CN104293894A - Tree SNB locus genotype detection method - Google Patents
Tree SNB locus genotype detection method Download PDFInfo
- Publication number
- CN104293894A CN104293894A CN201310298853.3A CN201310298853A CN104293894A CN 104293894 A CN104293894 A CN 104293894A CN 201310298853 A CN201310298853 A CN 201310298853A CN 104293894 A CN104293894 A CN 104293894A
- Authority
- CN
- China
- Prior art keywords
- site
- amplimer
- detection method
- pcr amplification
- single chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a tree SNB locus genotype detection method including following steps: (S1) performing PCR amplification to tree whole genomic DNA with an amplification primer to obtain a PCR amplification product of which a length is not more than 500 bp, wherein the amplification primer is provided with a biotin label; (S2) carrying out single-chain preparation to the PCR amplification product obtained through the step (S1) to obtain a DNA single chain of which a 5'-terminal is labeled by biotin, wherein the DNA single chain comprises a plurality of to-be-detected loca; and (S3) performing pyrosequencing to the DNA single chain obtained through the step (S2) to obtain a genotyping result, wherein a sequence reading length is 20-50 bp, a mixed enzyme usage amount is 390-395 [mu]l/plate, and a fluorogenic substrate usage amount is 390-395 [mu]l/plate. By means of the method, a sequencing length is lengthened and a plurality of loca can be detected in one time sequencing. Meanwhile, reagent usage amount is reduced by 1/3 and a cost is reduced.
Description
Technical field
The present invention relates to molecular genetics field, in particular to a kind of trees SNP site genotype detection method.
Background technology
When Manganic pyrophosphate complex initiation typing method mainly make use of nucleic acid chains extension, often add a nucleotide residue, a tetra-sodium group (PPi) will be discharged, and PPi and adenosine-5'-phosphosulfate(APS) (APS) are under the catalysis of enzyme, can generate the ATP of equivalent.ATP drives luciferase mediation fluorescein to be converted into oxyluciferin, discharges intensity and measures to ATP the visible light signal be directly proportional.Therefore, by presence or absence and the power of visible light signal, can judge whether this nucleotide residue is connected to the quantity of nucleic acid chains end and connection.So by adding thio triphosphates adenosine (dATPS successively in the primer hybridization extension system being template with the DNA single chain of waiting to check order respectively, substitute dATP), one in GTP (guanosine triphosphate) (dGTP), cytidine (dCTP) and thymidine triphosphate (dTTP) four kinds, by detecting the size whether having visible ray generation and visual intensity, the nucleotide residue type that extends and quantity can be judged, thus reach and template DNA strand checked order and the object of genotype type detection.
At present, Manganic pyrophosphate complex initiation typing method is mainly used in physianthropy and zooscopy field, and plant field seldom uses, and especially trees field is then blank.
Summary of the invention
The present invention aims to provide a kind of trees SNP site genotype detection method, compensate for the blank of Manganic pyrophosphate complex initiation typing method in trees field.
To achieve these goals, according to an aspect of the present invention, provide a kind of trees SNP site genotype detection method, this detection method comprises: step S1, amplimer is adopted to carry out pcr amplification to the complete genome DNA of trees, obtain the pcr amplification product that length is not more than 500bp, wherein amplimer has biotin labeling; Step S2, carries out strand preparation to the pcr amplification product obtained in step S1, and obtaining 5 ' end has biotin labeled DNA single chain, and DNA single chain comprises multiple site to be measured; Step S3, utilize sequencing primer to carry out Manganic pyrophosphate complex initiation analysis to the DNA single chain that step S2 obtains, wherein Sequence read lengths is 20 ~ 50bp, and mixed enzyme consumption is 390 ~ 395 μ l/plate, fluorogenic substrate consumption is 390 ~ 395 μ l/plate, obtains genotyping result.
Further, above-mentioned amplimer comprises forward amplimer and reverse amplimer, and forward amplimer or oppositely amplimer have biotin labeling.
