CN104293947B - Single nucleotide polymorphism rs58600253 is detecting the application in susceptibility gene of leprosy - Google Patents
Single nucleotide polymorphism rs58600253 is detecting the application in susceptibility gene of leprosy Download PDFInfo
- Publication number
- CN104293947B CN104293947B CN201410531166.6A CN201410531166A CN104293947B CN 104293947 B CN104293947 B CN 104293947B CN 201410531166 A CN201410531166 A CN 201410531166A CN 104293947 B CN104293947 B CN 104293947B
- Authority
- CN
- China
- Prior art keywords
- snp
- leprosy
- primer
- site
- polymorphism
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses single nucleotide polymorphism rs58600253 and detect the application in susceptibility gene of leprosy.The technical scheme that the present invention protects detects polymorphism (i.e. allelotrope) or the application of genotypic material in the product preparing the detection single nucleotide polymorphism relevant to leprosy of rs58600253 in human genome.Can will detect the polymorphism (i.e. allelotrope) of rs58600253 or the genotypic material product to other material (as detected other the single nucleotide polymorphism (i.e. allelotrope) relevant with leprosy or genotypic material) united preparation examination leper.
Description
Technical field
The present invention relates to single nucleotide polymorphism rs58600253 in biological technical field and detect the application in susceptibility gene of leprosy.
Background technology
Single nucleotide polymorphism (singlenucleotidepolymorphism, SNP) refers to the variation of genome single core thuja acid, and it is the most small variation unit, is the variant form formed displacement, transversion, insertion or disappearance by single core thuja acid.Single nucleotide polymorphism is highdensity genetic marker on genome, and the SNP quantity found in human genome is more than 30,000,000.As third generation genetic marker SNP One's name is legion, densely distributed, be easy to detect, because of but desirable gene type target.SNP somatotype detects at disease genome (as disease susceptibility), is significant in the research such as Drug Discovery (drug effect, drug metabolism difference and untoward reaction) and Swarm Evolution.
Existing multiple method can be used for SNP detection at present, as DNA sequencing, Restrictive fragment length polymorphism, single strand conformation polymorphism, denaturing high-performance chromatography, SNP chip.Wherein, SNP chip comprise the chip based on nucleic acid hybridization reaction, the chip based on single base extension, based on the chip of allele-specific primers extension, the chip reacted based on " single stage method ", the chip based on primer ligation, the chip based on restriction enzyme reaction, chip based on protein D NA association reaction, and based on the chip (Zhang little Yan etc. of fluorescence molecule DNA association reaction.By genechip detection single nucleotide polymorphism reaction principle.Chinese biological engineering magazine.2005,25(11):52～56)。
Leprosy is a kind of chronic infectious disease caused by M leprae infections, and in developing country, this remains a serious health problem, and annual global neopathy number of cases is 250000.Main infringement skin and peripheral nerve, and cause the nerve function lesion of non-reversibility and chronic teratogenesis to be disabled.This has been proved to be and has played vital effect in the environmental factors in the groove of leprosy and host genetic factor, estimates that inherited genetic factors is up to 57%.
The scheme of the World Health Organization is divided into tuberculosis type and knurl type the clinical manifestation of leprosy, distinguishes the immunne response of the human body of correspondence Th1 (cell-mediated) and Th2 (humoral) tissue.The multifarious clinical manifestation of leprosy reflects that human body is to two of allogenic disease substance kinds of distinct immunne responses, and this just illustrates the importance of genetic predisposition in leprosy morbidity.The result of genetic research shows that heredity is all relevant with the disease progression of vulnerability to leprosy and its clinical subtype.
Summary of the invention
The object of this invention is to provide single nucleotide polymorphism rs58600253 detecting and the application in examination leprosy.
The present invention provide firstly following A 1)-A7) in arbitrary purposes:
A1) polymorphism (i.e. allelotrope) or the application of genotypic material in preparation examination leper product of rs58600253 in human genome is detected.
A2) polymorphism (i.e. allelotrope) or the genotypic material that detect rs58600253 in human genome detect the application in leprosy susceptibility product in preparation.
A3) polymorphism (i.e. allelotrope) or the genotypic material that detect rs58600253 in human genome detect the application in the product of the single nucleotide polymorphism relevant to leprosy in preparation.
A4) application in the product of characterization or the assistant identification single nucleotide polymorphism relevant to leprosy of the polymorphism (i.e. allelotrope) of rs58600253 in human genome or genotypic material is detected.
A5) polymorphism (i.e. allelotrope) of rs58600253 or the application of genotype in preparation examination leper product in human genome.
A6) in human genome, the polymorphism (i.e. allelotrope) of rs58600253 or genotype detect the application in leprosy susceptibility product in preparation.
A7) containing detecting the polymorphism (i.e. allelotrope) of rs58600253 or the product of genotypic material in human genome, be a)-d) in any one product:
A) single nucleotide polymorphism (i.e. allelotrope) relevant to leprosy or genotypic product is detected;
B) qualification or the assistant identification single nucleotide polymorphism (i.e. allelotrope) relevant to leprosy or genotypic product;
C) examination leper product;
D) leprosy susceptibility product is detected.
In such use, in described detection human genome, the polymorphism (i.e. allelotrope) of rs58600253 or genotypic material can be PCR primer and the single-basic extension primer that amplification comprises the genomic DNA fragment of rs58600253.
In an embodiment of the present invention, described leprosy is specially Chinese han population and ethnic minority's leprosy.
Rs58600253 is the SNP site of two equipotential polymorphisms on human chromosome 10q21.3, and this variation is conversion (T/C is then A/G on its complementary strand).Described rs58600253 genotype is TT, TC or CC.Described TT is rs58600253 site is the homozygous of T, and described CC is rs58600253 site is the homozygous of C, the heterozygous of described TC to be rs58600253 site be T and C.In described detection human genome, the polymorphism (i.e. allelotrope) of rs58600253 or genotype specifically can be the Nucleotide kind detecting rs58600253.
