CN104293979A - Gene chip and kit for infectious bronchitis viruses and/or infectious laryngotracheitis viruses - Google Patents

Abstract

The invention discloses a gene chip and a kit for infectious bronchitis viruses and/or infectious laryngotracheitis viruses. The gene chip and detection kit disclosed by the invention can accurately and effectively detect infectious bronchitis viruses and/or infectious laryngotracheitis viruses, and are strong in specificity, high in sensitivity, short in time consuming and rapid in detection, and has a good application prospect.

Description

The gene chip of avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus and test kit

Technical field

The present invention relates to a kind of gene chip and the test kit that detect chicken avian infectious bronchitis virus and avian infectious laryngotracheitis virus.

Background technology

Along with improving constantly of China's aviculture intensive degree, the generation of various diseases is also in the trend risen year by year.The aggregate level of China's poultry disease prevention and control is not high, and the occurrence and harm of poultry diease is still very serious, and according to incompletely statistics, the disease that the China of harm at present aviculture is produced reaches more than 80 and plants, and wherein transmissible disease accounts for 75% of poultry diease sum, and harm is serious.Also there is new feature in the generation of poultry diease simultaneously, the transmissible disease as new constantly occurs; The kind of kainogenesis poultry diease increases; There is new change in the atypia of infectious disease incidence and cause of disease; Polyinfection and compound disease make disease more complicated.

Chicken infectious bronchitis and these 2 kinds of diseases of infectious laryngotracheitis of chicken are widely current in China and many countries and regions, chicken group by virus attack can cause large quantities of death, growing of resistance to mistake is slow, mortality increases, and disturb the immunizing power of other vaccine, make the easy secondary infection Other diseases of chicken, and cause serious financial loss.These 3 kinds sick common traits can cause respiratory symptom, and symptom is quite similar, are difficult to accurately judge in clinical diagnosis, also very easily obscure mutually with other respiratory tract disease such as bird flu, chronic respiratory tract disease etc.Existing poultry diease detects or Monitoring techniques all exists unsurmountable limitation, as the differentiation etc. of the polyinfection to epidemic disease, inapparent infection and vaccine virus and open country poison, all there is certain difficulty when detecting.Polyinfection simultaneously for multiple epidemic disease needs same method or different methods repeatedly to detect, and is therefore necessary to strengthen detecting animal epidemic or monitoring the research of new technique.

At present, Antigen isolation and identification and conventional serological method are generally adopted to these 2 kinds sick diagnosis, but the deficiency such as these methods exist trivial operations, waste time and energy, susceptibility is poor.Particularly when chicken group exists the multiple virus infection such as chicken infectious bronchitis and infectious laryngotracheitis of chicken, be difficult to apply these traditional methods and carry out rapid detection and differential diagnosis, have impact on the effective anti-system to these epidemic diseases to a certain extent.All establish PCR/RT-PCR detection method both at home and abroad recently, and multi-PCR detection method, but the requirement detecting multiple cause of disease polyinfection more fast and accurately can't be met.

The development of Molecular Biology and technology, particularly gene chip has the feature of high-throughput, diversity, microminiaturization and automatization, these characteristics make the information above it be read out rapidly and accurately, require seldom to the amount of sample, save reagent and cost, processing speed is accelerated greatly, in the detection to various pathogenic agent, the determination and analysis of pathogen gene is the most believable, and biochip technology can carry out the analysis of quantitative and qualitative analysis to the RNA of various pathogenic agent, thus the degree of clinician to the kind infected and infection is helped to analyze.

Publication number be 1616679 and 1616678 patent application individually disclose to detect and comprise avian infectious bronchitis virus and avian infectious laryngotracheitis virus etc. 10 kinds or 9 kinds of viral gene chips, but there is no specificity and the sensitivity test of chip in this file, can not illustrate that it can be special and detect avian infectious bronchitis virus and avian infectious laryngotracheitis virus delicately simultaneously.

Summary of the invention

In order to solve the problem, the invention provides new gene chip and the test kit of a kind of special strong, highly sensitive detection avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus.

The present invention detects the gene chip of avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus, and it comprises solid phase carrier and is fixed on the probe on solid phase carrier; Described probe to comprise shown in SEQ ID NO:1 ~ 2 any one or two gene fragments, and/or any one or two gene fragments shown in SEQ ID NO:3 ~ 4.

Gene chip, be DNA microarray again, refer to and refer to, by different methods, biomolecules (oligonucleotide, cDNA, genomic DNA, polypeptide, antibody, antigen etc.) is bonded to the biomolecules dot matrix that the solid phase mediators such as silicon chip, sheet glass (pearl), plastic sheet (pearl), gel, nylon membrane are formed, its outstanding feature is microminiaturized, integrated, parallelization and high-throughput.

Preferably, it also comprises position probe, and position probe is the gene fragment shown in SEQ ID NO:13.

The present invention detects the test kit of avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus, it comprises the reagent of aforesaid gene chip and amplification avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus gene, wherein, the reagent of amplification chicken infectious bronchitis virogene comprises primer pair shown in SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8; The reagent of amplification avian infectious laryngotracheitis virus gene comprises primer pair shown in SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12.

Described test kit also comprises primer pair shown in SEQ ID NO:14 ~ 15.

In described primer pair, shown in SEQ ID NO:5,7, shown in upstream primer and SEQ ID NO:6,8, the mol ratio of downstream primer is 1:10; Shown in SEQ ID NO:9,11, shown in upstream primer and SEQ ID NO:10,12, the mol ratio of downstream primer is 1:20.