Further, in above-mentioned site to be measured first site to be measured near last base of 3 ' end of sequencing primer.
Further, in above-mentioned steps S1, the system of pcr amplification is 25 μ l, is made up of 20ng complete genome DNA, 0.8U Taq enzyme, 0.2mM dNTPs, 10 × PCR damping fluid and 50ng forward primer and 50ng reverse primer and ultrapure water.
Further, in above-mentioned steps S1, pcr amplification comprises: step S11, by complete genome DNA successively denaturation 6min, sex change 30s at 95 DEG C at 95 DEG C, obtains denatured products; Step S12, anneal denatured products at 50 ~ 60 DEG C 30s, obtains annealed product; Step S13, by annealed product at 72 DEG C of downward-extension 1min; Step S14, repeated 35 ~ 45 times by step S11 to step S13, and last step S13 continues 10min.
Further, in above-mentioned steps S2, the preparation of DNA single chain comprises: step S21, mixes pcr amplification product with binding buffer liquid, sepharose 4B, forms mixture; Step S22, carries out chemical modification by mixture, obtains having biotin labeled DNA single chain.
Further, above-mentioned trees are populus simonii, and site to be measured is SNP1 site and the SNP2 site of CBF2 gene, and SNP1 site is positioned at the 68bp place of CBF2 gene, SNP2 site is positioned at the 95bp place of CBF2 gene, and wherein the base sequence of CBF2 gene is SEQ ID NO:1.
Further, above-mentioned amplimer comprises forward amplimer and reverse amplimer, wherein the base sequence of forward amplimer is SEQ ID NO:2, and the base sequence of reverse amplimer is SEQ ID NO:3, and forward amplimer adopts vitamin H to mark.
Further, the base sequence of above-mentioned sequencing primer is SEQ ID NO:4, and the genotype in SNP1 site is the genotype in T and C, SNP2 site is A and G, and has a base between SNP2 site and last base of sequencing primer 3' end.
Technical scheme of the present invention make use of the feature that trees gene heterozygosity is high, DNA sequence polymorphism is abundant, order-checking length is extended to 20 ~ 50bp by 20bp of the prior art, thus makes once sequencing be obtained by reacting more loci gene type information; Mixed enzyme consumption and fluorogenic substrate consumption are reduced to 390 ~ 395 μ l/plate by 588 μ l/plate of the prior art simultaneously, have saved the consumption of 1/3rd, therefore on the basis that ensure that detected result accuracy, reduced experimental cost.
Accompanying drawing explanation
The Figure of description forming a application's part is used to provide a further understanding of the present invention, and schematic description and description of the present invention, for explaining the present invention, does not form inappropriate limitation of the present invention.In the accompanying drawings:
Fig. 1 shows the genotype peak figure of the sequencing and typing result of embodiment 1.
Embodiment
It should be noted that, when not conflicting, the embodiment in the application and the feature in embodiment can combine mutually.Below with reference to the accompanying drawings and describe the present invention in detail in conjunction with the embodiments.
In a kind of typical embodiment of the present invention, provide a kind of trees SNP site genotype detection method, above-mentioned detection method comprises: step S1, the complete genome DNA of pcr amplification primer pair trees is adopted to carry out pcr amplification, obtain the pcr amplification product that length is not more than 500bp, wherein said amplimer has biotin labeling; Step S2, carries out strand preparation to the pcr amplification product obtained in described step S1, and obtaining 5 ' end has biotin labeled DNA single chain, and DNA single chain comprises multiple site to be measured; Step S3, utilize sequencing primer to carry out Manganic pyrophosphate complex initiation analysis to the DNA single chain that described step S2 obtains, wherein Sequence read lengths is 20 ~ 50bp, and mixed enzyme consumption is 390 ~ 395 μ l/plate, fluorogenic substrate consumption is 390 ~ 395 μ l/plate, obtains genotyping result.