In such use, described TT and the ratio of the genotypic individuality of described TC in leper colony are respectively higher than the ratio of genotype in normal people colony of correspondence.
Experiment proves, in the case colony be made up of 8313 lepers and the control population be made up of 11655 normal health persons and the control population be made up of 4362 other several immune correlated disease patients, the P value of rs58600253 is 3.02 × 10
-12, and the relative risk of rs58600253 is 1.22, illustrates that rs58600253 is the single nucleotide polymorphism relevant to leprosy.The risk allelotrope of rs58600253 is T, and the ratio of this allelotrope of the ratio of this allelotrope in leper colony in normal people colony is high by 22.16%.In three genotype of rs58600253, the genotypic individuality of TT and the ratio of the genotypic individuality of TC in leper colony are respectively higher than the ratio of genotype in normal people colony of correspondence, and the ratio of the genotypic individuality of CC in leper colony is lower than its ratio in normal people colony.In actual applications, the polymorphism (i.e. allelotrope) of rs58600253 or the genotypic material product to other material (as detected other the single nucleotide polymorphism (i.e. allelotrope) relevant with leprosy or genotypic material) united preparation examination leper will can be detected.
Wherein, detect the polymorphism (i.e. allelotrope) of rs58600253 in human genome or genotypic material to can be and determine reagent needed for the polymorphism (i.e. allelotrope) of rs58600253 or genotype and/or instrument by following at least one method: DNA sequencing, Restrictive fragment length polymorphism, single strand conformation polymorphism, denaturing high-performance chromatography and SNP chip.Wherein, SNP chip comprise the chip based on nucleic acid hybridization reaction, the chip based on single base extension, based on the chip of allele-specific primers extension, the chip reacted based on " single stage method ", the chip based on primer ligation, the chip based on restriction enzyme reaction, chip based on protein D NA association reaction, and based on the chip of fluorescence molecule DNA association reaction.
Described product can be reagent or test kit, also can be the combined prod of reagent or test kit and instrument, as the combined prod be made up of primer and DNA sequencer, and the combined prod be made up of PCR reagent and DNA sequencing reagent and DNA sequencer.
In one embodiment of the present of invention, PCR primer amplification is adopted to comprise the genomic DNA fragment of rs58600253, with the pcr amplification product obtained for template, single-basic extension primer is adopted to carry out single base extension, the sequence of the extension products obtained is detected, determines polymorphism and the genotype of rs58600253.Described PCR primer does not have particular requirement in sequence, as long as can amplify the genomic DNA fragment comprising rs58600253, specifically can be the single stranded DNA shown in SEQ ID No .1 and SEQIDNo.2.Described extension primer designs according to rs58600253 upstream in human genome (not comprising this SNP site), last 1 Nucleotide of described extension primer corresponds to front 1 Nucleotide of rs58600253 in human genome, as as described in extension primer specifically can be in sequence table the single stranded DNA shown in SEQIDNo.5, certainly also the single stranded DNA shown in SEQ ID No .5 can be extended more than one Nucleotide according to the downstream sequence of rs58600253 in human genome, or lack more than one Nucleotide according to the downstream sequence of rs58600253 in human genome, as long as 3 ' end of this single-basic extension primer can be made to extend the Nucleotide in rs58600253 site.
The present invention finds that in a sample from Chinese population (8313 lepers and 16017 healthy persons) rs58600253 is the single nucleotide polymorphism relevant to leprosy.Can will detect the polymorphism (i.e. allelotrope) of rs58600253 or the genotypic material product to other material (as detected other the single nucleotide polymorphism (i.e. allelotrope) relevant with leprosy or genotypic material) united preparation examination leper.
Accompanying drawing explanation
Fig. 1 does not get rid of to find site and the P value of SNP in MHC region and the P value of the SNP after eliminating the SNP in the past finding site and MHC region in the past.Wherein, left figure is the P value not getting rid of the SNP in the past finding site and MHC region, and right figure is the P value of the SNP after eliminating the SNP in the past finding site and MHC region.
Fig. 2 is the resample area of sample.
Embodiment
Below in conjunction with embodiment, the present invention is further described in detail, the embodiment provided only in order to illustrate the present invention, instead of in order to limit the scope of the invention.
Experimental technique in following embodiment, if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Embodiment 1, rs58600253 with rs663743 are the single nucleotide polymorphism relevant to leprosy
Ethics is stated
This research have passed Shandong Academy of Medical Sciences, the Ethics Committee (IRB) of Shandong Province's tetter and prevention and treatment of venereal diseases institute ratifies, all lepers, other several immune correlated diseases (psoriasis (psoriasis), vitiligo (vitilogo), allergic dermatitis (atopicdermatitis) and lupus erythematosus (SLE))) patient and normal health collator all endorsed Informed Consent Form.
Research object
At discovery phase (first stage), carry out two and independently studied.The research object of first independent studies is other several immune correlated diseases (psoriasis (psoriasis), vitiligo (vitilogo), allergic dermatitis (atopicdermatitis) and lupus erythematosus (the SLE)) case of sample 1 and the 4362 routine Northern Han Nationalities as population contrast, this sample 1 comprises 706 routine Han Nationality from Northern Cases of Leprosies and 1225 routine Han Nationality from Northern normal health contrasts, and they are all Northern Han Nationality blood lineage.The research object of second independent studies is sample 2, this sample 2 comprises between 2006-2011 in 955 examples (after Quality Control screening, sample total is 842 examples) Cases of Leprosy and 1040 examples (after Quality Control screening, sample total is 925 examples) the normal health contrast that China recruits, comprise 436 examples (being 376 examples after Quality Control screening) Cases of Leprosy and 533 examples (being 511 examples after Quality Control screening) the normal health contrast of Northern Han Nationality, 289 examples (being 265 examples after the Quality Control screening) Cases of Leprosy of Han nationality in southern China and 305 examples (being 263 examples after Quality Control screening) normal health contrast, 230 examples (being 201 examples after the Quality Control screening) Cases of Leprosy of southern china Zhuang and other ethnic minoritys and 202 examples (being 151 examples after Quality Control screening) normal health contrast, in table 1 and Fig. 2.