Described upstream primer is marked with fluorescence dye.

Described test kit also includes Radioactive colloidal gold.

Radioactive colloidal gold be by hydrochloro-auric acid (HAuCl4) at reductive agent as under the effect such as white phosphorus, xitix, Sodium Citrate, tannic acid, can be grouped to a certain size gold grain, and become a kind of stable colloidal state due to electrostatic interaction, form electronegative hydrophobic sol solution, become stable colloidal state due to electrostatic interaction, therefore claim Radioactive colloidal gold.

Radioactive colloidal gold of the present invention is prepared by the following method: get 200 mL sterilizing ultrapure waters and 2mL1%HAuCl4 is mixed in 500ml large beaker, then measures 20mL and is sub-packed in 10 50mL small beakers of numbering 1-10, uses heating magnetic stirring apparatus that the colloidal gold solution of packing is heated 5min successively, add 1% citric acid three sodium solution fast, add-on is respectively 0.1mL, 0.2mL, 0.24mL, 0.28mL, 0.32mL, 0.36mL, 0.4mL, 0.6mL, 1.0mL, 1.2mL.Color from pale yellow becomes rapidly black when becoming redness again, then Keep agitation 10min stops, and waits solution to be cooled to room temperature, filters, can obtain required Radioactive colloidal gold with cellulose nitrate film.

The present invention also to provide shown in SEQ ID NO:1 or 2 any one or two gene fragments, and/or any one or two gene fragments shown in SEQ ID NO:3 or 4 detect avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus in preparation gene chip in purposes.

Preferably, described gene chip also comprises position probe, and position probe is the gene fragment shown in SEQ ID NO:13.

Present invention also offers primer pair shown in SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8, preparing with primer pair shown in SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12 purposes simultaneously increased in the reagent of avian infectious laryngotracheitis virus and avian infectious bronchitis virus.

To present invention also offers shown in SEQ ID NO:1 ~ 2 primer pair shown in any one or two gene fragments and SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8, and/or primer pair shown in any one or two gene fragments shown in SEQ ID NO:3 ~ 4 and SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12 detect avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus in preparation test kit in purposes; Wherein, primer pair is amplifing reagent; SEQ ID NO:1 ~ 4 are detection probes.

In described primer pair, shown in SEQ ID NO:5,7, shown in upstream primer and SEQ ID NO:6,8, the mol ratio of downstream primer is 1:10; Shown in SEQ ID NO:9,11, shown in upstream primer and SEQ ID NO:10,12, the mol ratio of downstream primer is 1:20.

Gene chip of the present invention can detect avian infectious laryngotracheitis virus and avian infectious bronchitis virus, high specificity at the same time or separately, highly sensitive, and the minimal detectable concentration of two-strain sample is 1.8 × 10 ⁴copy/μ L (0.2pg/ μ L), consuming time short, detect fast, have a good application prospect.

The embodiment of form by the following examples, is described in further detail foregoing of the present invention.But this should be interpreted as that the scope of the above-mentioned theme of the present invention is only limitted to following embodiment.The technology that all contents recorded based on claims of the present invention realize all belongs to scope of the present invention.

Accompanying drawing explanation

The arranged situation of Fig. 1 DNA microarray;

Fig. 2 Radioactive colloidal gold affect result;

Fig. 3 specificity experiments result;

Fig. 4 sensitivity experiment result.

Embodiment

One, experiment material and instrument

Bacterial strain: ILTV type strain, IBV H120 strain, all purchased from China Veterinary Drugs Supervisory Inst., are preserved by this laboratory.

Main agents and substratum: Omega plasmid extraction kit, be purchased from Omega biotech company; 2 × Taq PCR Master Mix, Reverse Transcription box, total RNA extraction reagent box, sky root DNA extraction kit and 100bp DNA Ladder; Amp: getting 1gAmp, to be dissolved in concentration in 10mL sterilizing ultrapure water be 100mg/mL; LB liquid medium: Tryptones 2.0g, sodium-chlor 2.0g, yeast extract 1.0g, after being dissolved in 180.0mL ultrapure water completely, regulate pH=7.2 with NaOH, constant volume to 200mL, autoclaving 30min, be chilled to about 55 DEG C, 100mLLB adds the Amp of 100ul, 4 DEG C of preservations; Solid LB media: the LB to 100mL adds the agar powder of 1.5g, is chilled to about 55 DEG C after autoclaving, add the 100mg/mL Amp of 100uL, pour in flat board, and 4 DEG C save backup; 50 × TAE:0.5mol/L EDTA50.0mL, Glacial acetic acid 28.55mL, Tris 121.0g, regulate pH=8.0 with sodium hydroxide, constant volume is to 500mL.Amino-group substrate: amino slide glass, spotting buffer: spotting buffer, all purchased from the proud biotechnology company limited in Shanghai hundred.Cy3-dCTP is purchased from Amersham company of the U.S.; 100 × Denhardt: bovine serum albumin 0.2g, polyethylene adjoins pyrrolidone 0.2g, and ficoll 0.2g, is added to ddH ₂dissolve completely in O 10mL; 20 × SSC: Trisodium Citrate 8.82g, sodium-chlor 17.53g, ultrapure water 80.0mL, NaOH adjust pH=7.0, constant volume to 100.0mL, 4 DEG C of preservations; Washing lotion 1:2 × SSC/0.1%SDS, washing lotion 2:0.2 × SSC/0.1%SDS, washing lotion 3:0.16 × SSC/0.1%SDS, washing lotion 4:ddH2O