Technique scheme make use of the feature that trees gene heterozygosity is high, DNA sequence polymorphism is abundant, order-checking length is extended to 20 ~ 50bp by 20bp of the prior art, thus makes once sequencing be obtained by reacting more loci gene type information; Mixed enzyme consumption and fluorogenic substrate consumption are reduced to 390 ~ 395 μ l/plate by 588 μ l/plate of the prior art simultaneously, have saved the consumption of 1/3rd, therefore on the basis that ensure that detected result accuracy, reduced experimental cost.Mixed enzyme wherein and fluorogenic substrate are conventional substances when Manganic pyrophosphate complex initiation is carried out in this area, the mixed enzyme that such as mixed enzyme is archaeal dna polymerase (DNA polymerase), sulfurylase (ATP sulfurylase), luciferase (luciferase) and bisphosphatase (apyrase) form, does not repeat them here.
The amplimer applied in above-mentioned detection method comprises forward amplimer and reverse amplimer, and forward amplimer or oppositely amplimer have biotin labeling.
In order to improve the accuracy of genotyping result and increase the number in site to be measured, in preferred above-mentioned site to be measured, first site to be measured is near last base of 3 ' end of sequencing primer.
In a kind of preferred embodiment of the present invention, in preferred above-mentioned steps S1, the system of pcr amplification is 25 μ l, is made up of 20ng complete genome DNA, 0.8U Taq enzyme, 0.2mM dNTPs, 10 × PCR damping fluid and 50ng forward primer and 50ng reverse primer and ultrapure water.
When carrying out the pcr amplification of step S1, in order to improve concentration and the specificity of obtained pcr amplification product, in preferred above-mentioned steps S1, pcr amplification comprises: step S11, by complete genome DNA successively denaturation 6min, sex change 30s at 95 DEG C at 95 DEG C, obtains denatured products; Step S12, anneal denatured products at 50 ~ 60 DEG C 30s, obtains annealed product; Step S13, by annealed product at 72 DEG C of downward-extension 1min; Step S14, repeated 35 ~ 45 times by step S11 to step S13, preferably 39 to 42 times, and last step S13 continues 10min.
In another preferred embodiment of the present invention, in above-mentioned steps S2, the preparation of DNA single chain comprises: step S21, mixes pcr amplification product with binding buffer liquid, sepharose 4B, forms mixture; Step S22, carries out chemical modification by mixture, obtains DNA single chain.Wherein, the binding buffer liquid in the step S21 for preparing of single stranded DNA is often damping fluid that 10mM Tris-HCl, 2M NaCl conventional in prior art, 1mM EDTA and 0.1%Tween20 form; In step S22, chemical modification is also the conventional denaturation buffer utilizing this area, as 70% ethanol, 0.2M NaOH solution and lavation buffer solution (10mM Tris-Acetate).For the consumption of the reagent applied in above DNA single chain preparation process and reality, those skilled in the art can according to the characteristic of pcr amplification product and concentration, on the basis of existing background knowledge, and the corresponding binding buffer liquid of choose reasonable and denaturation buffer.
In a kind of specific embodiment optimized of the present invention, above-mentioned trees are populus simonii, and site to be measured is SNP1 site and the SNP2 site of CBF2 gene, and SNP1 is positioned at 68bp place, and SNP2 is positioned at 95bp place, and wherein the base sequence of CBF2 gene is SEQ ID NO:1.The distance in SNP1 site and SNP2 site is 26bp, even if that is detection method of the present invention also can be adopted to detect at a distance of the site of 26bp.
When the SNP12 site of the CBF4 gene to populus simonii and SNP13 site are analyzed, preferred above-mentioned amplimer comprises forward amplimer and reverse amplimer, wherein the base sequence of forward amplimer is SEQ ID NO:2, the base sequence of reverse amplimer is SEQ ID NO:3, and forward amplimer adopts vitamin H to mark.The base sequence of sequencing primer is SEQ ID NO:4, and the genotype in SNP1 site is the genotype in T and C, SNP2 site is A and G, and has a base between SNP2 site and last base of sequencing primer 3' end.