Qualify Phase applies two independently samples, sample 3 and sample 4.The sample of Qualify Phase 1 (subordinate phase) is sample 3, and this sample 3 comprises 2761 routine Cases of Leprosies and the 3038 routine normal health contrasts of Han Nationality from Northern, in table 1 and Fig. 2.The sample of Qualify Phase 2 (phase III) is sample 4, this sample 4 comprises 4004 routine Cases of Leprosies and 6467 routine normal health contrasts, comprise 277 routine Cases of Leprosies and the 2626 routine normal health contrasts of Han Nationality from Northern, 1494 routine Cases of Leprosies of southwest Han nationality and 1474 routine normal health contrasts, 418 routine Cases of Leprosies of southeast Han nationality and 306 routine normal health contrasts, 418 routine Cases of Leprosies of western Han nationality and 395 routine normal health contrasts, and 1397 of Southern Minority routine Cases of Leprosies and 1666 routine normal health contrasts.Qualify Phase amounts to 6765 routine Cases of Leprosies (in sample 3 leprosy number of cases and leprosy number of cases sum in sample 4) and 9505 routine normal health contrast (in sample 3, case load contrasts number sum with normal health in sample 4), in table 1 and Fig. 2.
Wherein, the Case definition of leprosy in China patient meets more than 2 or 2 in following 4, or meet the 3rd article of person and establish diagnosis: 1, skin damages with sensory disturbance and closes sweat, or has numb district; 2, peripheral nerve is got involved, and shows as nerve trunk thick companion's corresponding function obstacle; 3, leprosy bacillus found by skin damage tissue slice or tissue juice smear; 4, pathology visible features sexually revises.
The Case definition of normal health collator: without leprosy medical history and without the family history (comprising the one-level of leper, secondary and third degree relative) of leprosy; Without animal infectious diease medical history; Without other autoimmune disorder medical histories, systemic disease medical history and family history.
The Conjoint Analysis of following triphasic GWAS research and cognation has been carried out in leprosy in China patient:
One, the association analysis of discovery phase
1, the association analysis of SNP and leprosy
The selection of SNP
The leprosy GWAS database that sample 1 is announced before being, comprises 706 routine Northern Han Nationality Cases of Leprosies and 1225 routine Northern Han Nationality normal health contrasts; Sample 2 is that a new unpub database comprises 955 routine Cases of Leprosies (after Quality Control screening, sample total is 842 examples) and 1040 examples (after Quality Control screening, sample total is 925 examples) (Han nationality of Northern Han Nationality and southern china and ethnic minority) Chinese normal health contrasts (see table 1).Also analyze other several immune correlated diseases (psoriasis (psoriasis), vitiligo (vitilogo), allergic dermatitis (atopicdermatitis) and lupus erythematosus (SLE) case of the 4362 routine Northern Han Nationalities as population contrast in addition.It is of Chinese origin that principle component analysis (PCA) confirms that all samples is.Through Quality Control screening, (quality control method carries out according to the method in following document: Anderson, C.A.etal.Dataqualitycontrolingenetic-casecontrolassociat ionstudies.Nat.Protoc.5, 1564 – 1573 (2010)), the final sample number assessed in first independent studies is 706 routine Cases of Leprosies, 1225 routine Northern Han Nationality normal health contrasts, with other several immune correlated disease cases of the 4362 routine Northern Han Nationalities contrasted as population, and sample total is 842 routine Cases of Leprosies and 925 routine normal health contrasts carry out Quality Control screening in second independent studies after.Log-additive detects (wherein comprising 5 significant principal constituents) cognation for assessment of SNP and leprosy, two independently data set application meta analytical procedure routinely contrast that (1225 routine Northern Han Nationality normal health contrast at 1548 routine Cases of Leprosies (in sample 1 case load and Quality Control in sample 2 screen after leprosy number of cases sum) and 6512, with other several immune correlated disease cases of the 4362 routine Northern Han Nationalities contrasted as population and 925 routine normal health contrasts) in have studied 4577171 common SNP (minimum gene frequency >5%, 467552 gene types, 4109619 estimations).
Quality control standard:
The SNP of first independent studies and specimen quality control criterion: SNPs is positioned at sex chromosome, call-rate<90%, minimum gene frequency (MAF) <1% of leprosy case and contrast and significantly depart from Hardy-Weinberg in contrast and balance (HWE) (P<1 × 10
-8) or do not determine that the SNPs trooped all is rejected.Finally reject not identical with second independent studies SNPs, totally 467552 SNPs carry out whole-genome association.
The SNP of second independent studies and specimen quality control criterion: SNPs is positioned at sex chromosome, call-rate<90%, minimum gene frequency (MAF) <1% of leprosy case and contrast and significantly depart from Hardy-Weinberg in contrast and balance (HWE) (P<1 × 10
-8) or do not determine that the SNPs trooped all is rejected.Finally, reject not identical with first independent studies SNPs, totally 467552 SNPs carry out whole-genome association.
The sample of second independent studies is implemented (when having detected that 1st or 2nd level associates by PLINKv1.07, remove low call-rate person in pairs) call-rate assessment (must higher than 96%) associates (utilizing the method based on paired identity-by-state (IBS)) with potential between sample, whether they are that population is departed from (populationoutliers) to carry out principle component analysis (PCA) based on 206 routine HapMap samples, these samples are sampled in the Yorubas (YRI) (57 example) of Nigeria's Ibadan, the Japanese (JPT) (44 example) of Tokyo, the Chinese han population (CHB) of BeiJing, China (45 example) and ancestors are from the Utah State resident (CEU) (60 is routine) in Northern Europe and West Europe.
