CN104297307B - Electrochemical sensor based on stem-and-loop structured probe and preparation method of electrochemical sensor - Google Patents
Electrochemical sensor based on stem-and-loop structured probe and preparation method of electrochemical sensor Download PDFInfo
- Publication number
- CN104297307B CN104297307B CN201410545481.4A CN201410545481A CN104297307B CN 104297307 B CN104297307 B CN 104297307B CN 201410545481 A CN201410545481 A CN 201410545481A CN 104297307 B CN104297307 B CN 104297307B
- Authority
- CN
- China
- Prior art keywords
- probe
- working electrode
- electrochemical sensor
- loop
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The invention discloses an electrochemical sensor based on a stem-and-loop structured probe and a preparation method of the electrochemical sensor. Gold nanoparticles are deposited on the surface of a working electrode of the electrochemical sensor, and the surface of the working electrode is provided with the DNA probe, which has a stem-and-loop structure with a tetrahedral base and is modified with ferrocene, in a self-assembling manner. The invention further discloses a method for arranging the DNA probe having the stem-and-loop structure with the tetrahedral base on the surface of the working electrode of the electrochemical sensor in a self-assembling manner and a method for detecting microRNAs by utilizing the working electrode. According to the electrochemical sensor, the organic DNA nanostructure is combined with the inorganic gold nanoparticles, so that the surface density of the probe can be reasonably regulated and controlled, and the upright conformation of the probe can also be maintained. Thus, the electrochemical detection of a 'signal-on' system can be realized under a low surface density condition. The electrochemical sensor is simple and convenient to operate and ensures that the hybridization efficiency and the sample utilization rate are improved while the experiment cost is lowered. As a result, cancers in early stages can be simply and rapidly detected in a low-cost manner.
Description
Technical field
The present invention relates to a kind of electrochemical sensor, especially relate to a kind of " signal- based on loop-stem structure probe
On " electrochemical sensor and preparation method thereof.
Background technology
Cancer is that at present human health is threatened with one of disease of most serious.According to statistics, in the world because of disease death number
In, cancer occupy second, be only second to angiocardiopathy (free radical biology and medicine, 2004,37,
287-303).The World Health Organization estimates, cancer population is died from the whole world every year according to cancer morbidity, the death rate and demographic data
Sum reaches 6,900,000, and neopathy rate is about 8,700,000.Cancer is that mechanism is not normal causes by controlling cell growth increment, and feature is no
Limit hyperplasia and can be transferred to whole body growth and breeding everywhere, destroy histoorgan structure function, ultimately result in organ failure
And it is dead.
The current cure rate clinically having proved early-stage cancer is at a relatively high, and therefore the early diagnosis of cancer is to cancer
The treatment of patient and prognosis are very crucial.Early at the end of last century, nucleic acids marker just becomes the prominent of early-stage cancer detection technique
Cut, by dna or rna in quantitative determination sample, just can be detected before cancer symptoms appear, for early stage
Cancer detection provides technical support.In recent years, the research of the Human Genome Project show micrornas cell self more
Newly, play important regulating and controlling effect in a series of bioprocess such as increment, differentiation, and its expression and mankind's kinds cancer
Directly related (nature reviews cancer, 2006,6,259-269).Micrornas's (Chinese is referred to as " small rna ")
Quantitative determination is of great significance for the early detection tool of cancer.It is numerous to there is operation in traditional foranalysis of nucleic acids detection method
Defect (biosensors and bioelectronics, the 2006,21,1887- such as trivial, hybridization efficiency is low, with high costs
1892).Electrochemica biological sensor not only can overcome the problem that conventional method exists, and realizes simple, quick, inexpensive inspection
Survey, and sensitivity and the specificity of detection can also be significantly improved, it is easy to accomplish miniaturization, be the hybridization check of nucleic acid and portable
Formula portable medical provides a kind of detection means more effectively, easily realized.