Key instrument equipment: Bechtop, SW-CJ-2FD, SuZhou Antai Air Tech Co., Ltd.; Electronic balance, Sartorius BP 310S; Constant-temperature table, Thermo Forma, the U.S. produces; Grads PCR instrument, P × 2, Thermo hybaid, the U.S. produces; Ultrapure water instrument, Milli Qplus, method is domestic; Electrophoresis apparatus, POWER Pac300, Bio-RAD, Italy produces; Gel electrophoresis imaging system, Bio-RAD, Italy produces; High speed freezing centrifuge 3K18 type, Sigma, Germany produces; Nucleic acid-protein detector, SmartSpaee TM 3010, Bio-RAD, Italy produces; Hybridization Oven, Thermo hybaid, the U.S. produces; smartArrayer 16 gene chip sample applying instrument, Capitalbio Corporation, Beijing Bo Ao biotech firm; Vacuum drains machine, SinBo, and is produced from Hong Kong; Gene chip hybridization box, Beijing Bo Ao biotech firm; luxScan 10K gene chip scanning instrument, Capitalbio Corporation, Beijing Bo Ao biotech firm.

The preparation of embodiment 1 gene chip of the present invention

1, bacterial strain

ILTV type strain, IBV H120 strain.

2, experimental technique

The preparation of 2.1 PCR primer, detection probes

(1) cause of disease specific probe is designed: by the compare of analysis of the nucleotide sequence to the avian infectious bronchitis virus of including in GenBnak, avian infectious laryngotracheitis virus, selected conservative region sequence: IBV-IBM/IBN, ILTV-TK/gB.Detect multipair probe for conserved sequence design, select the probe sequence of high specificity.

(2) Auele Specific Primer of designing probe sequence: for above-mentioned conservative probe sequence, utilizes the design Auele Specific Primers such as bioinformatics software DNAman, Primer5.0.Auele Specific Primer is synthesized by Shanghai bio-engineering corporation.

(3) probe preparation: extract avian infectious bronchitis virus, avian infectious laryngotracheitis virus with a small amount of virus/liquid sample DNA/RNA extraction agent box, above-mentioned Auele Specific Primer is utilized to carry out pcr amplification to two kinds of cause of disease nucleic acid, purifying concentration determination.

Reverse transcription system and condition (method with reference to PrimeScript RT reagent Kit)

PCR amplification system and condition:

Reaction conditions is as follows:

(4) screening of probe: synthetic probe is dissolved and makes DNA microarray with gene chip sample applying instrument point on amination glass substrate after appropriate dilution, carry out probe screening by cross experiment, finally obtain detecting specific probe needed for DNA microarray for the preparation of the present invention: IBV-IBM/IBN, ILTV-TK/gB.

The sequence of primer and probe is as follows:

SEQ?ID?NO：1(IBV-M)

Source gene source: IBV H120 strain

Gene size and sequence: 368 bp

ACACAGGAGGTCTTGTCGCAGCGATAATACTTACTGTGTTTGCGTGTCTTTCTTTTGTAGGTTATTGGATCCAGAGTATTAGACTCTTTAAGCGGTGTAGATCTTGGTGGTCATTTAACCCAGAATCTAACGCCGTAGGTTCAATACTCCTAACTAATGGTCAACAATGTAATTTTGCTATAGAGAGTGTGCCGATGGTGCTTTCTCCTATTATAAAGAATGGTGTTCTTTATTGTGAGGGTCAGTGGCTTGCTAAATGTGAACCAGACCACTTGCCTAAAGACATATTTGTATGCACACCAGATAGACGTAATATCTATCGTATGGTGCAGAAATACATTGGTGACCAAAGCGGAA?ATAAGAAAAGG

SEQ?ID?NO：2(IBV-N)

Source gene source: IBV H120 strain

Gene size and sequence: 292bp

CAATACCCGCTACGATTCTCAGATGGAGGACCTGATGGTAATTTCCGTTGGGACTTCATTCCAATAAATCGTGGTAGGAGTGGAAGATCAACAGCGGCTTCATCAGCAGCATCTAGTAGAGCACCGTCGCGTGATGGCTCGCGTGGACGTAGAAGCGGAGCTGAAGATGATCTTATAGCTCGTGCAGCAAAGATCATTCAGGATCAGCAGAAGAAGGGTTCTCGCATTACTAAAGCTAAGGCCGATGAAATGGCTCATCGCCGGTATTGTAAGCGTACTATCCCACCTGGTT

SEQ?ID?NO：3(ILTV-TK)

The source gene source of clone gene: ILTK type strain

Gene size and sequence: 279 bp

TCCTCGTAGATAGGCACCCACTCGCGGCATGTTTGTGTTTCCCTGTTGCACAATATCTAAGCGGAGCGCTCGAATTTGGAGATTTAATAACTTTATTGTCAGGAATTCCTGACATTCCAACACACTCCAACATTGTTTTAATGGATTTGGATATTTGCGAACAGGCACGGCGTATAATACAAAGGGGGCGCCCAGGGGAAACGGTCGACTGGACGTATTTGTGTGCATTACGTAACTCGTACATCTGCCTCATGAATACTACCACCTACCTCCAACGTA

SEQ?ID?NO：4(ILTV-gB)