Phasing and classification (PhasingandImputation):
Phasing (Phasing) carries out respectively in the Northern Han Nationality in first independent studies stage and the Northern Han Nationality in second independent studies stage, the Han nationality of southern china and ethnic minority.Phasing adopts SHAPEIT version 2, based on the research of 467552 common single nucleotide polymorphism, sort out (imputation) and adopt IMPUTE2.2.2 version, derive from NCBIbuild37 (hg19) database with reference to panel, plan I based on thousand people and integrate different setreleasev3.Later stage is sorted out (Post-imputation) quality control and comprises: get rid of insertion-deletion and structural changes, SNPsMAF<5%, SNPs categorizing information score (imputationcertainty) <0.8, the HWESNPs in contrast be (P<1 × 10 significantly
-5).Finally, the SNPs having 4109619 SNPs (imputedSNPs) sorted out and 467552 somatotypes is applied to association analysis, obtains 91 sites significantly associated with leprosy.
2, the association analysis of SNP genotype and leprosy
The gene type of first independent studies and second independent studies is all applied IlluminaHuman610K-QuadBeadChips and is carried out gene type.All typing assay are performed according to the explanation of manufacturers by Genergy biotechnology (Shanghai) Co., Ltd..
The method of the gene type of first independent studies and second independent studies is as follows:
91 adopt IlluminaHuman660K-QuadBeadChips to verify with the site that leprosy significantly associates, and each sample about uses 15ngDNA.First the genomic dna of peripheral blood is extracted, after stdn, sample DNA comprises the genomic DNA fragment of SNP site through multi-PRC reaction amplification, and amplified production carries out the extension of the single chain of SNP site specificity, and extension products desalination is also transferred on the chip in 384 holes.Mass spectrograph (MALDI-TOFMS) carries out allelic detection, adopts IlluminaHuman660K-QuadBeadChips somatotype software to analyze detected result.
2.1, whole blood sample collection
In informed consent, and when signing written consent book, gather research object peripheric venous blood 5ml, be positioned over EDTANa
2in anticoagulant tube, put-80 DEG C of refrigerator-freezers and store for future use.
2.2, DNA concentration standard comprises the steps:
2.2.1 the NanoDrop-1000 concentration tester Accurate Determining standardized sample DNA concentration of every a needs and OD ratio (A260/A280, A260/A230) is utilized.
2.2.2 set up electrical form, each sample aperture that is ranked needs the DNA numbering added.
Carry out the sample of SequenomMassArray somatotype, every 96 orifice plates leave blank and repeated sample contrast.
2.2.3 according to the order of electrical form, the DNA measuring concentration is added.
Requiring that experimental concentration is 12-30ng/ μ l for the sample carrying out SequenomMassArray somatotype, is generally good with 18ng/ μ l.And A260/A280 ratio between 1.5-2.0, A260/230 between 1.5-2.3, as DNA concentration then adds appropriate FG3 higher than 18ng/ul, by concentration mark to 18ng/ul; If DNA concentration is lower than 12ng/ul, then again extract qualified DNA from blood.Concentration directly adds between 12-18ng/ μ l.
Stick viscosity masking foil after centrifugal, and put on the information such as sample plane label, sample type, source place with marker pen.
2.2.4 on plate centrifuge, centrifugal 3 minutes of 3000g, deposit in-20 DEG C for subsequent use.
2.3, multiplex PCR
Wherein, in multiplex PCR amplification to comprise the primer of the genomic DNA fragment of rs58600253 as follows: ACGTTGGATGCCTGATCCCATATGAGTTAG (SEQIDNo.1 in sequence table) and ACGTTGGATGTCAGAGAACTTGCTGCACTC (SEQIDNo.2 in sequence table).
In multiplex PCR, to comprise the primer of the genomic DNA fragment of rs663743 as follows in amplification: ACGTTGGATGTGCAGCTGCCACAGTGAGAC (SEQIDNo.3 in sequence table) and ACGTTGGATGACTCCCACTCAGGAAGTCTC (SEQIDNo.4 in sequence table).
2.4, the extension of the single chain of SNP site specificity
Wherein, extend primer according to SNP site upstream in human genome (not comprising this SNP site) design, last 1 Nucleotide of described extension primer corresponds to front 1 Nucleotide of this SNP site in human genome.The sequence of the extension primer of rs58600253 is TTAGAAAAATCATCCTGAGAC (SEQIDNo.5 in sequence table); The sequence of the extension primer of rs663743 is GCCCCCCTCCATGCC (SEQIDNo.6 in sequence table).
2.5, data quality control
1) callrate calculating is carried out to the SNP of somatotype, remove the SNP of callrate<95% or the SNPs of gene frequency <0.01;
2) genetic equilibrium inspection is carried out to SNP, remove SNP P≤0.001 of Hardy-Weinberg balance check (in the check sample) departing from the law of genetic equilibrium.
3) in SequenomMassArray system, check the somatotype dendrogram of SNP, remove the SNP that dendrogram divides heap unclear.
4) sample Quality Control: the sample directly removing somatotype failure.
Statistical study is carried out by by the sample of Quality Control and SNP.
2.6, statistical study:
The association analysis of two independent studies is carried out respectively.Somatotype SNPs is converted into genotype dosage (genotypedosage), analyzes together with the genotype dosage of imputedSNPs.Association analysis adopts SNPTEST2.4.1, is adding frequency of utilization detection in phase model.Use principle component analysis (PCA) to assess potential population structure, in every research, we list 5 principal constituents in, and the concomitant variable as association study explains population layering.
Two independent studies, the meta using META461.3.2 to adopt back mutation method to carry out Fixed-effects analyzes, and also obtain isomeric data (the Q statistical assumption value of Cochran and I index) equally.
Before meta analyzes, this program allows the adjustment lambda (lambdaGC) of genomicinflationlambda, lambdaGC is specified for each research contriver, the lambdaGC of Section 1 independent studies be 1.13 and second only item lambdaGC of standing research be 1.02.
Thegenomicinflationfactor (λ GC=1.02) value is very low, shows due to population stratification Confounding Factor very small (Fig. 1).After eliminating the SNP in the past finding site and MHC region, still there is the P value of a large amount of SNP very low, show have new association site to exist.In addition, the susceptibility loci of contriver also in known 9 non-MHC regions finds association, and it is independent of the SNP by conditions relevant analysis report.