The preparation of probe dna is the key of electrochemica biological sensor.Due to micrornas, to there is sequence short by (19～23
Individual base), the problems such as solution temperature is low for hybridization, similarity degree is high between sequence, straight chain probe and sandwich structure probe cannot meet
Sensitive and accurate detection requires.The probe of two-dimentional loop-stem structure, in the detection need not be to target compared with one-dimensional single-stranded probe
Micrornas is marked and can improve the detection for single base mismatch for the sensitivity realization, thus is applied to target
The detection of molecule.Fan in 2003 etc. has delivered the electrochemical sensor that a kind of utilization loop-stem structure detects dna, largely
Improve nucleic acid detecting sensitivity (pnas, 2003,100,9134-9137).But this electrochemical sensor is " signal-
The sensor of off " system, is easily affected by false Yangxin number.So-called " signal-off ", that is, sensor be not detected by letter
Number when have a reference signal, when target molecule occurs in sample detection signal be less than reference signal.Bockisch in 2005
Report a kind of " signal-on " sensor based on loop-stem structure (nuclear acids research, 2005,33,
1362-4962), but using enzymatic colorimetric determination.Colorimetric method, as a kind of conventional quantitative analysis method, is easily subject to
To reaction condition interference, the degree of accuracy of sensor measurement, sensitivity and range of application are all limited by largely.
Content of the invention
The problems referred to above being existed based on prior art, it is an object of the invention to provide a kind of simple to operate, sensitivity is high, are become
This is low, and the electrochemical sensor being simultaneously again avoided that loop-stem structure is because " signal-off " system is by the impact of false positive number
Produce erroneous judgement makes detection technique.
For achieving the above object, the invention provides a kind of new electrochemical sensor, it combines organic dna folding
Paper art and inorganic golden nanometer particle.The electrochemical sensor that the present invention provides is a kind of probe based on loop-stem structure to cancer
The sensor that mark micrornas is detected.
The technical scheme that the present invention provides be a kind of electrochemical sensor based on loop-stem structure probe it is characterised in that
The working electrode surface deposition of described electrochemical sensor has a golden nanometer particle, and the stem ring with tetrahedron base for the self assembly
Structure and be modified with the dna probe of ferrocene, described loop-stem structure is used for combining target microrna.
Wherein, the dna probe of the described loop-stem structure with tetrahedron base is repaiied by 5 ' ends with loop-stem structure
It is decorated with the single-stranded dna of ferrocene and three 5 ' terminal modified single-stranded dna self assemblies having sulfydryl form.
Preferably, the dna probe of the described loop-stem structure with tetrahedron base can ensure that loop-stem structure is kept upright
Conformation and ferrocene mark be located at tetrahedron base top.
Preferably, constitute tetrahedral structure four single-stranded dnas contain three domains, each domain respectively with other
Article three, single-stranded dna corresponding domain complementarity pairing.
Preferably, described working electrode is gold electrode.
Preferably, described golden nanometer particle is deposited on working electrode surface by electrochemical deposition method.
Preferably, described dna probe is by forming golden mercapto key self assembly between sulfydryl and gold in working electrode surface.
Present invention also offers a kind of method of the working electrode surface self assembly dna probe in electrochemical sensor, bag
Include following steps:
1) terminal modified there is sulfydryl with 5 ' the terminal modified single-stranded dnas having ferrocene being designed with loop-stem structure and three 5 '
Single-stranded dna be self-assembly of one and carry the dna probe that tetrahedron base and top have loop-stem structure, described sulfydryl is located at
Three apex of tetrahedron base, described loop-stem structure is used for combining target microrna；
2) connect electrochemical appliance, three electrodes are immersed in gold chloride and is circulated voltammetric scan, so that golden nanometer particle is sunk
Amass in working electrode surface；
3) by step 1) probe that obtains is self-assembled to step 2 by the sulfydryl on three summits of tetrahedron base) described in
Working electrode surface；
4) by step 3) obtain with probe working electrode immersion sulfydryl hexanol (mch) solution in, make exposed work
Make electrode surface to be covered by sulfydryl hexanol, to close working electrode.
In the present invention, step 1) it is by dna self-assembling technique one-step synthesis method probe, wherein dna self-assembling technique is
This area conventional technique.
Preferably, step 1) described in loop-stem structure stem length can by change dna base pairing number adjust；Excellent
The stem length of choosing is 5～10 bases.
Preferably, step 2) described in working electrode be gold electrode.
Preferably, step 2) described in sedimentation time be 30s～240s；It is highly preferred that sedimentation time is 120s.
Preferably, step 3) self assembling process be: working electrode is placed in dna probe assembles concentration, under room temperature soak
For a period of time.Wherein, the concentration of dna probe assembles concentration is preferably 1nm～10 μm, and preferred concentration is 100nm；Soak time
It is preferably 1h～12h, the preferred time is 3h.