Source gene source: ILTV type strain

Gene size and sequence: 189 bp

TGCTGGAATAATAGACCCTCGTGATACAGCCAGCATGGATGTTGGAAAAATCTCTTTCTCCGAAGCCATTGGGTCGGGGGCACCGAAAGAACCCCAGATTAGAAACAGAATTTTTGCGTGCTCATCTCCAACTGGCGCCAGTGTTGCGAGGCTTGCCCAGCCACGACATTGTCACCGACATGCCGATTC

SEQ?ID?NO：5～6(IM-primer)

F?5`-ACACAGGAGGTCTTGTCGCAG-3'

R?5`–CCTTTTCTTATTTCCGCTTTGG-3`

SEQ?ID?NO：7～8(IN-primer)

F?5`-CAATACCCGCTACGATTCTCAG-3`

R?5`-AACCAGGTGGGATAGTACGCTTA-3`

SEQ?ID?NO：9～10(TK-primer)

F?5`-TCCTCGTAGATAGGCACCCACTC-3`

R?5`-TACGTTGGAGGTAGGTGGTAGTATTCA-3`

SEQ?ID?NO：11～12(gB-primer)

F?5`-TGCTGGAATAATAGACCCTCGT-3`

R?5`-GAATCGGCATGTCGGTGA-3`

The sequence (SEQ ID NO:13) of gene location

aaagcgaggc?tttttggcct?ctgtcgtttc?ctttctctgt?ttttgtccgt?ggaatgaaca?atggaagtcaacaaaaagca?gctggctgac?attttcggtg?cgagtatccg?taccattcag?aactggcagg?aacagggaatgcccgttctg?cgaggcggtg?gcaagggtaa?tgaggtgctt?tatgactctg?ccgccgtcat?aaaatggtatgccgaaaggg?atgctgaaat?tgagaacgaa?aagctgcgcc?gggaggttga?agaactgcgg?caggccagcgaggcagatct?ccagccagga?actattgagt?acgaacgcca?tcgacttacg?cgtgcgcagg?ccgacgcacaggaactgaag?aatgccagag?actccgctga?agtggtggaa?accgcattct?gtactttcgt?gctgtcgcggatcgcaggtg?aaattgccag?tattctcgac?gggctccccc?tgtcggtgca?gcggcgtttt?ccggaactggaaaaccgaca

SEQ ID NO:14 ~ 15 (amplimer of gene location complementary sequence)

F：AAAGCGACGCAATGAGGCACT

R：GTTCCACGACCGCAACTGC

For verifying the validity of primer of the present invention, carry out the symmetrical PCR and multiple symmetrical PCR of substance respectively according to following system and condition, be divided into two groups to increase respectively, two groups of primers are respectively, system 1:ILTV-gB, IBV-N; System 2:ILTV-TK, IBV-M.

PCR marks system:

The concentration of upper and lower primer is all 25umol/L.

In test, Cy3-dCTP fluorescein uses final concentration to be 2.5umol/L, when adding fluorescein and operation later all carry out in darkroom.Reaction conditions is as follows:

After having increased, get 10 μ L products, with 2% agarose gel electrophoresis analysis, evaluate between primer and whether can influence each other.

The structure of 2.2 standard plasmids

2.2.1 the genomic extracting of IBV

The total serum IgE extracting of IBV adopts the total RNA extraction reagent box of sky root, and with reference to illustrating, concrete operation method is as follows:

1) directly get 200 μ L virus allantoic fluids in 1.5mL centrifuge tube, add 600 μ L lysates, mixing of fully vibrating;

2) homogenised sample is placed 5min at 15-30 DEG C;

3) 4 DEG C, the centrifugal 5min of 12000r/min, is drawn onto supernatant liquor in new centrifuge tube;

4) add 200 μ L chloroforms, acutely vibrate 15sec up and down, and room temperature leaves standstill 3min;

5) 4 DEG C, the centrifugal 10min of 12000r/min, sample can produce layering, forwards in new pipe lightly by aqueous phase colourless for the superiors;

6) add 0.5 times of volume dehydrated alcohol, mixing, transfers in adsorption column, 4 DEG C, the centrifugal 30sec of 12000r/min;

7) 500 μ L protein liquid removals are added, 4 DEG C, the centrifugal 30sec of 12000r/min;

8) add 600 μ L rinsing liquids, leave standstill 2min, 4 DEG C, the centrifugal 30sec of 12000r/min; Repeat once

9) 4 DEG C, the centrifugal 2min of 12000r/min, discards residual liquid;

10) forwarded in RNase-Free centrifuge tube by adsorption column, add 50 μ L RNase-Free ultrapure waters, room temperature leaves standstill 2min, 4 DEG C, the centrifugal 2min of 12000r/min.The viral RNA that namely centrifugate obtain, saves backup or directly carries out reverse transcription at-20 DEG C.

2.2.2 the genomic extracting of ILTV

The DNA extracting of ILTV adopts sky root blood/cell/tissue genome DNA extracting reagent kit, and with reference to illustrating, concrete operation method is as follows:

1) get-20 DEG C of chorioallantoic membrane 10mg preserved, milled processed is cell suspension, then the centrifugal 1min of 12000r/min, uses up supernatant, adds 200 μ L damping fluid GA, and vibration is to thoroughly suspending;

2) add 20 μ L Proteinase K solution, be positioned over 56 DEG C after mixing and dissolve to chorioallantoic membrane.

3) add 200 μ L damping fluid GB, fully put upside down mixing, place 10min for 70 DEG C.

4) 200 μ L dehydrated alcohols are added, fully vibration mixing 15sec.

5) mixture is all added in adsorption column, the centrifugal 30sec of 12000r/min.