In first independent studies and second independent studies of discovery phase, obtain 2 significance (P<5 × 10 in whole-genome association
-8, as shown in table 2) the new SNP relevant to leprosy: the rs58600253 being positioned at 10q21.3, be positioned at the rs663743 of 11q13.1.
Contriver have evaluated the interaction in new discovery site and meaningful site in the past, and the application pairwise interaction analytical remarkable SNP in these 2 sites, although data volume is huge do not find any interaction.
Two, the association analysis of Qualify Phase 1 and Qualify Phase 2
In order to the cognation of 2 that verify that discovery phase shows new SNP and leprosy, choose P<5 × 10 from the sites of the remarkable association of 91 displays
-4sNP in sample 3 (2761 routine Han Nationality from Northern Cases of Leprosies and 3038 routine Han Nationality from Northern normal health contrasts, table 1 and Fig. 2) in carry out check analysis (subordinate phase), in 88 SNP of successful somatotype, 11 SNPP<0.05,5 SNP are consistent in the first stage with the associated effect of subordinate phase, although its P value does not reach statistical significance (P>0.05).
2 SNP in all 16 are verified further in sample 4 (amounting to 4004 routine Cases of Leprosies and 6467 routine normal health contrasts, table 1 and Fig. 2), i.e. the phase III.
Qualify Phase uses PLINKv1.07 to carry out Log-additive interactive calculation to SNP.Second Qualify Phase application fixed-effectsmeta analyzes the associating data obtaining each SNP.
In addition, contriver demonstrates secondary SNP (P<5 × 10 having independent association from the SNP site in 9 non-MHC regions and 3 in report in the past in the sample 3 and the sample of phase III 4 of subordinate phase
-4).
The selection of SNP:
The SNP that may have mutant gene site is positioned at for those, each independently locus determined by condition analysis, condition analysis carries out within the scope of the 1MB of the most significant SNP of each locus.If P value still keeps <1 × 10 after condition analysis
-4locus is considered to independently, therefore the most significant SNP or its alternative (r in each independently locus
2>0.9) be considered to verify.Contriver also considers to select independently gene locus, and the P value of its TopSNP is positioned at 5 × 10
-4with 1 × 10
-4between, their GRAILP value <0.05.– logP is between 3 and 4, and this will be statistics threshold value (P<5 × 10 that SNP selects
-4) (Fig. 1).
Genotypic analyses and quality control:
The SNP gene type stage of Qualify Phase carries out in dermatopathy and venereal disease key lab of Shandong Province of Jinan City of Shandong Province of China province, application SequenomMassArraysystem (SanDiego, USA) and TaqManCustom genotype tests 7900HT determine Fluorescent Quantitative PCR reactive system according to manufacturer instruction operation carry out (AppliedBiosystemFosterCity, CA, USA).3 SNP are had not have successful somatotype due to following reason: 2 SNP are denied in the process of design, and another SNP gene type cluster is very poor.Quality control measures in such a way: can not determine that the SNP of SNP and callrate<90% of cluster is by disallowable.
Candidate gene is by the priority ranking of chip analysis: each gene score in the LD region of each locus is relevant to the biological evidences including the SNP of following evidence that we set up based on them: if SNP (r a) in dangerous SNP or any LD region
2>0.8) gene being defined as missense mutation or nonsense mutation based on the functional explanation (based on thousand human genome plans) in asian population of dbSNP will obtain a value.If b) find that they are based on the SNP (r in dangerous SNP or any LD region
2>0.8) obvious cis-eQTLandmQTL effect (P<0.001) is had also can to obtain a value.Cis-eQTL and mQTL data set comprises some researchs that can obtain in the peripheral blood lymphocytes eQTLmeta-analysis and SangerGenevar data set that announce recently, comprise the special lymph matricyte system of biological cells and tissues, inoblast, T cell, skin and fat eQTL analyze; If what c) gene had been set up by application based on PubMed text mining (GRAIL) shows obvious polarization (P<0.05) with the importing of guiding SNP, a value will be obtained.Equally, as fruit gene is polarized in albumen and albumen interaction, gene also can obtain a value.Interaction between gene applies DAPPLE (P<0.05) and carry out molecular pathway analysis by MAGENTA (FDRq<0.05) and IPAtop network gene (networkP<1E-10) to obtain.
Wherein, the method for gene type is as follows:
16 SNP adopt SequenomMassArray (SanDiego, USA) platform validation, and each sample about uses 15ngDNA.First the genomic dna of peripheral blood is extracted, after stdn, sample DNA comprises the genomic DNA fragment of SNP site through multi-PRC reaction amplification, and amplified production carries out the extension of the single chain of SNP site specificity, and extension products desalination is also transferred on the chip in 384 holes.Mass spectrograph (MALDI-TOFMS) carries out allelic detection, adopts SequenomMassARRAY somatotype software to analyze detected result.
1, whole blood sample collection
In informed consent, and when signing written consent book, gather research object peripheric venous blood 5ml, be positioned in EDTANa2 anticoagulant tube, put-80 DEG C of refrigerator-freezers and store for future use.
2, DNA concentration standard comprises the steps:
1) the NanoDrop-1000 concentration tester Accurate Determining standardized sample DNA concentration of every a needs and OD ratio (A260/A280, A260/A230) is utilized.
2) set up electrical form, each sample aperture that is ranked needs the DNA numbering added.
Carry out the sample of SequenomMassArray somatotype, every 96 orifice plates leave blank and repeated sample contrast.
3) according to the order of electrical form, the DNA measuring concentration is added.
Requiring that experimental concentration is 12-30ng/ μ l for the sample carrying out SequenomMassArray somatotype, is generally good with 18ng/ μ l.And A260/A280 ratio between 1.5-2.0, A260/230 between 1.5-2.3, as DNA concentration then adds appropriate FG3 higher than 18ng/ul, by concentration mark to 18ng/ul; If DNA concentration is lower than 12ng/ul, then again extract qualified DNA from blood.Concentration directly adds between 12-18ng/ μ l.