Preferably, step 4) in sulfydryl hexanol solution concentration be 1m, soak time be 1h.
Further, present invention also offers a kind of self assembly using the present invention has the work electricity of tetrahedron dna probe
The method that micrornas is detected with electrochemical process in pole, including step: the working electrode that self assembly is had tetrahedron dna probe soaks
Enter in the solution of testing sample, make probe and target micrornas carry out hybridization reaction, then adopt three traditional electrode body
System, carries out differentiated pulse scanning to reacted working electrode, thus carrying out Electrochemical Detection analysis to reaction.
Preferably, described three-electrode system using platinum plate electrode be to electrode, ag/agcl electrode be reference electrode；Described
Scanning voltage scope is 0～0.6v, and the pulse period is 0.5s.
The principle of above-mentioned Electrochemical Detection step is the ring sequence and described target by dna probe loop-stem structure
The whole sequence Complementary hybridization of microrna.Change by distance between the ferrocene of mark and the working electrode of electrochemical appliance
Produce signal.
Preferably, the concentration of described target microrna is 0.01pm～1 μm, and preferred concentration is 1pm～1 μm, can
To realize quantitative linear gradient detection.
Preferably, described target microrna sequence is selected from mir-1, mir-21, mir-141, mir-155, mir-342-
3p、mir-423-5p、mir-200c.When described target sequence is selected from above-mentioned micrornas, the inventive method can be fine
Ground carries out early detection to the part cancer such as lung cancer, prostate cancer, breast cancer and kidney.
In sum, the present invention detects that the principle of target microrna is as follows:
First the single-stranded dna of a single-stranded dna with loop-stem structure and three sulfydryl modifications being marked with ferrocene is led to
Cross and be self-assembly of dna nano-probe.
Then deposit one layer of golden nanometer particle by being electrochemically-deposited in the working electrode surface of naked gold.
Again dna nano-probe is passed through golden mercapto key self assembly has the working electrode surface of golden nanometer particle in deposition.Pass through
Sulfydryl hexanol enclosed-electrode.
Finally, detection sample, target microrna and dna nano-probe direct cross complementary pairing, loop-stem structure are added
Open, the ferrocene of mark moves to bottom (as shown in Figure 1) from tetrahedron top.The distance between ferrocene and working electrode
Change produces current signal, is checked or analyzed using existing Electrochemical Detection or analytical instrument.
Under the conditions of traditional high density surface probe, due to arrangement closely thus most probes can be kept upright shape
State, label is increased with the distance of working electrode, hinders electronics between the two directly to transmit, electrochemical signals weaken；In the present invention
Low-density surface-probe under the conditions of, after the hybridization of loop-stem structure probe and target molecule, form the double-spiral structure of rigidity, due to
The electrostatic interaction that do not have surrounding probe and state of cannot being kept upright, label and working electrode distance reduce, and are conducive to both
Between electronics directly transmit, electrochemical signals strengthen.Dna tetrahedron provides a natural difference in height so that loop-stem structure is beaten
The range difference opening before and after's label ferrocene with gold electrode surfaces increases, thus after combining target molecule, electrochemical signals change is bright
The aobvious detection that can be used for target molecule, that is, achieve " signal-on " system.
Organic dna nanostructured is combined by the present invention with inorganic golden nanometer particle, by electrochemica biological sensor
Detection means, it is achieved that quantitative determination to cancer markers microrna, reaches the purpose of cancer early detection.The present invention by
In being combined with dna two dimension loop-stem structure and dna three-dimensional structure, both can also be able to keep visiting with the superficial density of Reasonable Regulation And Control probe
The upright conformation of pin, can realize the Electrochemical Detection of " signal-on " system in the case of low superficial density.To target
When micrornas is detected, both need not carry out pcr amplification and be marked without to micrornas.Easy and simple to handle, improve
Hybridization efficiency and sample utilization rate, and reduce experimental cost, realize the inspection simple, quick, inexpensive to early-stage cancer
Survey.
The present invention can be used for clinically carrying out early detection or the examination of cancer, it may also be used for clinical cancer patient's prognosis is given birth to
Deposit the assessment of rate and the transfer of focus.
Compared to existing technology, the present invention has the advantage that
1st, two dimension is combined with three-dimensional dna nano-probe, that is, keep the upright conformation of probe to enhance the spy of sensor simultaneously
The opposite sex.
2nd, organic nano material and inorganic nano material structure, improve the sensitivity of sensor.
3rd, low surface-probe density, realizes the electrochemical sensor of " signal-on " system, reduces the shadow of false positive number
Ring, reduce sensor cost simultaneously.
4th, adopt ferrocene label, it is to avoid the sequence of operations such as enzymatic, simplify detection operation.
5th, can detect that multiple microrna and dna, suitable high flux and multisequencing detect simultaneously using homogenous configuration.
6th, in the microrna of 1pm～1 μm, quantitative linearity detection is realized to concentration, meet clinical requirement.
Brief description
Fig. 1 is change of configuration schematic diagram during structure and the detection of probe of the present invention.
Fig. 2 is the corresponding relation figure of target microrna concentration and sensed current signal in embodiment 1, target molecule hsa-
The concentration of mir-21 is followed successively by 1pm, 10pm, 100pm, 1nm, 10nm, 100nm and 1 μm.
Fig. 3 be in detection realistic simulation sample in embodiment 7 concentration of target molecule hsa-mir-21 and detection signal it
Between linear relationship curve.
Specific embodiment
Below embodiments of the invention are elaborated: the present embodiment is carried out under premised on technical solution of the present invention
Implement, give detailed embodiment and specific operating process, but protection scope of the present invention is not limited to following enforcements
Example.
Embodiment 1
Reagent includes:
Article 4, it is used for being self-assembly of the single-stranded dna of dna probe, a (93bp, molecular weight 28496.0,5 ' terminal modified ferrocene
Ssdna), b (55bp, molecular weight 17018.0,5 ' terminal modified sulfydryl ssdna), (5 ' is terminal modified for 55bp, molecular weight 16898.0 for c
Sulfydryl ssdna), d (55bp, molecular weight 16877.0,5 ' terminal modified sulfydryl ssdna).Four that constitute tetrahedral structure single-stranded
Dna contains three domains, and domain complementarity corresponding with other three single-stranded dnas matches (17 alkali to each domain respectively
Base to).A forms a loop-stem structure at 5 ' ends, and stem structure is 6 base-pairs, and ring structure is used for identifying target for 22 bases
Molecule.
A (seq id no:1):
5’-fc-tccagcgttcaacatcagtctgataagctaacgctgttacattcctaagtctgaaacattaca
gcttgctacacgagaagagccgccatagta-3’
B (seq id no:2):
5’-hs-c6-tatcaccaggcagttgacagtgtagcaagctgtaatagatgcgagggtccaatac-3’
C (seq id no:3):
5’-hs-c6-tcaactgcctggtgataaaacgacactacgtgggaatctactatggcggctcttc-3’
D (seq id no:4):
5’-hs-c6-ttcagacttaggaatgtgcttcccacgtagtgtcgtttgtattggaccctcgcat-3’
Wherein, loop-stem structure sequence on a chain:
5’-tccagcgttcaacatcagtctgataagctaacgctgtt-3’
Target microrna sequence (seq id no:5):
Hsa-mir-21:5 '-uagcuuaucagacugauguuga-3 ' (lung cancer/prostate cancer index)
Target microrna and the ring structure sequence hybridization complementary pairing of loop-stem structure probe.
All of chemical reagent is all that pure process of analysis is further purified.All solution process water using depc and join
System.
Detecting step is as follows:
The first step, self assembly dna probe.
By tetra- single-stranded dnas of a, b, c, d tm buffer (20mm tris, 50mm mgcl2, ph8.0) and dissolved dilution one-tenth
Concentration is 100 μm of solution.Take the solution of 2 μ tetra- single-stranded dnas of l a, b, c, d, the tm buffer (20mm with 37 μ l respectively
Tris, 50mm mgcl2, ph 8.0) and 5 μ l tcep solution (30mm) be mixed into concentration be 4 μm, the solution of volume 50 μ l.95
DEG C heating 2min after be cooled to 4 DEG C immediately, continue at least 5min.
Second step, depositing gold nanoparticles.
Take the gold disc electrode of diameter 2mm, be first polishing to minute surface no marking with 0.05 μm of aluminum oxide, then use " Piranha " molten
Liquid (98% concentrated sulfuric acid and 35% hydrogen peroxide 3:1 volume mixture) soaks 10min, more ultrasonic successively with pure water and acetonitrile
5min, is placed in 1m sulfuric acid and is circulated voltammetric scan.Scanning voltage 0～1.5v, sweep speed 100mv/s, after scanning 20 circle
Electrochemical deposition 120s in 10mm gold chloride.
3rd step, dna probe is self-assembled to working electrode surface.
Electrode is placed in the dna probe assembles concentration of 100nm, under room temperature, soaks 3h.
4th step, closes working electrode with sulfydryl hexanol.
1h in 1m sulfydryl hexanol solution will be soaked in after electrode taking-up ultrapure water.
5th step, carries out hybridization reaction and detects.
By target microrna with containing 1m naclo4Pb cushioning liquid (ph 7.4) be diluted to variable concentrations gradient
(1pm, 10pm, 100pm, 1nm, 10nm, 100nm and 1 μm).By working electrode press concentration from low to high successively with target
Microrna is hybridized, and time control is 15min.After quick complementary pairing, electrode is taken out, rinse electricity with pbs cushioning liquid
Pole, inserts and carries out differentiated pulse scanning in pbs.Electrochemical Detection uses chi electrochemical analyser (chi660) and using tradition
Three-electrode system, platinum plate electrode be to electrode, ag/agcl electrode be reference electrode.Scanning voltage scope 0～0.6v, pulse
Cycle 0.5s.Testing result is as shown in Figure 2.
Embodiment 2-6
Reagent includes:
A chain is changed according to the different of early screening cancer species from target micrornas, refers to following table.
Detecting step is with embodiment 1.
Embodiment 7
Reagent is with embodiment 1.
Detecting step 1～4 is with embodiment 1.
5th step, target microrna:hsa-mir-21 cell lysis buffer is become 1 μm of concentration.By working electrode
It is placed in reaction system and hybridize 15min with target microrna.After quick complementary pairing, electrode is taken out, use pbs cushioning liquid
Rinse electrode, insert and in pbs, carry out differentiated pulse scanning.Electrochemical Detection using chi electrochemical analyser (chi660) and is adopted
With traditional three-electrode system, platinum plate electrode is to be reference electrode to electrode, ag/agcl electrode.Scanning voltage scope 0～
0.6v, pulse period 0.5s.Close between the concentration of target molecule hsa-mir-21 and detection signal in detection realistic simulation sample
System, its result is as shown in Figure 3.
By detecting to microrna in cell pyrolysis liquid environment, illustrate that this probe can apply to actual complex
In sample.
The preferred embodiment of the present invention described in detail above.It should be appreciated that those of ordinary skill in the art is no
Need creative work just can make many modifications and variations according to the design of the present invention.Therefore, all technology in the art
It is available that personnel pass through logical analysis, reasoning, or a limited experiment under this invention's idea on the basis of existing technology
Technical scheme, all should be in the protection domain being defined in the patent claims.
Claims (8)
1. a kind of electrochemical sensor based on loop-stem structure probe is it is characterised in that the work of described electrochemical sensor is electric
Pole surface deposition has a golden nanometer particle, and the loop-stem structure with tetrahedron base for the self assembly and be modified with the dna of ferrocene
Probe, described loop-stem structure is used for combining target microrna；Wherein, the dna of the described loop-stem structure with tetrahedron base
Probe terminal modified has the single-stranded of sulfydryl by 5 ' the terminal modified single-stranded dnas having ferrocene with loop-stem structure and three 5 '
Dna self assembly forms；The loop-stem structure of the dna probe of the described loop-stem structure with tetrahedron base be kept upright conformation and
Ferrocene mark is located at the top of tetrahedron base.
2. a kind of method of the working electrode surface self assembly dna probe in electrochemical sensor it is characterised in that include below
Step:
1) with 5 ' the terminal modified single-stranded dnas having ferrocene being designed with loop-stem structure and three 5 ' terminal modified lists having sulfydryl
Chain dna is self-assembly of one with tetrahedron base and top has the dna probe of loop-stem structure, and described sulfydryl is located at four sides
Three apex of body base, described loop-stem structure is used for combining target microrna；
2) connect electrochemical appliance, three electrodes are immersed in gold chloride and is circulated voltammetric scan, so that golden nanometer particle is deposited on
Working electrode surface；
3) by step 1) probe that obtains is self-assembled to step 2 by the sulfydryl on three summits of tetrahedron base) described in work
Electrode surface；
4) by step 3) obtain with probe working electrode immersion sulfydryl hexanol solution in, make exposed working electrode surface
Covered by sulfydryl hexanol, to close working electrode.