Embodiment 1
Have collected 528 strains individual as research object from populus simonii distributing region.After extracting the genomic dna of every strain individuality, random choose 40 strains are individual, and carry out cloning and sequencing to its CBF2 gene respectively, be SNP1 and SNP2 by sequence alignment determination candidate SNP s site.
Distance for two sites is SNP1 site and the SNP2 site of 26bp, on the basis obtaining populus simonii CBF2 gene complete sequence, the base sequence of design and synthesis forward amplimer is SEQ ID NO:2:5 '-TGCCTTCAGTTCTTGTTG-3 ', the base sequence of reverse amplimer is SEQ ID NO:3:5 '-GTTTGGTTCCCGCATCTC-3 ', wherein forward amplimer vitamin H marks, and expanding fragment length is 280bp.
A design and synthesis base sequence is the reverse sequencing primer of SEQ ID NO:4:5 '-GCTTCTTGCCTGTCA-3 ', the genotype of two site SNP1 to be detected is T and C, the genotype of SNP2 is A and G, and has a base between SNP2 site and last base phase of 3 ' end of reverse sequencing primer.
Use above-mentioned amplimer, respectively pcr amplification is carried out to the genomic dna of individual plant in populus simonii natural population, finally obtain 6 batches, the pcr amplification product of CBF2 Gene Partial fragment of totally 528.The system of pcr amplification is: 20ng genomic dna, 0.8UTaq enzyme, 0.2mMdNTPs, 10 × PCR buffer and 50ng forward primer and 50ng reverse primer, supplements ultrapure water to 25 μ l.The condition of pcr amplification is: denaturation 95 DEG C of 6min, sex change 95 DEG C of 30s, and anneal 58 DEG C of 30s, extends 72 DEG C of 1min, 40 circulations, last extension 72 DEG C of 10min.
In the pcr amplification product obtained after above-mentioned pcr amplification, every batch of Stochastic choice 10 samples, carry out sampling quality inspection, by the method for agarose gel electrophoresis, detect its specificity and concentration, with judge this batch of whole amplified production whether can carry out subsequently strand preparation and sequencing and typing step subsequently in each sample, the sepharose beads of the binding buffer liquid and 1 μ l that add 24 μ l respectively mixes, shake 15min on the oscillator, formation is suspended mixture, wherein, binding buffer liquid is 10mM Tris-HCl, 2M NaCl, the damping fluid that 1mM EDTA and 0.1%Tween20 forms.
Then, this being suspended mixture is adsorbed onto on film, namely 70% ethanol is inserted successively, elution wash in the lavation buffer solution of 0.2M NaOH solution solution and 10mM Tris-Acetate, finally on film, obtain biotin labeled forward single stranded DNA, being discharged into containing base sequence subsequently is respectively in the sex change annealing buffer of the reverse sequencing primer of SEQ ID NO:3, wherein sex change annealing buffer is the damping fluid that 20mM Tris-Acetate and 2mM Mg-Acetate form, somatotype mensuration is carried out by Manganic pyrophosphate complex initiation analyser, sequencing and typing reference sequences is set to: TT/CGGGCATTGAATTTGACCTCAAAGGATA/GTT.By being chosen at the application of sample parametric scheme preset in instrument: mixed enzyme injecting time 84ms, fluorogenic substrate injecting time 77ms, mixed enzyme and fluorogenic substrate consumption are 392ul/plate, finally add up genotyping result, and peak shape figure as shown in Figure 1.
Statistical result showed: the genotype in SNP1 site is distributed as 351 strain CC, 102 strain TC and 75 strain TT, the genotype in SNP2 site is distributed as 422 strain GG and 106 strain AG.As can be seen here, detection method of the present invention is adopted also can to obtain genotyping result comparatively accurately in one-time detection to two sites at a distance of 26bp.
The foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, for a person skilled in the art, the present invention can have various modifications and variations.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
。
Claims (9)
1. a trees SNP site genotype detection method, is characterized in that, described detection method comprises:
Step S1, adopt amplimer to carry out pcr amplification to the complete genome DNA of trees, obtain the pcr amplification product that length is not more than 500bp, wherein said amplimer has biotin labeling;
Step S2, carries out strand preparation to the pcr amplification product obtained in described step S1, and obtaining 5 ' end has biotin labeled DNA single chain, and described DNA single chain comprises multiple site to be measured;
Step S3, utilize sequencing primer to carry out Manganic pyrophosphate complex initiation analysis to the described DNA single chain that described step S2 obtains, wherein Sequence read lengths is 20 ~ 50bp, and mixed enzyme consumption is 390 ~ 395 μ l/plate, fluorogenic substrate consumption is 390 ~ 395 μ l/plate, obtains genotyping result.
2. detection method according to claim 1, is characterized in that, described amplimer comprises forward amplimer and reverse amplimer, and described forward amplimer or described reverse amplimer have described biotin labeling.
3. detection method according to claim 1, is characterized in that, in described site to be measured, first site to be measured is near last base of 3 ' end of described sequencing primer.
4. detection method according to claim 1, it is characterized in that, the system of pcr amplification described in described step S1 is 25 μ l, is made up of 20ng complete genome DNA, 0.8U Taq enzyme, 0.2mM dNTPs, 10 × PCR damping fluid and 50ng forward primer and 50ng reverse primer and ultrapure water.
5. detection method according to claim 4, is characterized in that, described in described step S1, pcr amplification comprises:
Step S11, by described complete genome DNA successively denaturation 6min, sex change 30s at 95 DEG C at 95 DEG C, obtains denatured products;
Step S12, anneal described denatured products at 50 ~ 60 DEG C 30s, obtains annealed product;
Step S13, by described annealed product at 72 DEG C of downward-extension 1min;
Step S14, repeated 35 ~ 45 times by described step S11, and last described step S13 continues 10min to described step S13.
6. detection method according to claim 1, is characterized in that, the preparation of DNA single chain described in described step S2 comprises:
Step S21, mixes described pcr amplification product with binding buffer liquid, sepharose 4B, forms mixture;
Step S22, carries out chemical modification by described mixture, obtains having described biotin labeled described DNA single chain.
7. detection method according to any one of claim 1 to 6, it is characterized in that, described trees are populus simonii, described site to be measured is SNP1 site and the SNP2 site of CBF2 gene, described SNP1 site is positioned at the 68bp place of described CBF2 gene, described SNP2 site is positioned at the 95bp place of described CBF2 gene, and wherein the base sequence of CBF2 gene is SEQ ID NO:1.
8. detection method according to claim 7, it is characterized in that, described amplimer comprises forward amplimer and reverse amplimer, the base sequence of wherein said forward amplimer is SEQ ID NO:2, the base sequence of described reverse amplimer is SEQ ID NO:3, and described forward amplimer adopts described vitamin H to mark.