Stick viscosity masking foil after centrifugal, and put on the information such as sample plane label, sample type, source place with marker pen.
4) on plate centrifuge, centrifugal 3 minutes of 3000g, deposit in-20 DEG C for subsequent use.
3, multiplex PCR (following primer sequence synchronization is 2.3 in a kind of 2 suddenly)
Wherein, in multiplex PCR amplification to comprise the primer of the genomic DNA fragment of rs58600253 as follows: ACGTTGGATGCCTGATCCCATATGAGTTAG (SEQIDNo.1 in sequence table) and ACGTTGGATGTCAGAGAACTTGCTGCACTC (SEQIDNo.2 in sequence table).
In multiplex PCR, to comprise the primer of the genomic DNA fragment of rs663743 as follows in amplification: ACGTTGGATGTGCAGCTGCCACAGTGAGAC (SEQIDNo.3 in sequence table) and ACGTTGGATGACTCCCACTCAGGAAGTCTC (SEQIDNo.4 in sequence table).
4, the extension (following primer sequence synchronization is 2.4 in a kind of 2 suddenly) of the single chain of SNP site specificity
Wherein, extend primer according to SNP site upstream in human genome (not comprising this SNP site) design, last 1 Nucleotide of described extension primer corresponds to front 1 Nucleotide of this SNP site in human genome.The sequence of the extension primer of rs58600253 is TTAGAAAAATCATCCTGAGAC (SEQIDNo.5 in sequence table); The sequence of the extension primer of rs663743 is GCCCCCCTCCATGCC (SEQIDNo.6 in sequence table).
5, data quality control
1) callrate calculating is carried out to the SNP of somatotype, remove the SNP of callrate<95% or the SNPs of gene frequency <0.01;
2) genetic equilibrium inspection is carried out to SNP, remove SNP P≤0.001 of Hardy-Weinberg balance check (in the check sample) departing from the law of genetic equilibrium.
3) in SequenomMassArray system, check the somatotype dendrogram of SNP, remove the SNP that dendrogram divides heap unclear.
4) sample Quality Control: the sample directly removing somatotype failure.
Statistical study is carried out by by the sample of Quality Control and SNP.
6, data statistic analysis
Utilize Plink1.07 software to somatotype success and do gene phenotype correlation analysis by the SNP of Quality Control in case group and control group, check the genotype of each sample and the cognation of phenotype with Cochran-Armitagetrend, then comprehensively analyze the genotype of all samples and the dependency of phenotype with Cochran-Mantel-Haenszel.The heterogeneity evaluated between individuality is checked, in this experiment, using p<0.05 as inspection level with Q.Multiple logistic regression analysis is used for the independence of the signal in surveyed area.Inspection level α with 0.05 divided by by the SNP number of quality control for inspection level.Q inspection, for assessment of the significance of genetic heterogeneity, is less than 0.05 to P value after SNP correct detection and has been considered as remarkable genetic heterogeneity.
Genotype and the phenotype association study result of rs58600253 and rs663743 are as shown in table 2, show that rs58600253 with rs663743 is all single nucleotide polymorphism relevant to leprosy.
Three, the Conjoint Analysis of cognation
The Conjoint Analysis of discovery and Qualify Phase has been analyzed by fixed-effectsmeta, object is all samples, totally 8313 examples (in sample 1-4 leprosy number of cases sum) Cases of Leprosy and 16017 routine normal health contrasts (comprising the normal health contrast in sample 1-4 and other several immune correlated disease cases as 4362 routine Northern Han Nationalities of population contrast).The nonuniformity research of assessment is the statistics P value (the heterogeneous P value <0.05 that Bonferroni corrects is considered to there is significance) by assessment Cochran ' sQ.P<5 × 10
-8think that LocusZoom instrument is used for generating the region association figure in each site, and its center is at topSNP in the threshold value of full-length genome research significance.
Every research uses SNPTEST or PLINK to carry out conditional logic regression analysis, carries out PLINKmeta subsequently and analyzes the joint effect assessing topSNP.
The Conjoint Analysis of all samples of three phases uses transactional analysis between two.In 16 SNP, there are 153 interactive testings between two, use logistic regression and likelihood ratio test.Mutual P value is calculated by likelihood ratio test, and whether be used for comparing two kinds of models has alternately, and the concomitant variable of SNP1, SNP2 and research variable includes model in.Significant Bonferroni threshold value is P=0.05/153=0.00033.
Haplotyping examines the independence associated at the other diseases with leprosy same loci of previously report, in the SNP (r2>0.8) that LD value is high, do not carry out haplotyping.This analyzes by using the regular genotype of PHASEv.2.1.1 program, is finally completed by R.
The allelic imputation of HLA and association analysis
The object analyzed comprises other several immune correlated diseases (psoriasis (psoriasis), vitiligo (vitilogo), allergic dermatitis (atopicdermatitis) and lupus erythematosus (the SLE)) case of sample 1-4 and the 4362 routine Northern Han Nationalities as population contrast, and this analysis is used for avoiding artificial statistical error.The allelic imputation of classical HLA is the reference panel based on the chb of 178 and the sample of JPTHapMap.This panel comprises intensive SNP data and the HLA allelotrope HLA-I type (HLA-A in 2-digit and 4-digit resolving power, B, and II type (DQA1 C), DQB1, DRB1), but (based on the codon) of amino acid variation coding is the standard definition (http://www.ebi.ac.uk/imgt/hla/) following EMBL-EBI immunology genetics HLA database at present. application Beagle carries out Imputation, the program described before following.
Association analysis is implemented to be the additive model by comparing best-guessed genotype frequency and allelic dose application logistic regression analysis supposition heredity in case and contrast in PINK.Before presenting the result based on best-guessed gene type assay, have detected best-guessed and allelotrope dose uniformity result.We also weigh the accuracy of rs9271100imputation in the routine case of data centralization Stochastic choice 600 found and 600 example contrasts, the consistence between display imputation and actual gene type is 97.3%.
In the case colony be made up of 8313 lepers and the control population be made up of 11655 normal peoples and the control population be made up of 4362 other several immune correlated disease patients, 2 that obtain the present invention SNPs relevant to leprosy carry out Conjoint Analysis, result is as follows: the rs58600253 being positioned at 10q21.3, and its P value is P=3.02 × 10
-12, OR value is OR=1.22; Be positioned at the rs663743 of 11q13.1, its P value is P=8.84 × 10
-14, OR value is OR=1.24.
The genotype frequency of 2 SNP in leper colony and normal people colony is as shown in table 3.Result shows: in three genotype of rs663743, the genotypic individuality of AA and the ratio of the genotypic individuality of AG in leper colony are respectively higher than the ratio of genotype in normal people colony of correspondence, and the ratio of the genotypic individuality of GG in leper colony is lower than its ratio in normal people colony; In three genotype of rs58600253, the genotypic individuality of TT and the ratio of the genotypic individuality of TC in leper colony are respectively higher than the ratio of genotype in normal people colony of correspondence, and the ratio of the genotypic individuality of CC in leper colony is lower than its ratio in normal people colony.
Table 3, the SNP genotype frequency in leper colony and normal people colony
Note:
In the genotype of rs58600253, A1*A1 represents TT, and A1*A2 represents TC, and A2*A2 represents CC;
In the genotype of rs663743, A1*A1 represents AA, and A1*A2 represents AG, and A2*A2 represents GG.
The logistic regression model of two classification (log-additive model) is utilized to calculate gene frequency difference P value in leper colony and normal people colony, determine that SNP is with or without significant (the results are shown in Table 4), wherein genotype adopts additive models to add up.Such as, suppose that A1 is risk allelotrope, for case, if this case genotype is A1*A1, so the independent variable(s) of this case is 2, and dependent variable is 1; If this case genotype is A1*A2, so the independent variable(s) of this case is 1, and dependent variable is 1; If this case genotype is A2*A2, so the independent variable(s) of this case is 0, and dependent variable is 1.Such as, suppose that A1 is risk allelotrope, for normal health contrast, if this case genotype is A1*A1, so the independent variable(s) of this case is 2, and dependent variable is 0; If this case genotype is A1*A2, so the independent variable(s) of this case is 1, and dependent variable is 0; If this case genotype is A2*A2 genotype, so this case independent variable(s) be 0, dependent variable is 0.According to above theory, when case and normal health contrast P value are less than 0.05, there were significant differences.
Table 4, leper colony and normal people colony gene frequency difference P value
| SNP | Chr | Position | P |
| rs58600253 | 10 | 64507904 | 5.6E-11 |
| rs663743 | 11 | 64107735 | 1.1E-10 |
Table 5, the SNP gene frequency in leper colony and normal people colony
Note:
In the allelotrope of rs58600253, A1 represents T, and A2 represents C;
In the allelotrope of rs663743, A1 represents A, and A2 represents G.
From table 4 and table 5, each allelic gene frequency of rs58600253 and rs663743 all has significant difference in normal people colony and leper colony.The risk allelotrope of rs58600253 is T, the gene frequency of this allelotrope in Cases of Leprosy is 0.1812, gene frequency in normal health contrast is 0.1484, and compared with contrasting with normal health, this allelotrope adds 22.16% in Cases of Leprosy; The risk allelotrope of rs663743 is A, and the gene frequency of this allelotrope in Cases of Leprosy is 0.1956, and the gene frequency in normal health contrast is 0.1641, and compared with contrasting with normal health, this allelotrope adds 19.17% in Cases of Leprosy.
Experimental result shows, the polymorphism of rs58600253 and rs663743 or genotype or gene frequency can be used for the examination of leper.
Claims (4)
1. detect polymorphism or the application of genotypic material in preparation examination leper product of rs58600253 in human genome; In described detection human genome, the polymorphism of rs58600253 or genotypic material are PCR primer and the single-basic extension primer that amplification comprises the genomic DNA fragment of rs58600253, described PCR primer is the primer shown in SEQIDNo.1 and SEQIDNo.2, and described single-basic extension primer is the primer shown in SEQIDNo.5; Described rs58600253 genotype is TT, TC or CC; Described TT is rs58600253 site is the homozygous of T, and described CC is rs58600253 site is the homozygous of C, the heterozygous of described TC to be rs58600253 site be T and C; Described TT and the ratio of the genotypic individuality of described TC in leper colony are respectively higher than the ratio of genotype in normal people colony of correspondence.
2. the polymorphism or the genotypic material that detect rs58600253 in human genome detect the application in leprosy susceptibility product in preparation; In described detection human genome, the polymorphism of rs58600253 or genotypic material are PCR primer and the single-basic extension primer that amplification comprises the genomic DNA fragment of rs58600253, described PCR primer is the primer shown in SEQIDNo.1 and SEQIDNo.2, and described single-basic extension primer is the primer shown in SEQIDNo.5; Described rs58600253 genotype is TT, TC or CC; Described TT is rs58600253 site is the homozygous of T, and described CC is rs58600253 site is the homozygous of C, the heterozygous of described TC to be rs58600253 site be T and C; Described TT and the ratio of the genotypic individuality of described TC in leper colony are respectively higher than the ratio of genotype in normal people colony of correspondence.
3. the polymorphism or the genotypic material that detect rs58600253 in human genome detect the application in the product of the single nucleotide polymorphism relevant to leprosy in preparation; In described detection human genome, the polymorphism of rs58600253 or genotypic material are PCR primer and the single-basic extension primer that amplification comprises the genomic DNA fragment of rs58600253, described PCR primer is the primer shown in SEQIDNo.1 and SEQIDNo.2, and described single-basic extension primer is the primer shown in SEQIDNo.5; Described rs58600253 genotype is TT, TC or CC; Described TT is rs58600253 site is the homozygous of T, and described CC is rs58600253 site is the homozygous of C, the heterozygous of described TC to be rs58600253 site be T and C; Described TT and the ratio of the genotypic individuality of described TC in leper colony are respectively higher than the ratio of genotype in normal people colony of correspondence.
