CN104292336A - Application of Oryza sativa transcription factor Os03g50310 gene - Google Patents
Application of Oryza sativa transcription factor Os03g50310 gene Download PDFInfo
- Publication number
- CN104292336A CN104292336A CN201310296096.6A CN201310296096A CN104292336A CN 104292336 A CN104292336 A CN 104292336A CN 201310296096 A CN201310296096 A CN 201310296096A CN 104292336 A CN104292336 A CN 104292336A
- Authority
- CN
- China
- Prior art keywords
- os03g50310
- rice
- gene
- transcription factor
- fusion rotein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the application of an Oryza sativa transcription factor Os03g50310 gene. According to the invention, transcription-factor-activating motif VP64 is fused with the Oryza sativa transcription factor Os03g50310 gene, such that a composite transcription factor is constructed, and is transferred into a crop such as Oryza sativa for increasing the yield. For example, plant height can be increased, and grains per panicle can be increased. The invention has important theoretical value for specifically explaining the development mechanism for controlling Oryza sativa yield. With a transgenic approach, Oryza sativa yield can be improved. The application has a good market application prospect.
Description
Technical field
The present invention relates to genetically engineered field, specifically, relate to the application of rice transcription factor Os03g50310 gene.
Background technology
Paddy rice (Oryza sativa L.) is one of most important Three major grain crops in China and the whole world, is the staple food of world's population over half, is also the model plant of an important functional gene research.The attention of relative genetics and molecular biology research extremely investigator always, the regulation and control of transcriptional level are the important way of gene expression regulation.The research of current increasing production of rice comparatively depends on limited Rice Germplasm Resources, and traditional cross-breeding advantage weakens gradually, and Transgenic Rice technology likely excavates the potentiality that paddy rice is increased production further.
Rice yield is a complicated economical character, reconstructed by number of productive ear, fringe examples explain and grain, majority shows as quantitative character, from botanical aspect, tiller to grow with fringe portion and all comprise apical growth and branch, the final formation of plant type and fringe type depends on the balance and coordination between both, receives the complex network regulation and control that genotype, hormone, photoperiod, inner growth signal and environmental factor etc. are formed.The heavy length and width by paddy of grain, thick and circularity determine jointly.Up to now, the number ratio of report single plant yield QTL (quantitative trait locus) is less, and this may be cause output not change because most QTL has positives and negatives simultaneously, low relevant with the heritability of output in addition.Xiao etc. detect 2 and just imitate QTL in Malaysian common wild-rice, yld1.1 and yld2.1 can improve output 18%, 17% respectively.Li Dejun etc. find 2 high yield QTL on the 2nd and 11 karyomit(e)s of Dongxiang common wild-rice, and contribution rate is respectively 17%, 12%, He etc. and has carried out Fine Mapping to the high yield QTL be positioned on the 2nd karyomit(e).Comparatively speaking, the report positioning using Yield And Yield Components as phenotype and clone is then more, and as gene Ghd7 expresses enhancing under long day, thus delay is eared, and plant is increased, grain number per spike increases, stem stalk is sturdy anti-fall, thus improves single plant yield.Be positioned at the Gn1a genes encoding phytokinin oxidation/desaturase on the 1st the short arm of a chromosome, can degradation of cell mitogen content Gn1a be a negative regulation factor, the reduction of expression amount can cause the accumulation of phytokinin in inflorescence meristem, promote the increase of reproductive organ quantity, thus increase floret bears amount, finally improve output.
VP64 is that 4 VP16 functional domain motifs merge composition, is a class enhanser.VP16 finds in animal virus gene, has now been widely applied in plant, is mainly used in the research of the transcriptional control of plant gene.Transcription factor effect in vivo can be divided into two kinds substantially: a kind of is transcriptional enhancer, and another kind is Transcription inhibition.After transcription factor and VP16 functional domain motif merge, it will strengthen the function of transcription factor, thus in transfer-gen plant, occur more obvious character mutation.
CONSTANS-LIKE protein family is a transcription factor family, containing 17 gene members in Arabidopis thaliana, containing 2 conserved regions, B-box and CCT (CO, COL and TOC1) district.In Arabidopis thaliana, the multiple gene of CONSTANS-LIKE family regulates Photoperiod pathway flowering time jointly.Current CONSTANS-LIKE family transcription factor Os03g50310 is to the research of crop yield regulatory mechanism and be familiar with seldom, and therefore the research of this transcription factor is in theory for the molecule mechanism understanding crop yield regulation and control further provides new clue; Practice also will be provided fundamental basis for high-yield breeding of crops.
Summary of the invention
The object of this invention is to provide the application of rice transcription factor Os03g50310 gene.