9. detection method according to claim 7, it is characterized in that, the base sequence of described sequencing primer is SEQ ID NO:4, the genotype in described SNP1 site is T and C, the genotype in described SNP2 site is A and G, and has a base between described SNP2 site and described last base of sequencing primer 3' end.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310298853.3A CN104293894B (en) | 2013-07-16 | 2013-07-16 | A kind of trees SNP site genotype detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310298853.3A CN104293894B (en) | 2013-07-16 | 2013-07-16 | A kind of trees SNP site genotype detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104293894A true CN104293894A (en) | 2015-01-21 |
| CN104293894B CN104293894B (en) | 2016-08-31 |
Family
ID=52313842
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310298853.3A Active CN104293894B (en) | 2013-07-16 | 2013-07-16 | A kind of trees SNP site genotype detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104293894B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106845152A (en) * | 2017-02-04 | 2017-06-13 | 北京林业大学 | A kind of genome cytimidine site apparent gene type classifying method |
-
2013
- 2013-07-16 CN CN201310298853.3A patent/CN104293894B/en active Active
Non-Patent Citations (6)
| Title |
|---|
| PER UNNEBERG: "Computational approaches for in-depth analysis of cDNA sequence tags", 《DOCTORAL THESIS OF ROYAL INSTITUTE OF TECHNOLOGY ALBANOVA UNIVERSITY CENTER 》 * |
| PETER J. MAUGHAN: "Single-Nucleotide Polymorphism Genotyping in Mapping Populations via Genomic Reduction and Next-Generation Sequencing: Proof of Concept", 《THE PLANT GENOME》 * |
| 兰青阔: "基于SNP标记的黄瓜杂交种纯度鉴定方法", 《中国蔬菜》 * |
| 叶卉: "焦磷酸测序中PCR 引物与测序引物的设计", 《分析化学研究报告》 * |
| 袁群英等: "焦磷酸测序技术及其在水稻单核苷酸多态性研究中的应用", 《浙江农业学报》 * |
| 郭琦等: "毛白杨PtDREB2A基因的克隆、表达及单核苷酸多态性分析", 《林业科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106845152A (en) * | 2017-02-04 | 2017-06-13 | 北京林业大学 | A kind of genome cytimidine site apparent gene type classifying method |
| CN106845152B (en) * | 2017-02-04 | 2019-01-29 | 北京林业大学 | A kind of genome cytimidine site apparent gene type classifying method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104293894B (en) | 2016-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Daniel et al. | A SNaPshot of next generation sequencing for forensic SNP analysis | |
| Brion et al. | Hierarchical analysis of 30 Y-chromosome SNPs in European populations | |
| CN101586150B (en) | Detection probe, general oligonucleotide chip and nucleic acid detection method and application thereof | |
| EP2802666B1 (en) | Genotyping by next-generation sequencing | |
| CN101619352B (en) | Double-probe gene mutation detecting method based on allele special amplification as well as special chip and kit thereof | |
| Gu et al. | Smart-RRBS for single-cell methylome and transcriptome analysis | |
| EP2341151A1 (en) | Methods for determining sequence variants using ultra-deep sequencing | |
| US20060172324A1 (en) | Methods of genotyping using differences in melting temperature | |
| Kenta et al. | Multiplex SNP‐SCALE: a cost‐effective medium‐throughput single nucleotide polymorphism genotyping method | |
| CN104372093A (en) | SNP (single-nucleotide polymorphism) detection method based on high-flux sequencing | |
| Guevara et al. | Analysis of DNA cytosine methylation patterns using methylation-sensitive amplification polymorphism (MSAP) | |
| Pettersson et al. | Molecular haplotype determination using allele-specific PCR and pyrosequencing technology | |
| RU2014126423A (en) | HIGH-PERFORMANCE ANALYSIS OF SINGLE-NUCLEOTIDE POLYMORPHISMS | |
| Zha et al. | E xploring of tri‐allelic SNP s using P yrosequencing and the SN a P shot methods for forensic application | |
| CN111996244B (en) | Composition for detecting single nucleotide polymorphism and application thereof | |
| Sanchez et al. | Typing of Y chromosome SNPs with multiplex PCR methods | |
| WO2012099397A2 (en) | Method for determining the single nucleotide polymorphism of target genes using a real-time polymerase chain reaction, and kit for determining the single nucleotide polymorphism of target genes using same | |
| Xiao et al. | Gel immobilization of acrylamide‐modified single‐stranded DNA template for pyrosequencing | |
| CN107937493B (en) | Hairpin modified primer for allele PCR | |
| CN104293894B (en) | A kind of trees SNP site genotype detection method | |
| Li et al. | Single nucleotide polymorphism genotyping and point mutation detection by ligation on microarrays | |
| KR101955074B1 (en) | Snp markers for discrimination of raphanus sativus | |
| CN113373241B (en) | Microsatellite marker of fishes in loach, and amplification primer and application thereof | |
| CN106520948B (en) | Reverse probe, kit and detection method for visually detecting single nucleotide polymorphism sites in gene sequence | |
| de Paula Careta et al. | Recent patents on high-throughput single nucleotide polymorphism (SNP) genotyping methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |