume 1%, and enzyme is produced in induction.Be control strain (being namely preserved in the bacterial strain being numbered CCTCCNO:M2012266 of China typical culture collection center) to express the P.pastoris GS115 of wild-type (that is, without sudden change the GOD that sets out) glucose oxidase.
Substratum:
Seed and slant medium are YPD substratum (1L): Tryptones 20g, yeast extract 10g, glucose 20g; Slant medium adds agar 20g.
Basic fermention medium is BMGY substratum (1L): Tryptones 20g, yeast extract 10g, glycerine 10mL, YNB 13.4g, the phosphoric acid buffer of 100mM pH6.0.
Inducing culture is BMMY substratum (1L): Tryptones 20g, yeast extract 10g, methyl alcohol 8mL, the phosphoric acid buffer of YNB13.4g, 100mM pH6.0.
Obtain fermented liquid after fermentation ends, centrifugal acquisition fermentation supernatant, carries out purifying to enzyme, and purification process is anion chromatography, adopts the method for gradient elution, the glucose oxidase that final acquisition is purer.
As shown in Figure 1, can find out the protein band obtaining a molecular size range and be about 68kDa, this band is glucose oxidase to the SDS-PAGE figure of the glucose oxidase before and after sudden change.
The process for fixation of embodiment 4 glucose oxidase
Adopt carrier free crosslinking technological (CLEAs) immobilization protoenzyme and mutant enzyme.Get 100 μ L enzyme liquid, add isopyknic 10U/mL versatile peroxidase, then, slowly dripping Macrogol 2000 to final concentration is 75% (w/v), and then adding the glutaraldehyde that linking agent volume fraction is 25%, is 70mmolL to final concentration
-1.Mixture is put into shaking table, 30 DEG C of crosslinked one 20h periods, take out mixture, wash with damping fluid (10mM sodium malonate pH of buffer 5.0), collected after centrifugation supernatant, and repeat aforesaid operations, until cannot detect in supernatant that enzyme is lived, immobilized enzyme is put into damping fluid (final volume 10mL), 4 DEG C save backup.
The scale resistance of embodiment 5 enzyme measures
With Brandford test kit by unified to same protein concentration for the enzyme liquid of protoenzyme and mutant enzyme, adopt carrier free crosslinking technological immobilization protoenzyme and mutant enzyme.
Protoenzyme after immobilization and mutant enzyme are placed on different concns H
2o
2(10,20,50,100,500mM) process, treatment temp is 35 DEG C, and the treatment time is 2h, and damping fluid is sodium malonate damping fluid (pH5.0,10mM).After process, centrifugal, outwell supernatant, and wash precipitation until cannot H be detected in supernatant with damping fluid
2o
2thoroughly to remove H
2o
2.Precipitation is used isopyknic buffer solution, and centrifugal and abundant resuspended rear mensuration residual enzyme is lived.Relative enzyme work is through H
2o
2the ratio that enzyme after process is lived and initial enzyme is lived, defining initial enzyme activity is 100%.
By to different concns H
2o
2under condition, glucose oxidase stability change researchs and analyses discovery, as shown in Figure 2, along with H
2o
2concentration raises gradually, and glucose oxidase enzyme is lived in remaining and reduced gradually.Simultaneously compared to contrast enzyme, the scale resistance of mutant enzyme M556L is at the H of different concns
2o
2the residual enzyme raising all had in various degree alive after process, at 50mmolL
-1to 500mmolL
-1h
2o
2under existence, the enzyme work of mutant enzyme M556L is about 2 times of the work of contrast enzyme enzyme, and at 50mmolL
-1h
2o
2under, mutant enzyme M556L can also keep without H
2o
2the enzyme of under existing 78% is lived, and contrasts the significantly decline alive of enzyme enzyme.Mutant enzyme is relative to contrast enzyme, and scale resistance significantly improves.
Although the present invention with preferred embodiment openly as above; but it is also not used to limit the present invention, any person skilled in the art, without departing from the spirit and scope of the present invention; all can do various changes and modification, what therefore protection scope of the present invention should define with claims is as the criterion.
Claims (10)
1. a glucose oxidase for scale resistance raising, it is characterized in that, the aminoacid sequence of described glucose oxidase of encoding is the sequence shown in SEQ ID NO.3.
2. glucose oxidase according to claim 1, is characterized in that, the nucleotide sequence of described glucose oxidase of encoding is the sequence shown in SEQ ID NO.4.
3. glucose oxidase according to claim 1, is characterized in that, described aminoacid sequence is that the methionine(Met) of amino acid whose 556th shown in SEQ ID NO.1 is sported leucine.
4. the expression vector containing glucose oxidase described in claim 1.
5. express the genetic engineering bacterium of glucose oxidase described in claim 1 for one kind.
6. a construction process for genetic engineering bacterium described in claim 5, is be connected on Expression vector pPIC9K by the nucleotide sequence shown in SEQ ID NO.4 to form recombinant vectors, recombinant vectors is transformed P.pastoris GS115, namely obtains genetic engineering bacterium.
7. utilize engineering bacteria fermentation shown in claim 5 to produce a method for glucose oxidase, it is characterized in that, comprising: (1) is cultured to OD after being activated by genetic engineering bacterium
600=1.6-1.7, as seed liquor; (2) seed liquor is inoculated in basal fermentation medium, is cultured to OD in 28 DEG C-30 DEG C
600=1.2-1.5; (3) collect thalline, thalline is proceeded to inducing culture and cultivate, induction is laid eggs white.
8. method according to claim 7, is characterized in that, described basic fermention medium is BMGY substratum; Described inducing culture is BMMY substratum.
9. glucose oxidase described in claim 1 is in the application of food, medicine, biological field.
10. measuring a method for the scale resistance of glucose oxidase described in claim 1, it is characterized in that, is adopted by glucose oxidase after carrier free is cross-linked being fixed of immobilization technology, by the H of immobilized enzyme in different concns
2o
2middle process, centrifugal, supernatant discarded after process, washes precipitation until cannot H be detected in supernatant with damping fluid
2o
2, calculate through H
2o
2process with without H
2o
2the enzyme ratio alive of the immobilized glucose oxidase of process.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410589628.XA CN104312989A (en) | 2014-10-28 | 2014-10-28 | Glucose oxidase with improved oxidative resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410589628.XA CN104312989A (en) | 2014-10-28 | 2014-10-28 | Glucose oxidase with improved oxidative resistance |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104312989A true CN104312989A (en) | 2015-01-28 |
Family
ID=52368305
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410589628.XA Pending CN104312989A (en) | 2014-10-28 | 2014-10-28 | Glucose oxidase with improved oxidative resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104312989A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039362A (en) * | 2015-07-21 | 2015-11-11 | 湖北大学 | Method for improving oxidation resistance of glucose oxidase |
| CN106636021A (en) * | 2016-12-14 | 2017-05-10 | 曹书华 | Method for improving oxidation resistance of glucose oxidase |
| CN107488640A (en) * | 2017-09-18 | 2017-12-19 | 山东隆科特酶制剂有限公司 | A kind of resistance to oxidation low temperature glucose oxidase and its production method and application |
| CN107488600A (en) * | 2017-09-18 | 2017-12-19 | 山东隆科特酶制剂有限公司 | One plant height produces the aspergillus niger of resistance to oxidation low temperature glucose oxidase |
| CN108918625A (en) * | 2018-07-27 | 2018-11-30 | 三诺生物传感股份有限公司 | A kind of preparation method of bio-sensing film, bio-sensing film and monitoring device |
| CN112143717A (en) * | 2019-06-26 | 2020-12-29 | 青岛蔚蓝生物集团有限公司 | Glucose oxidase mutant with improved specific activity |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030077702A1 (en) * | 2001-10-23 | 2003-04-24 | Rajiv Shah | Method for formulating a glucose oxidase enzyme with a desired property or properties and a glucose oxidase enzyme with the desired property |
| CN103088003A (en) * | 2013-01-29 | 2013-05-08 | 江南大学 | Oxidation resistive amylase mutant as well as preparation method and application thereof |
| CN103614350A (en) * | 2013-12-18 | 2014-03-05 | 江南大学 | Glucose oxidase with improved catalytic efficiency |
-
2014
- 2014-10-28 CN CN201410589628.XA patent/CN104312989A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030077702A1 (en) * | 2001-10-23 | 2003-04-24 | Rajiv Shah | Method for formulating a glucose oxidase enzyme with a desired property or properties and a glucose oxidase enzyme with the desired property |
| CN103088003A (en) * | 2013-01-29 | 2013-05-08 | 江南大学 | Oxidation resistive amylase mutant as well as preparation method and application thereof |
| CN103614350A (en) * | 2013-12-18 | 2014-03-05 | 江南大学 | Glucose oxidase with improved catalytic efficiency |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039362A (en) * | 2015-07-21 | 2015-11-11 | 湖北大学 | Method for improving oxidation resistance of glucose oxidase |
| CN105039362B (en) * | 2015-07-21 | 2019-01-08 | 湖北大学 | A kind of gene mutation improves antioxidative glucose oxidase and its method |
| CN106636021A (en) * | 2016-12-14 | 2017-05-10 | 曹书华 | Method for improving oxidation resistance of glucose oxidase |
| CN107488640A (en) * | 2017-09-18 | 2017-12-19 | 山东隆科特酶制剂有限公司 | A kind of resistance to oxidation low temperature glucose oxidase and its production method and application |
| CN107488600A (en) * | 2017-09-18 | 2017-12-19 | 山东隆科特酶制剂有限公司 | One plant height produces the aspergillus niger of resistance to oxidation low temperature glucose oxidase |
| CN107488600B (en) * | 2017-09-18 | 2020-09-25 | 山东隆科特酶制剂有限公司 | Aspergillus niger capable of producing oxidation-resistant low-temperature glucose oxidase with high yield |
| CN108918625A (en) * | 2018-07-27 | 2018-11-30 | 三诺生物传感股份有限公司 | A kind of preparation method of bio-sensing film, bio-sensing film and monitoring device |
| CN112143717A (en) * | 2019-06-26 | 2020-12-29 | 青岛蔚蓝生物集团有限公司 | Glucose oxidase mutant with improved specific activity |
| CN112143717B (en) * | 2019-06-26 | 2023-02-03 | 青岛蔚蓝生物集团有限公司 | Glucose oxidase mutant with improved specific activity |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104312989A (en) | Glucose oxidase with improved oxidative resistance | |
| CN103614350B (en) | Glucose oxidase with improved catalytic efficiency | |
| CN103525778B (en) | Glucose oxidase mutant with high catalytic activity | |
| CN102994406B (en) | Genetically engineered bacterium for producing glucose oxidase as well as construction and application thereof | |
| CN101298604B (en) | High-temperature acid-resistant alpha-amylase mutant strain and construction method thereof | |
| CN102936585B (en) | Method for producing glucose oxidase via fermentation | |
| CN104357417A (en) | Method for producing glucose oxidase by high-density fermentation of enhanced pichia pastoris | |
| CN101348794A (en) | Encoding gene of high activity glucose oxidase, preparation and use thereof | |
| CN102925375A (en) | Engineered yeasts producing glucose oxidase and construction method and use thereof | |
| CN103937830B (en) | A kind of recombinant bacterium of efficient secretory expression Nattokinase | |
| CN101348795B (en) | Encoding gene of glucose oxidase, preparation and use thereof | |
| CN109251881A (en) | The Escherichia coli recombinant strain and its application of one plant of heterogenous expression nitrile hydratase | |
| CN103849636A (en) | Optimized gene encoding rhizomucor miehei lipase, aspergillus niger strain transformed from optimized gene and use thereof | |
| CN102965292A (en) | Glucose oxidase secretion enhanced bacterial strain and application thereof | |
| CN105238732A (en) | Method for producing L-citrulline by use of whole cell transformation of recombinant corynebacterium crenatum | |
| CN103451163B (en) | The hydrogen peroxide enzyme mutant that a kind of enzyme is lived and thermostability improves | |
| CN104711273A (en) | Method for preparing recombinant-aspergillus niger glucose oxidase and application of recombinant-aspergillus niger glucose oxidase | |
| CN104031899B (en) | A kind of lipase and application thereof | |
| CN102994541B (en) | Method for enhancing secretion of glucose oxidase by coexpression of UPR (unfolded protein response) key genes and downstream target genes | |
| CN107227284A (en) | A kind of restructuring streptococcus zooepidemicus for the micromolecule hyaluronic acid that ferments | |
| JP2021514679A (en) | Recombinant oxalate decarboxylase expressed by filamentous fungal host cells | |
| CN114350641B (en) | Ruminant rumen protozoan xylanase OGXyn1A and application thereof | |
| CN106636021A (en) | Method for improving oxidation resistance of glucose oxidase | |
| CN101914476B (en) | Deep sea elastase gene as well as preparation method and application thereof | |
| JP5534502B2 (en) | Protein having laccase activity, polynucleotide encoding the protein, method for producing the protein, and method for obtaining the polynucleotide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150128 |