In order to realize object of the present invention, the present invention provide firstly a kind of fusion rotein, and this fusion rotein is (VP16)
n-Linker-Os03g50310; Wherein, n is the integer of>=1; Linker is in series by 1 ~ 50 flexible amino acid; VP16 is the VP16 albumen from hsv (Herpes simplex virus); Os03g50310 is rice transcription factor Os03g50310.
Further, described fusion rotein is (VP16)
4-Linker-Os03g50310; Wherein, Linker is in series by 39 flexible amino acid.
The nucleotide sequence of described rice transcription factor Os03g50310 is as shown in SEQ ID No.1, and its aminoacid sequence is as shown in SEQ ID No.2.
Wherein, Linker is in series by 39 flexible amino acid, and its sequence is as shown in SEQ ID No.9, and its nucleotide sequence is as shown in SEQ ID No.3; VP16 is the VP16 albumen from hsv; Os03g50310 is rice transcription factor Os03g50310.
The aminoacid sequence of described rice transcription factor Os03g50310 is as shown in SEQ ID No.2, or this sequence also belongs to protection scope of the present invention through replacing, lacking or add one or several amino acids formed aminoacid sequence with same function.
Wherein, (VP16) 4 i.e. VP64, merge with Gly Ser two acids apart the enhanser formed by 4 VP16 functional domain motifs (Asp Ala Leu Asp Asp Phe Asp Leu Asp Met Leu), its sequence is as shown in SEQ ID No.10, and its nucleotide sequence is as shown in SEQ ID No.4.
The present invention also provides the carrier of the gene containing encoding said fusion protein.
The construction process of described carrier is as follows:
(1) in plant transcription factor database, Os03g50310 gene is found, according to its sequences Design pcr amplification primer pair, it is forward primer F:5'-CAAAAAAGCAGGCTTCATGGCGAGCGCCGCCGCGGCG-3' and reverse primer R:5'-CAAGAAAGCTGGGTCAAAACGGTAGCGCCCGTG;
(2) with the total cDNA of the fine paddy rice of wild Japanese for template, carry out PCR and obtain Os03g50310 complete sequence;
(3) PCR primer is cloned on connection pDONER cloning vector, obtains the identical sequence with goal gene through order-checking qualification;
(4) sequence comprised with binary expression vector right boundary is for frame sequence, pass through vitro recombination, ubi promoter-Gateway-VP64 is expressed unit, 35S promoter-asRED expresses unit and 35S promoter-bar expression unit constructs with it, obtains the complete sequence of carrier cVP64-bar-asRED as shown in SEQ ID No.5;
(5) to be building up to by Os03g50310 by LR reaction and to have merged on the plant expression vector cVP64-bar-asRED of VP64 label, obtain carrier ubi::Os03g50310-VP64, carrier complete sequence is as shown in SEQ ID No.6.
The expression vector carrying the gene of encoding said fusion protein imports (Weissbach in vegetable cell by using the standard biologic technological methods such as Ti-plasmids, plant viral vector, directly delivered DNA, microinjection, electroporation, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, 411-463 page; Geiserson and Corey, 1998, Plant Molecular Biology, 2nd Edition).
The present invention also provides the engineering bacteria of the gene containing encoding said fusion protein.
The present invention also provides a kind of construction process of transgenic rice plant, be specially, adopt agriculture bacillus mediated method, aforementioned bearer is proceeded in Rice Callus, transform with the AAM conversion fluid containing inductor and Agrobacterium, material after conversion through the exercise of Dual culture-screen-break up-take root-transgenic seedling and transplanting, screening transgenic rice plant.
The present invention also provides the application of the gene of encoding said fusion protein in improvement rice yield (as increased number of grain per ear).
Present invention also offers the primer pair for amplifying rice transcription factor Os03g50310 gene, it is forward primer F:5'-CAAAAAAGCAGGCTTC ATGGCGAGCGCCGCCGCGGCG-3' and reverse primer R:5'-CAAGAAAGCTGGGTC AAAACGGTAGCGCCCGTG-3'.
The present invention also provides the application of rice transcription factor Os03g50310 gene in adjusting and controlling rice yield traits further.
Aforesaid application is by the CDS sequence of rice transcription factor Os03g50310 gene by the downstream of Gateway system constructing to 4 transcription factor activation motif VP16, rice transformation, thus the proterties of improvement transgenic paddy rice output.
The present invention utilizes transcription factor activation motif VP64(i.e. 4 transcription factor activation motif VP16 first) build obtain composing type transcription factor with rice transcription factor Os03g50310 gene fusion, and be transformed in paddy rice, thus improvement rice yield traits, as increased grain number, the increase single plant yield of every fringe.For illustrating regulation and control output development mechanism in detail, there is important theory value, and can transgenic approach be passed through, increase the output of paddy rice, therefore also significant in production practice.
Accompanying drawing explanation
Fig. 1 is cVP64-bar-asRED Vector map in the embodiment of the present invention 1.
Fig. 2 is ubi::Os03g50310-VP64 Vector map in the embodiment of the present invention 1.
Fig. 3 is that Q-PCR of the present invention detects Os03g50310-VP64 transgenic positive strain, and wherein WT is wild rice ' kitaake ', and OE4, OE7 are Os03g50310-VP64 transgenic paddy rice strain.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.
The separation of embodiment Os03g50310 gene and plant expression vector construction
Os03g50310 gene is found in plant transcription factor database, according to its sequences Design pcr amplification primer, according to its sequences Design pcr amplification primer (forward primer F:5'-CAAAAAAGCAGGCTTCATGGCGAGCGCCGCCGCGGCG-3' and reverse primer R:5'-CAAGAAAGCTGGGTCAAAACGGTAGCGCCCGTG.With the total cDNA of the wild-type fine paddy rice of Japan for template, carry out PCR and obtain Os03g50310 complete sequence, its nucleotide sequence is as shown in SEQ ID No.1.
PCR is carried out according to PrimeSTAR polymeric enzymatic amplification system and response procedures.Two-wheeled PCR is comprised in this process, primer the gene primer F and the primer R that add part adaptor attB joint of first round PCR, and the second template of taking turns PCR primer of the first round, and primer complete adaptor attB primer (attB5'adaptor:5'-GTGGGGACAAGTTTGTACAAAAAAGCAGGCTTC-3', attB3'adaptor:5'-GTGGGGACCACTTTGTACAAGAAAGCTGGGTC-3'.）。PCR primer is connected on pDONER cloning vector (purchased from Invitrogen), obtains the identical sequence with goal gene through order-checking qualification.By LR reaction, Os03g50310 is building up to cVP64-bar-asRED(Fig. 1, carrier complete sequence is as shown in SEQ ID No.5) on, obtain carrier ubi::Os03g50310-vp64(Fig. 2, carrier complete sequence is as shown in SEQ ID No.6).
The acquisition of embodiment 2 transgenic rice plant
Water intaking rice ' kitaake ' mature seed, artificial or mechanical dejacketing, selects the full bright and clean seed without bacterial plaque and is inoculated on inducing culture after sterilizing and carries out inducing culture.Selection outward appearance is good, the Rice Callus that growing ability is good is acceptor material, agrobacterium-mediated transformation is adopted to proceed in Rice Callus by ubi::Os03g50310-VP64, transform with the AAM conversion fluid being the Agrobacterium of 0.7 containing the Syringylethanone of 100 μMs and O.D. value, the callus soaked by conversion fluid is placed on Dual culture base and carries out Dual culture, 25 DEG C of light culture 3d are placed in screening culture medium and cultivate about 30d, and every 10d subculture once.Then transferred on division culture medium by the kanamycin-resistant callus tissue sifted out and break up about 20d, every 10d subculture once.Transferred on root media by the kanamycin-resistant callus tissue differentiating green seedling and take root, about 7d grows hardening after flourishing root system, and calculates and transform institute and obtain transgenic seedling number.Grown in field is transferred to after hardening 7d.
Wherein, inducing culture based formulas is: a large amount of+B5 trace+NB of N6 is organic+and molysite+copper cobalt mother liquor+2.5mg/L2,4D+0.6g/L acid hydrolyzed casein+2.878g/L proline(Pro)+0.5g/L glutamine+30g/L sucrose, with water preparation, adds plant gel 4g/L after adjusting pH to 5.8 ~ 5.9.
Dual culture based formulas is: a large amount of+B5 trace+NB of N6 is organic+and molysite+2.5mg/L2,4D+0.5g/L glutamine+0.6g/L acid hydrolyzed casein+10g/L glucose+30g/L sucrose, with water preparation, after adjusting pH to 5.2, add plant gel 4g/L.After sterilizing, about 50 DEG C add AS(Syringylethanone) 100 ~ 200 μ g/mL.
Screening and culturing based formulas is: a large amount of+B5 trace+NB of N6 is organic+and molysite+copper cobalt mother liquor+2.5mg/L2,4D+0.6g/L acid hydrolyzed casein+2.878g/L proline(Pro)+0.5g/L glutamine+30g/L sucrose, with water preparation, after adjusting pH to 5.8 ~ 5.9, add plant gel 4g/L.35mg/L Totomycin (purchased from Shanghai Niu Jin Bioisystech Co., Ltd) is added after sterilizing.
Differentiation culture based formulas is: MS inorganic+MS-B5 trace+MS is organic+and molysite+MS-copper cobalt mother liquor+0.05mg/L NAA+2.0mg/L Kinetin(kinetin)+30g/L sorbyl alcohol+2g/L caseinhydrolysate+30g/L sucrose, with water preparation, after adjusting pH to 5.8 ~ 5.9, add plant gel 4g/L.
The qualification of embodiment 3 transgenic positive strain
For detecting the T2 of ubi::Os03g50310-VP64 gene in embodiment 2 method for the process LAN situation in transgenic paddy rice, Q-PCR is utilized to identify.Real-time quantitative PCR adopts ABIStepOne to carry out, and utilizes SYBR Green I to detect fluorescent signal.Primer sequence is:
Q3g50310-F:TTCGATCCCAGCGAGTCATG
Q3g50310-R:GCACCTCGTACCGGATCTTCTT。
1) reaction system is 15 μ l:
2) response procedures is:
Three-step approach:
1: warm start 95 DEG C of 10s;
2:PCR reacts 95 DEG C of 5s, 58 DEG C of 30s, 60 DEG C of 1min, 40 circulations;
3: melt curve analysis analyzes 95 DEG C of 15s, 60 DEG C of 1min, 95 DEG C of 15s.
If when two-step approach is undesirable, three-step approach is utilized to carry out adjusting and optimizing to annealing temperature.
3) calculating of gene relative expression quantity, utilize Q-PCR instrument to measure the CT value of target gene and reference gene, utilize the expression amount relative to internal reference of the strain after this gene of formulae discovery process LAN below, calculation formula is: relative expression quantity (RQ)=2
-X, wherein X is the difference of the CT value of target gene and the CT value of reference gene.Qualification result shows that transfer-gen plant expression amount increases, and wild-type is not expressed, and sees Fig. 3.
Embodiment 4 transgenic paddy rice phenotype analytical and species test analysis
The transgenic paddy rice obtain the present invention and wild-type (' kitaake ') paddy rice carry out survey product and compare, species test data analysis shows that transgenic paddy rice of the present invention increases than wild rice kitaake plant height, number of grain per ear increases, single plant yield increases, in table 1.Wherein OE4, OE7 are the Os03g50310-VP64 transgenic paddy rice strain that the present invention obtains according to the method for embodiment 2.
Table 1 transgenic paddy rice of the present invention and wild-type (' kitaake ') paddy rice phenotype, species test analysis
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.
Claims (10)
1. a fusion rotein, is characterized in that, this fusion rotein is (VP16)
n-Linker-Os03g50310; Wherein, n is the integer of>=1; Linker is in series by 1 ~ 50 flexible amino acid; VP16 is the VP16 albumen from hsv (Herpes simplex virus); Os03g50310 is rice transcription factor Os03g50310.
2. fusion rotein as claimed in claim 1, it is characterized in that, described fusion rotein is (VP16)
4-Linker-Os03g50310; Wherein, Linker is in series by 39 flexible amino acid.
3. fusion rotein as claimed in claim 1, it is characterized in that, the aminoacid sequence of described rice transcription factor Os03g50310 is as shown in SEQ ID No.2.
4. the gene of fusion rotein described in any one of coding claim 1-3.
5. the carrier containing gene described in claim 4.
6. the engineering bacteria containing gene described in claim 4.
7. the construction process of a transgenic paddy rice, it is characterized in that, adopt agriculture bacillus mediated method, carrier according to claim 5 is proceeded in Rice Callus, transform with the AAM conversion fluid containing inductor and Agrobacterium, material after conversion through the exercise of Dual culture-screen-break up-take root-transgenic seedling and transplanting, screening transgenic rice plant.
8., for the primer pair of amplifying rice transcription factor Os03g50310 gene, it is:
Forward primer F:5'-CAAAAAAGCAGGCTTCATGGCGAGCGCCGCC GCGGCG-3';
Reverse primer R:5'-CAAGAAAGCTGGGTCAAAACGGTAGCGCCC GTG-3'.
9. the application of rice transcription factor Os03g50310 gene in adjusting and controlling rice yield traits.
10. apply as claimed in claim 9, it is characterized in that, it is by the CDS sequence of rice transcription factor Os03g50310 gene by the downstream of Gateway system constructing to 4 transcription factor activation motif VP16, rice transformation, thus the proterties of improvement transgenic paddy rice output.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310296096.6A CN104292336A (en) | 2013-07-15 | 2013-07-15 | Application of Oryza sativa transcription factor Os03g50310 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310296096.6A CN104292336A (en) | 2013-07-15 | 2013-07-15 | Application of Oryza sativa transcription factor Os03g50310 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104292336A true CN104292336A (en) | 2015-01-21 |
Family
ID=52312311
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310296096.6A Pending CN104292336A (en) | 2013-07-15 | 2013-07-15 | Application of Oryza sativa transcription factor Os03g50310 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104292336A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105524154A (en) * | 2016-01-14 | 2016-04-27 | 华南农业大学 | Application of rice blast resistance related gene OsCOL9 |
| CN112143737A (en) * | 2020-09-21 | 2020-12-29 | 盐城工学院 | Application of OsbZIP62-VP64 fusion expression in improvement of rice agronomic traits |
-
2013
- 2013-07-15 CN CN201310296096.6A patent/CN104292336A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| EBI: "UniProtKB-Q53RJ0(Q53RJ0_ORYSJ), CCT motif family protein,expressed", 《EBI》 * |
| N D GONZALEZ-SCHAIN AND P SUAREZ-LOPEZ: "CONSTANS delays flowering and affects tuber yield in potato", 《BIOLOGIA PLANTARUM》 * |
| 付建新等: "高等植物CO基因研究进展", 《分子植物育种》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105524154A (en) * | 2016-01-14 | 2016-04-27 | 华南农业大学 | Application of rice blast resistance related gene OsCOL9 |
| CN105524154B (en) * | 2016-01-14 | 2019-07-09 | 华南农业大学 | The application of rice blast resistance related gene OsCOL9 |
| CN112143737A (en) * | 2020-09-21 | 2020-12-29 | 盐城工学院 | Application of OsbZIP62-VP64 fusion expression in improvement of rice agronomic traits |
| CN112143737B (en) * | 2020-09-21 | 2023-04-25 | 苏州健雄职业技术学院 | Application of OsbZIP62-VP64 fusion expression in improving agronomic traits of rice |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102816243B (en) | Application of rice transcription factor Os06g08400 genes | |
| CN103820480B (en) | The application of a kind of rice transcription factor in improvement rice high yield proterties | |
| CN104418955A (en) | Application of CDS sequence of rice transcription factor Os06g47150 gene | |
| CN103421119B (en) | Application of rice transcription factor Os05g41450 genes | |
| CN104292336A (en) | Application of Oryza sativa transcription factor Os03g50310 gene | |
| CN104341525A (en) | Application of CDS (coding sequence) of gene for coding oryza sativa L. transcription factor Os02g47744 | |
| CN103421121B (en) | Application of rice transcription factor Os02g07780 genes | |
| CN104341514A (en) | Application of oryza sativa transcription factor Os03g05590.1 gene CDS sequence | |
| CN102321633B (en) | Pleiotropic gene for controlling vegetative growth and development of floral organs of rice and application thereof | |
| CN109112157B (en) | Silencer CNV-18bp of rice panicle development gene and application thereof in rice yield improvement | |
| CN103408670B (en) | Application of rice transcription factor Os05g09480 gene | |
| CN104341513A (en) | Application of rice transcription factor Os05g10670.1 gene CDS (Coding Sequence) | |
| CN104371023A (en) | Application of CDS sequence of paddy rice transcription factor Os01g36630 gene | |
| CN103421120B (en) | Application of rice transcription factor Os11g02540 genes | |
| CN104341527B (en) | The application of rice transcription factor Os03g12350 gene C DS sequences | |
| CN104341521A (en) | Application of rice transcription factor Os09g11480.2 gene CDS (Coding Sequence) | |
| CN104418954A (en) | Application of CDS sequence of rice transcription factor Os06g07010 gene | |
| CN104341520A (en) | Application of oryza sativa transcription factor Os01g09550.1 gene CDS sequence | |
| CN104341522A (en) | Application of oryza sativa transcription factor Os05g27980 gene CDS sequence | |
| CN104341512A (en) | Application of oryza sativa transcription factor Os05g32270.1 gene CDS sequence | |
| CN104341509A (en) | Application of oryza sativa transcription factor Os11g35030.1 gene sequence | |
| CN104211812A (en) | Application of rice transcription factor Os02g49370 gene | |
| CN104341508A (en) | Application of rice transcription factor Os11g31340.1 gene CDS (Coding Sequence) | |
| CN104341517A (en) | Application of rice transcription factor Os09g14040 gene CDS (Coding Sequence) | |
| CN104418953A (en) | Application of rice transcription factor Os02g19804 gene CDS sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150121 |
|
| RJ01 | Rejection of invention patent application after publication |