3. the method for the working electrode surface self assembly dna probe in electrochemical sensor according to claim 2, it is special
Levy and be, step 1) it is by dna self-assembling technique one-step synthesis method probe.
4. the method for the working electrode surface self assembly dna probe in electrochemical sensor according to claim 2, it is special
Levy and be, step 1) described in the stem length of loop-stem structure be 5～10 bases.
5. the method for the working electrode surface self assembly dna probe in electrochemical sensor according to claim 2, it is special
Levy and be, step 2) described in working electrode be gold electrode.
6. the method for the working electrode surface self assembly dna probe in electrochemical sensor according to claim 2, it is special
Levy and be, step 3) self assembling process be: working electrode is placed in dna probe assembles concentration, soaks a period of time under room temperature.
7. the working electrode with tetrahedron dna probe of the method self assembly described in a kind of utilization any one of claim 2-6
The method of detection microrna is it is characterised in that include step: the working electrode that self assembly is had tetrahedron dna probe immerses
In the solution of testing sample, make probe and target microrna carry out hybridization reaction, then adopt traditional three-electrode system, right
Reacted working electrode carries out differentiated pulse scanning, thus carrying out Electrochemical Detection analysis to reaction.
8. the method for detection microrna according to claim 7 is it is characterised in that the sequence of described microrna is selected from
In seq id no:5, seq id no:7, seq id no:9, seq id no:11, seq id no:13, seq id no:15,
In seq id no:17 one.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410545481.4A CN104297307B (en) | 2014-10-15 | 2014-10-15 | Electrochemical sensor based on stem-and-loop structured probe and preparation method of electrochemical sensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410545481.4A CN104297307B (en) | 2014-10-15 | 2014-10-15 | Electrochemical sensor based on stem-and-loop structured probe and preparation method of electrochemical sensor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104297307A CN104297307A (en) | 2015-01-21 |
| CN104297307B true CN104297307B (en) | 2017-01-18 |
Family
ID=52317128
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410545481.4A Expired - Fee Related CN104297307B (en) | 2014-10-15 | 2014-10-15 | Electrochemical sensor based on stem-and-loop structured probe and preparation method of electrochemical sensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104297307B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104962615B (en) * | 2015-06-04 | 2018-05-11 | 西南大学 | Biology sensor of DNA paper foldings nanostructured-nanogold based on aptamers modification and its preparation method and application |
| CN108593742B (en) * | 2018-05-03 | 2020-08-18 | 南京工业大学 | Electrochemical aptamer sensor for quantitatively detecting aflatoxin B1 and application thereof |
| CN109295205A (en) * | 2018-10-17 | 2019-02-01 | 南京宁贝欣医疗科技有限公司 | A kind of method that quickly can detect a variety of miR simultaneously |
| CN109632903A (en) * | 2018-12-05 | 2019-04-16 | 泰山学院 | A method of in glassy carbon electrode surface fabricated in situ single layer uniform gold nanoparticle |
| CN115715806A (en) * | 2021-08-24 | 2023-02-28 | 华中科技大学 | Temperature-controlled nano-drug release system and application thereof |
| CN115518701B (en) * | 2022-09-30 | 2024-09-13 | 天津医科大学 | Preparation and detection method of gold nanoflower microarray chip for miRNA detection |
| CN115807060A (en) * | 2022-12-06 | 2023-03-17 | 中国科学院苏州生物医学工程技术研究所 | miRNA detection sensor, kit and detection method based on DNA tetrahedral local structure degradation |
| CN116593546B (en) * | 2023-04-27 | 2024-07-30 | 无锡学院 | Ortho-position connection electrochemiluminescence analysis method for detecting gonyautoxin |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102899418B (en) * | 2012-11-09 | 2014-07-16 | 中国科学院上海应用物理研究所 | Electrochemical miRNA (micro Ribose Nucleic Acid) detection method based on DNA (Deoxyribose Nucleic Acid) three-dimensional nano structure probe |