6) in adsorption column, 500 μ L damping fluid GD are added, the centrifugal 30sec of 12000r/min.

7) in adsorption column, add 600 μ L rinsing liquid PW, the centrifugal 30sec of 12000r/min, repeats once.

8) 12000r/min is empty from 2min, and ambient temperatare is put and dried for 5 minutes.

9) pillar is put on clean centrifuge tube, adds 50 μ L elutriant TE, place the centrifugal 2min of 2min, 12000r/min.The centrifugate of collecting and viral DNA, or Direct PCR increases or saves backup at-20 DEG C.

2.2.3 the RT-PCR of probe gene and pcr amplification

With the RNA of the IBV of extracting for template, with Random 6 primers for primer synthesizes cDNA, reaction system is as follows:

RT?Enzyme?Mix	0.5μL
		Random?6?primers	0.5μL
5×PrimeScript?RT?Buffer	2.0μL
		RNA	2.0μL
RNase-Free ultrapure water	5.0μL
		Total	10.0μL

CDNA synthesis is carried out by program below: response procedures is 37 DEG C, 15min by after the mixing of above-mentioned system; 85 DEG C, 5sec; 4 DEG C, preserve.

With the DNA of cDNA and ILTV of the IBV of reverse transcription synthesis for template, carry out PCR reaction, reaction system is as follows:

2×Taq?PCR?MasterMix	12.5μL
		cDNA/DNA	2.0μL
Upstream specific primer (25.0 μm of ol/L)	0.5μL
		Downstream specific primer (25.0 μm of ol/L)	0.5μL
Ultrapure water	9.5μL
		Total	25.0μL

Reaction conditions is as follows:

After PCR, get 7 μ L amplified production sepharoses respectively and carry out electrophoretic analysis.

2.2.4 the glue of probe gene reclaims

The glue of probe gene reclaims, and adopt OMEGA glue recovery test kit in a small amount, carries out reclaimer operation with reference to illustrating, step is as follows:

1) get 20 μ LPCR products and carry out electrophoresis, 6V/cm, 25min, ultraviolet lamp incision glue, weighs.Illustrate according to test kit and carry out glue recovery;

2) add Binding Buffer (XP2) in the ratio of 1:1,55 DEG C of-60 DEG C of water-baths are until glue all melts, and period to turn upside down centrifuge tube every 2-3min;

3) add in adsorption column by liquid, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;

4) add 300 Binding Buffer (XP2), the centrifugal 1min of room temperature 12000r/min, outwells filtrate;

5) add 700mL rinsing liquid SPW, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;

6) room temperature 12000r/min is empty from 2min, outwells filtrate;

7) be put in new centrifuge tube by adsorption column, add 30mL elution buffer, room temperature leaves standstill 1min;

8) the centrifugal 2min of room temperature 12000r/min, get 7 μ L recovery products and carry out electrophoresis, checking recovering effect, all the other reclaim products and save backup in-20 DEG C.

2.2.5 the connection restructuring of probe gene

Adopt pMD19-T Simple Vector Cloning Kit, carry out the connection restructuring of probe gene, concrete steps are illustratively carried out.Linked system is as follows:

PMD19-T Simple carrier	0.5μL
		Glue reclaims PCR primer	5.0μL
Solution?I	4.5μL
		Total	10.0μL

4 DEG C of connections are spent the night, and connect product for transforming DH5 α competent cell.

2.2.6 the Making and banking of competent cell

With reference to " Molecular Cloning: A Laboratory guide " Calcium Chloride Method ^[56]preparation DH5 α competent cell, the competent cell prepared is packed as 100 μ L/ and manage, is directly used in conversion or in-70 DEG C of preservations.

2.2.7 the conversion of product is connected

100 μ L recipient cells are placed on ice, add 10 μ L wherein and connect product, ice bath 30min; 42 DEG C of water-bath heat-shocked 90s, quick ice bath cooling 5min; Add the LB liquid nutrient medium (without the need to operating) of 600 μ L, 37 DEG C of preheatings immediately on ice, 37 DEG C, 150r/min shaking culture 1h, makes recipient bacterium restore normal growth state; Get 150 μ L cultures and be spread evenly across LB flat board (containing 100mg/mL Amp), dry, cultivate about 12h in 37 DEG C, picking colony is identified.

2.2.8 the qualification of probe plasmid bacterial and preservation

2.2.8.1 the DNA extracting of probe plasmid bacterial

Positive plasmid bacterium is inoculated in 5mL LB (containing 100mg/mL Amp) liquid nutrient medium, 37 DEG C of shaking culture 12h; Extract test kit illustration method by Omega mini-scale plasmid and extract plasmid.Concrete steps are as follows:

1) inhale 1mL bacterium liquid in centrifuge tube, the centrifugal 1min of room temperature 12000r/min, inhales and abandons supernatant;

2) add 250 μ L Solution I (4 DEG C of storages), vibration makes thalline suspend;

3) add 250 μ L Solution II, put upside down mixing lightly, leave standstill 2min;

4) add 350 μ L Solution III, gentleness is put upside down for several times to forming white flock precipitate thing, room temperature 12000r/min, centrifugal 10min;

5) proceed in adsorption column by the liquid of previous step, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;

6) add 500 μ L Buffer HB to it, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;

7) add 700 μ L Buffer Wash Buffer to it, the centrifugal 1min of room temperature 12000r/min, outwells filtrate; Repeat once;

8) room temperature 12000r/min is empty from 2min, is loaded on by pillar in a clean centrifuge tube, adds 30 μ L Elution Buffer to it, and leave standstill the centrifugal 1min of 2min, 12000r/min, the centrifugate of collection is the plasmid DNA of extraction.

2.3.8.2 the PCR qualification of probe plasmid bacterial

Carry out PCR qualification respectively to the probe plasmid bacterial extracted, make negative control with pMD19-T Simple empty vectors, reaction system is as follows simultaneously:

2×Taq?PCR?MasterMix	7.5μL
		Upstream specific primer (25.0 μm of ol/L)	0.5μL
Downstream specific primer (25.0 μm of ol/L)	0.5μL
		Plasmid (50 times of dilutions)	2.0μL
Ultrapure water	4.5μL
		Total	15.0μL

Response procedures is the same.React complete, get the sepharose of 5 μ L in 2.0% respectively and carry out electrophoretic analysis.

2.2.9 the Sequencing and Characterization of probe plasmid bacterial

Adopt the two deoxidation chain termination method of Sanger to carry out sequencing to being accredited as positive probe plasmid bacterial through PCR, sequencing efforts transfers to Shanghai Jie Li Bioisystech Co., Ltd to complete.

Must be checked order correct plasmid bacterial T/M, T/N, T/TK, T/gB, respectively containing, for example lower gene fragment: SEQ ID NO:1 (IBV-M), SEQ ID NO:2 (IBV-N), SEQ ID NO:3 (ILTV-TK), SEQ ID NO:4 (ILTV-gB).

2.2.10 the preservation of probe plasmid bacterial

Probe plasmid bacterial bacterium enlarged culturing correct for sequencing, then using 20% skim-milk as protective material freeze-drying ,-70 DEG C of preservations.

2.3 chip preparations

(1) design of chip matrix: often open chip and be divided into four districts, four districts are four repeat arrays, separate with hybridization fence, to carry out the hybridization of multiple different sample simultaneously.Each array parameter is as shown in Figure 1: often arrange probe gene and gene location is 9 sampling points, various kinds dot center spacing 450 μm, and spot diameter is 220 μm.

Detect the some system of DNA microarray: spotting buffer is mixed with sampling liquid, avian infectious laryngotracheitis virus probe, avian infectious bronchitis virus, gene location and negative Quality Control gene quantification to working concentration will be comprised and be 250ng/ μ L, be heated to 95 DEG C and keep 5min, be then placed in cooled on ice 10min.

By chip design requirement add in 96 (384) hole load sample plate holes dilution sex change good comprise avian infectious laryngotracheitis virus, avian infectious bronchitis virus probe, gene location, negative Quality Control gene and blank Quality Control damping fluid, seal orifice plate, with gene chip sample applying system (Microarray Printing System, SpotArrayTM 16) contact point sample on amination substrate.Point sample ambient relative humidity is 55%-65%, temperature 15-30 DEG C.

The chip that point makes leaves standstill abundant dried overnight (> 8h), then 60-80 DEG C of hydration-treated 10s is used, immediately in being heated to 80 DEG C of In situPCR instrument are dried, after ultraviolet-crosslinkable 30min, with 0.2%SDS liquid washing 5min, again with centrifugal drying after distilled water quick wash, sealing, 4 DEG C save backup.

Embodiment 2 detection method

1, nucleic acid extraction

The extracting of viral RNA: adopt kit method extracting viral RNA, test uses virus/liquid sample RNA extraction agent box in a small amount.By this test kit, extracting RNA is described, method is as follows:

A) get measuring samples 300 μ L and be placed in centrifuge tube, after adding 500 μ L RV liquid, after thermal agitation 2min, room temperature leaves standstill 5min.

B) add 750 μ L Virahols, shake up gently.

C) 800 μ L are pipetted in adsorption column, the centrifugal 30s of 12000rpm at 4 DEG C.

D) abandon liquid in collection tube, remaining lysate is moved in adsorption column, the centrifugal 30s of 12000r at 4 DEG C.

E) add 500 μ L RP liquid after abandoning collection liquid, at 4 DEG C, the centrifugal 30s of 12000rpm removes protein.

F) 500 μ L W3 liquid are added, after leaving standstill lmin, the centrifugal 15s of 12000rpm at 4 DEG C.

G) repeating step f.

H) transferred to by adsorption column in another clean centrifuge tube, add 30 μ L ultrapure waters in adsorption film central authorities, room temperature leaves standstill 2min.

I) the centrifugal 2min of 12000rpm, centrifugate is the RNA extracted, and-70 DEG C save backup.

The reverse transcription of viral RNA: IBV reverse transcription system 10.0 μ L system:

Reverse transcription reaction program is as follows: 42 DEG C, reverse transcription 30min; 85 DEG C, 30s deactivation ThermoScript II; 4 DEG C of maintenances.

The extracting of viral DNA: adopt blood/cell/tissue genome DNA extracting reagent kit extracting viral DNA, method is as follows

A) animal tissues's (tissue consumption should lack 10mg) first should smash and be treated to cell suspension, then the centrifugal 1min of 10000rpm, uses up supernatant, adds 200 μ l damping fluid GA, and vibration is to thoroughly suspending.

B) add 20 μ l Proteinase K solution, mixing, 56 DEG C of placements, until histolysis, brief centrifugation is to remove the globule of cap wall.

C) add 200 μ l damping fluid GB, fully put upside down mixing, place 10min for 70 DEG C, solution strain is limpid, and brief centrifugation is to remove the globule of cap wall.

D) add people 200 μ l dehydrated alcohol, fully vibration mixing 15s, now may occur flocks, brief centrifugation is to remove the globule of cap wall.

E) all add in an adsorption column CB3 (adsorption column puts into collection tube) by previous step gained solution and flocks, the centrifugal 30s of 12000rpm, outwells waste liquid, is put back in collection tube by adsorption column CB3.

F) in adsorption column CB3, add 500 μ l damping fluid GD, the centrifugal 30s of 12000rpm, outwells waste liquid, and adsorption column CB3 is put into collection tube.

G) in adsorption column CB3, add 600 μ l rinsing liquid PW, the centrifugal 30s of 12000rpm, outwells waste liquid, and adsorption column CB3 is put into collection tube.

H) repetitive operation step g.

I) put back in collection tube by adsorption column CB3, the centrifugal 2min of 12,000rpm, outwells waste liquid.Adsorption column CB3 is placed in room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.

J) proceeded to by adsorption column CB3 in a clean centrifuge tube, the unsettled dropping in the middle part to adsorption film 50-200 μ l elution buffer TE, room temperature places 2-5min, the centrifugal 2min of 12000rpm, centrifugal 2min, centrifugate is the DNA extracted, and-70 DEG C save backup.

2, the asymmetric PCR mark amplification of cDNA/DNA

The cDNA of the IBV obtained with the DNA of ILTV and reverse transcription is template, and carry out PCR reaction, reaction system is as follows:

The concentration of all upstream primers is 10umol/l, shown in SEQ ID NO:6,8, the concentration of downstream primer is 100umol/l, downstream primer concentration shown in SEQ ID NO:10,12 is that shown in 200umol/l, SEQ ID NO:21, downstream primer concentration is 10umol/l.

5 ' end of each downstream primer all has Cy3 fluorescent mark, and therefore adding primer must carry out in darkroom.

Reaction conditions is as follows:

3, detect

The gene chip of embodiment 1 is adopted to detect.

The prehybridization of gene chip

Get the gene chip that preparation is preserved, chip is placed in hybridization cabin, in chip point sample, district adds prehybridization solution 25ul, cover glass is put down gently on it, in order to avoid formation bubble, make prehybridization solution uniform fold chip region, in wet box chip being placed in sealing at 44 DEG C prehybridization 1h.

The hybridization of gene chip

Absorb prehybridization solution, the nucleic acid samples of pcr amplification and hybridization buffer are mixed after 95 DEG C of sex change 5min, put in ice immediately and cool 3min, get this mixed solution 20-40ul and be added to chip region, put down gently on it with cover glass, chip is put into hybridization cabin in a wet box lucifuge hybridization, under 48 DEG C of hybridization temperatures, hybridize the 3h time.After having hybridized, after cover glass removing, wash 3min successively with warm scavenging solution 1, scavenging solution 2, scavenging solution 3, scavenging solution 4 successively, the dry laggard line scanning of low-speed centrifugal.

The chip gene chip scanning instrument of scanning analysis centrifugal drying scanning Detction.Sweep parameter is Laserpower 95%, PMGT 75%, resolving power 20um, and scanning result preserves image with 16 TIFF and BMP forms.

Embodiment 3 Radioactive colloidal gold is on the impact of gene chip hybridization efficiency

1, the preparation of Radioactive colloidal gold

The HAuCl4 of preparation 1%, 1% citric acid three sodium solution.Get 1.0gHAuCl4 powder dissolution in the clean beaker filling 100mL sterilizing ultrapure water, the HAuCl4 of namely make 1%, and be stored in brown bottle, lucifuge 4 DEG C saves backup.

Get 200mL sterilizing ultrapure water and 2mL1%HAuCl4 is mixed in 500ml large beaker, then measure 20mL and be sub-packed in 10 50mL small beakers of numbering 1-10, use heating magnetic stirring apparatus that the colloidal gold solution of packing is heated 5min successively, add 1% citric acid three sodium solution fast, add-on is respectively 0.1mL, 0.2mL, 0.24mL, 0.28mL, 0.32mL, 0.36mL, 0.4mL, 0.6mL, 1.0mL, 1.2mL.Color from pale yellow becomes rapidly black when becoming redness again, then Keep agitation 10min stops, and waits solution to be cooled to room temperature, and filter with cellulose nitrate film, can obtain required colloidal gold solution, 4 DEG C keep in Dark Place.During use, be diluted to the solution that Radioactive colloidal gold concentration is 25nmol/L.

2, Radioactive colloidal gold is on the impact of gene chip hybridization effect

Except add colloidal gold solution (25nmol/L) in PCR system except, add-on is 0.6uL, and all the other conditions, with embodiment 2, detect the biased sample of ILTV and IBV.

3, experimental result

Shown in experimental result chart 1, table 2 and Fig. 2.

Table 1 does not add Radioactive colloidal gold scanning result

Table 2 adds Radioactive colloidal gold scanning result

As can be seen from table 1, table 2 and Fig. 2, the output of asymmetric PCR well can be increased after adding Radioactive colloidal gold, hybridization finds that the average signal value adding Radioactive colloidal gold is than not adding the high by about 2000 of Radioactive colloidal gold, illustrate that Radioactive colloidal gold can allow the amplification of strand increase, and inhibit non-specific hybridization.

Experimental result illustrates, Radioactive colloidal gold can make detected result more accurate.Therefore, detection kit of the present invention preferably comprises Radioactive colloidal gold.

Embodiment 4 specific test

One, test method

By the method for embodiment 2, detect by IBV, ILTV, IBDV, AIV tetra-kinds of pathogenic agent, to detect its specificity.

Two, result

As shown in Figure 3, the inventive method can effectively detect IBV, ILTV of the present invention to experimental result, and can not detect other virus, and e.g., IBDV, AIV, show the high specificity of test kit of the present invention and gene chip, and can not increase other viruses.

Experimental result illustrates, the high specificity of gene chip of the present invention and test kit.

Embodiment 5 sensitivity test

One, test method

After 4 kinds of plasmid DNA nucleic acid-protein instrument embodiment 1 built are quantitative, plasmid copy number is adjusted to 1.8 × 10 ¹²copy/μ L carries out 10 times of gradient dilutions, dilutes 8 gradients, the liquid of each gradient is added 5 μ L gene location mixing, detects according to the method for embodiment 2.

Two, result

Result is as shown in table 3 ~ 4:

Table 3 gene chip sensitivity technique result

Can find out, be 10 at target gene extent of dilution ⁸(plasmid copy number is adjusted to 1.8 × 10 ⁴copy/μ L) time, ILTV, IBV all have comparatively significantly hybridization spot, and average signal value is greater than 1000, SNRm and is greater than 1.5, and positive control spot is obviously and negative control spots is not obvious.

When adopting the inventive method to detect, the minimal detectable concentration of each viral sample is 1.8 × 10 ⁴copy/μ L (0.2pg/ μ L), illustrates the highly sensitive of gene chip of the present invention and test kit.

Embodiment 6 adopts genechip detection pathological material of disease of the present invention

One, detection method

1, the taking and pre-treatment of pathological material of disease:

1) the taking of pathological material of disease: collect the chicken of 20 parts, Chongqing Sichuan 12 cities and counties (Chengdu Chongzhou City, Dayi, Chengdu, Liangping, Chongqing, Mianyang, Nanchong, Meishan Hongya, the high eyebrow of Meishan, Meishan Danleng, Weiyuan, inland river, Yaan Yu Cheng, Yaan asbestos, Changning, Yibin) performance respiratory symptom, dove sample, comprise tracheae and lung tissue.

2) pre-treatment of pathological material of disease: ground with sterilizing PBS by the pathological material of disease gathered, acts on 30 minutes at 37 DEG C, and multigelation 3 times also uses ultrasonication, centrifugal, supernatant liquor-20 DEG C preservation.

2, detect

Adopt the PCR system of embodiment 2 and condition to carry out single PCR and detect IBV and ILTV respectively, adopt the gene chip of embodiment 1 simultaneously, detect according to the method for embodiment 2.

Two, detected result

Clinical sample detected result

Experimental result illustrates, test kit of the present invention and gene chip can detect avian infectious bronchitis virus, avian infectious laryngotracheitis virus accurately and efficiently.

To sum up, test kit of the present invention and gene chip can effectively detect avian infectious bronchitis virus, avian infectious laryngotracheitis virus, and high specificity, susceptibility are high, consuming time short, detect fast, have a good application prospect.

Claims (10)

1. detect a gene chip for avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus, it is characterized in that: it comprises solid phase carrier and is fixed on the probe on solid phase carrier; Described probe to comprise shown in SEQ ID NO:1 ~ 2 any one or two gene fragments, and/or any one or two gene fragments shown in SEQ ID NO:3 ~ 4.

2. gene chip according to claim 1, is characterized in that: it also comprises position probe, and position probe is the gene fragment shown in SEQ ID NO:13.

3. one kind is detected the test kit of avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus, it is characterized in that: it comprises the reagent of the gene chip described in claim 1 or 2 and increase avian infectious laryngotracheitis virus and/or chicken infectious bronchitis virogene, wherein, the reagent of amplification chicken infectious bronchitis virogene comprises primer pair shown in SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8; The reagent of amplification avian infectious laryngotracheitis virus gene comprises primer pair shown in SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12.

4. test kit according to claim 3, is characterized in that: it also comprises primer pair shown in SEQ ID NO:14 ~ 15.

5. test kit according to claim 3, is characterized in that: it also comprises Radioactive colloidal gold.

6. test kit according to claim 3, is characterized in that: in described primer pair, and shown in SEQ ID NO:5,7, shown in upstream primer and SEQ ID NO:6,8, the mol ratio of downstream primer is 1:10; Shown in SEQ ID NO:9,11, shown in upstream primer and SEQ ID NO:10,12, the mol ratio of downstream primer is 1:20.

Any one or two gene fragments shown in 7.SEQ ID NO:1 or 2, and/or any one or two gene fragments shown in SEQ ID NO:3 or 4 detect avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus in preparation gene chip in purposes.

8. purposes according to claim 7, is characterized in that: described gene chip also comprises position probe, and position probe is the gene fragment shown in SEQ ID NO:13.

Primer pair shown in 9.SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8, is preparing with primer pair shown in SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12 purposes simultaneously increased in the reagent of avian infectious bronchitis virus and avian infectious laryngotracheitis virus.

Primer pair shown in any one or two gene fragments shown in 10.SEQ ID NO:1 ~ 2 and SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8, and/or primer pair shown in any one or two gene fragments shown in SEQ ID NO:3 ~ 4 and SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12 detect avian infectious bronchitis virus and/or avian infectious laryngotracheitis virus in preparation test kit in purposes; Wherein, primer pair is amplifing reagent; SEQ ID NO:1 ~ 4 are detection probes.