4. detect the application in the product of characterization or the assistant identification single nucleotide polymorphism relevant to leprosy of the polymorphism of rs58600253 in human genome or genotypic material; In described detection human genome, the polymorphism of rs58600253 or genotypic material are PCR primer and the single-basic extension primer that amplification comprises the genomic DNA fragment of rs58600253, described PCR primer is the primer shown in SEQIDNo.1 and SEQIDNo.2, and described single-basic extension primer is the primer shown in SEQIDNo.5; Described rs58600253 genotype is TT, TC or CC; Described TT is rs58600253 site is the homozygous of T, and described CC is rs58600253 site is the homozygous of C, the heterozygous of described TC to be rs58600253 site be T and C; Described TT and the ratio of the genotypic individuality of described TC in leper colony are respectively higher than the ratio of genotype in normal people colony of correspondence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410531166.6A CN104293947B (en) | 2014-10-10 | 2014-10-10 | Single nucleotide polymorphism rs58600253 is detecting the application in susceptibility gene of leprosy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410531166.6A CN104293947B (en) | 2014-10-10 | 2014-10-10 | Single nucleotide polymorphism rs58600253 is detecting the application in susceptibility gene of leprosy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104293947A CN104293947A (en) | 2015-01-21 |
| CN104293947B true CN104293947B (en) | 2016-03-23 |
Family
ID=52313894
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410531166.6A Expired - Fee Related CN104293947B (en) | 2014-10-10 | 2014-10-10 | Single nucleotide polymorphism rs58600253 is detecting the application in susceptibility gene of leprosy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104293947B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102876793A (en) * | 2012-09-29 | 2013-01-16 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphism rs2058660 to detecting susceptibility gene of leprosy |
| CN102876794A (en) * | 2012-09-29 | 2013-01-16 | 山东省皮肤病性病防治研究所 | Application of mononucleotide polymorphic rs6871626 in detection of susceptibility genes of lepriasis |
| CN102899413A (en) * | 2012-09-29 | 2013-01-30 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphisms of rs2735591 in detection of leprosy susceptibility genes |
-
2014
- 2014-10-10 CN CN201410531166.6A patent/CN104293947B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102876793A (en) * | 2012-09-29 | 2013-01-16 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphism rs2058660 to detecting susceptibility gene of leprosy |
| CN102876794A (en) * | 2012-09-29 | 2013-01-16 | 山东省皮肤病性病防治研究所 | Application of mononucleotide polymorphic rs6871626 in detection of susceptibility genes of lepriasis |
| CN102899413A (en) * | 2012-09-29 | 2013-01-30 | 山东省皮肤病性病防治研究所 | Application of single nucleotide polymorphisms of rs2735591 in detection of leprosy susceptibility genes |
Non-Patent Citations (2)
| Title |
|---|
| Human Polymorphisms as Clinical Predictors in Leprosy;Ernesto Prado Montes de Oca;《J Trop Med》;20111218;1-14 * |
| ss83875539;NCBI;《NCBI》;20071130;1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104293947A (en) | 2015-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104293946B (en) | Single nucleotide polymorphism rs663743 is detecting the application in susceptibility gene of leprosy | |
| CN104293952B (en) | Single nucleotide polymorphism rs10817758 application in detection susceptibility gene of leprosy | |
| Bamshad et al. | Deconstructing the relationship between genetics and race | |
| Liu et al. | Discovery of six new susceptibility loci and analysis of pleiotropic effects in leprosy | |
| De Bakker et al. | A high-resolution HLA and SNP haplotype map for disease association studies in the extended human MHC | |
| Little et al. | Reporting, appraising, and integrating data on genotype prevalence and gene-disease associations | |
| Martinez-Mir et al. | Genomewide scan for linkage reveals evidence of several susceptibility loci for alopecia areata | |
| Dumitrescu et al. | Assessing the accuracy of observer-reported ancestry in a biorepository linked to electronic medical records | |
| Santos et al. | A minimum set of ancestry informative markers for determining admixture proportions in a mixed American population: the Brazilian set | |
| Qi et al. | Discovery of susceptibility loci associated with tuberculosis in Han Chinese | |
| Saw et al. | Establishing multiple omics baselines for three Southeast Asian populations in the Singapore Integrative Omics Study | |
| CN106868126B (en) | Fluorescent quantitative PCR detection kit and detection method | |
| CN102876793B (en) | Application of single nucleotide polymorphism rs2058660 to detecting susceptibility gene of leprosy | |
| Magalhães da Silva et al. | The correlation between ancestry and color in two cities of Northeast Brazil with contrasting ethnic compositions | |
| CN102876794B (en) | Application of mononucleotide polymorphic rs6871626 in detection of susceptibility genes of lepriasis | |
| CN102899413B (en) | Application of single nucleotide polymorphisms of rs2735591 in detection of leprosy susceptibility genes | |
| Koch et al. | Global transcriptome profiling of mild relapsing‐remitting versus primary progressive multiple sclerosis | |
| Poodineh et al. | Association of two methylenetetrahydrofolate reductase polymorphisms (rs1801133, rs1801131) with the risk of type 2 diabetes in South-East of Iran | |
| CN104630374A (en) | Rheumatoid-arthritis-related single-gene single nucleotide polymorphism site and application thereof | |
| CN104293950B (en) | Single nucleotide polymorphism rs77061563 is detecting the application in susceptibility gene of leprosy | |
| Chatterton et al. | Brain-derived circulating cell-free DNA defines the brain region and cell specific origins associated with neuronal atrophy | |
| CN107653311B (en) | Single nucleotide polymorphism rs4883263 detection system related to blood lipid level and related application | |
| Vercelli et al. | Strength in numbers: the quest for asthma genes | |
| CN104293947B (en) | Single nucleotide polymorphism rs58600253 is detecting the application in susceptibility gene of leprosy | |
| CN104293949B (en) | Single nucleotide polymorphism rs73058713 is detecting the application in susceptibility gene of leprosy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160323 Termination date: 20211010 |