| CN103698374A (en) * | 2013-12-23 | 2014-04-02 | 邢士超 | Electrochemical sensor of DNA (deoxyribonucleic acid) probe based on fluorescein and sulfydryl modification |
| CN103698375B (en) * | 2013-12-27 | 2016-06-29 | 上海市计量测试技术研究院 | A kind of method detecting miRNA |
| CN103743802A (en) * | 2014-01-10 | 2014-04-23 | 南京师范大学 | DNA biosensor based on three-dimensional ordered gold doped nano titanium dioxide electrode as well as preparation method and application of DNA biosensor |
-
2014
- 2014-10-15 CN CN201410545481.4A patent/CN104297307B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| 《Hybridization Chain Reaction Amplification of MicroRNA Detection with a Tetrahedral DNA Nanostructure-Based Electrochemical Biosensor》;Zhilei Ge 等;《Analytical Chemistry》;20140122;第86卷;2124-2130页 * |
| 《Scaffolded biosensors with designed DNA nanostructures》;Hao Pei 等;《NPG Asia Materials》;20130614;第5卷;1-9页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104297307A (en) | 2015-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104297307B (en) | Electrochemical sensor based on stem-and-loop structured probe and preparation method of electrochemical sensor | |
| Eivazzadeh-Keihan et al. | Recent advances on nanomaterial based electrochemical and optical aptasensors for detection of cancer biomarkers | |
| ES2818586T3 (en) | Biosonde and methods of using them | |
| CN105821132B (en) | A method of the specific Single stranded DNA concentration of Electrochemical Detection based on exonuclease and nucleic acid probe | |
| CN105784796B (en) | A kind of sensitive determination method of the aptamer sensor based on gold/molybdenum disulfide/graphene nanocomposite material to lysozyme | |
| Hatami et al. | Zinc oxide-gold nanocomposite as a proper platform for label-free DNA biosensor | |
| Ruan et al. | Target-triggered assembly in a nanopipette for electrochemical single-cell analysis | |
| CN106568936B (en) | The preparation method and applications of miRNA-21 electrochemical luminescence immunosensors based on multifunction molybdenum disulfide | |
| CN110243891A (en) | A kind of label-free homogeneous electrochemical biosensor method detecting cancer cell | |
| CN105593379A (en) | Systems, methods and devices for electrochemical detection using helper oligonucleotides | |
| CN107064259A (en) | Based on coacetylase Au（I）The preparation method and application of the electrochemica biological sensor of coordination polymer | |
| CN110106232A (en) | Based on target catalysis without the unmarked double tail hybrid organisms sensors of enzyme and preparation method | |
| CN109001167A (en) | A kind of method and kit based on the strand displacement signal of aptamers and carbon dots amplification fluorescent optical sensor detection atriphos | |
| CN106872447A (en) | Strengthen the preparation method of the electrochemical luminescence biology sensor of Luminol | |
| CN103743802A (en) | DNA biosensor based on three-dimensional ordered gold doped nano titanium dioxide electrode as well as preparation method and application of DNA biosensor | |
| CN109797200A (en) | Ratio-type telomere enzyme active quantitive detection method | |
| CN110423798A (en) | A kind of electrochemical method detecting staphylococcus aureus | |
| Zhao et al. | 3D MoS2-AuNPs carbon paper probe for ultrasensitive detection and discrimination of p53 gene | |
| CN104561274B (en) | A kind of method of microRNA contents in detection prepare liquid | |
| Mohammadi et al. | Electrochemical biosensing of influenza A subtype genome based on meso/macroporous cobalt (II) oxide nanoflakes-applied to human samples | |
| CN203732494U (en) | Graphene field effect transistor biosensor | |
| CN108445067A (en) | A kind of signal amplification RNA nano biological sensors without enzyme of dual signal, preparation method and applications | |
| Liu et al. | Coupling technique of random amplified polymorphic DNA and nanoelectrochemical sensor for mapping pancreatic cancer genetic fingerprint | |
| CN106501343B (en) | A method of heavy metal ion is detected based on polymerase isothermal amplification technique | |
| yong Cao et al. | A double signal amplification-based homogeneous electrochemical sensor built on catalytic hairpin assembly and bisferrocene markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170118 Termination date: 20191015 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |