CN104278054A - Application of kinase Lats2 in regulation of precursor fat cell proliferation - Google Patents
Application of kinase Lats2 in regulation of precursor fat cell proliferation Download PDFInfo
- Publication number
- CN104278054A CN104278054A CN201310279922.6A CN201310279922A CN104278054A CN 104278054 A CN104278054 A CN 104278054A CN 201310279922 A CN201310279922 A CN 201310279922A CN 104278054 A CN104278054 A CN 104278054A
- Authority
- CN
- China
- Prior art keywords
- lats2
- cell
- vitro
- preadipocyte
- ebnxn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to application of kinase Lats2 and Hippo signal pathway in regulation of animal precursor fat cell proliferation. The application refers to overexpression of the kinase Lats2 and activation of the Hippo signal pathway so as to inhibit animal precursor fat cell proliferation. The invention firstly reveals the regulatory effect of the Lats2 and Hippo signal pathway on animal fat development, especially the regulation effect on precursor fat cell proliferation. The invention can be applied to reduction of animal fat deposition and enhancement of the lean meat rate, and also provides new candidate gene and signal pathway to genetic breeding, meat quality improvement and the like of animal husbandry.
Description
Technical field
The present invention relates to molecular biology, cytobiology and cell signalling field, specifically, relate to kinases Lats2 and the application of Hippo signal path in regulation and control Preadipocyte In Vitro propagation.
Background technology
In vivo, fatty tissue is mainly distributed in around subcutaneous and organ, is called subcutaneous lipids pad and encloses organ fat's pad, and these fat pads have important effect for maintenance animal heat balance and armour.In organism system, fatty tissue plays very important effect, its Main Function is the energy balance maintaining body, excess energy is stored with the form of triglyceride level, when energy expenditure is greater than Energy intaking, mobilize fat that energy is discharged continuation metabolism production capacity with the form of free fatty acids and glycerine.In addition, subcutaneous lipids can keep animal heat, also has shock absorption to mechanical collision.Because fatty tissue has important effect for body, therefore the research of adipose tissue development regulatory mechanism is also seemed particularly important.
First Hippo signal path finds in fruit bat, in Mammals, also there is such path, high conservative between species.Hippo signal path controls the size of organ, be the reaction of a kind of kinase cascade, some, the factor having grown down regulation be made up of, finally cause the phosphorylation and inactivation of transcribing secondary navigable span, thus regulate and control the expression of some target genes, antiproliferative effect and control organ size.
Lats2 belongs to the kinase whose AGC family of Ser/Thr, and C-holds kinase domain high conservative.Lats2, as the core kinases of in Hippo signal path, by interacting with transcriptional co-factor YAP and TAZ in downstream thus regulating and controlling the expression of target gene, plays regulating and controlling effect to the proliferation and apoptosis of cell.
Hippo signal path and kinases Lats2 participate in the developmental regulation of Various Tissues and organ, but but do not have clear and definite report for the developmental regulation of fatty tissue.
Summary of the invention
For the problems referred to above, the object of this invention is to provide kinases Lats2 and Hippo signal path at the developmental novelty teabag of control animal tallow.
The invention provides the application of kinases Lats2 in regulation and control animal tallow cell proliferation, described in be applied as process LAN kinases Lats2, activate Hippo signal path, thus suppress animal tallow cell proliferation.
Preferably, described adipocyte is Preadipocyte In Vitro.
Described animal is Mammals.Preferably, described animal is mouse, ox or sheep.
Present invention also offers the preparation method of the mouse Preadipocyte In Vitro of a kind of process LAN kinases Lats2, described method comprises the steps:
(1) extract mouse brain and organize RNA, reverse transcription becomes cDNA, take cDNA as template, carrying out pcr amplification, obtaining Lats2 gene with primers F 1 and R1 for guiding; Primers F 1:AGATCTATGAGGCCAAAGACTTTTCC(SEQ ID No.1); Primer R1:CTCGAGTTACACGTACACCGGCTGGC(SEQ ID No.2);
(2) by Lats2 gene clone to expression vector pPB-CAG-EBNXN, obtain recombinant expression vector pPB-CAG-EBNXN-Lats2;
(3) by recombinant expression vector pPB-CAG-EBNXN-Lats2 transfected Preadipocyte In Vitro, drug screening obtains the cell of stable integration Lats2, namely obtains the mouse Preadipocyte In Vitro of process LAN kinases Lats2.
In step (1), reverse transcription becomes the method for cDNA to be M-MLV ThermoScript II reverse transcription method.
In step (1), pcr amplification the primer is F1 and R1, and the reaction system of pcr amplification is 50 microlitre KOD high-fidelity enzyme PCR amplification system:
The response procedures of pcr amplification is:
In step (2), PCR primer in step (1) and expression vector pPB-CAG-EBNXN are carried out BglII and XhoI double digestion by the preparation method of recombinant expression vector pPB-CAG-EBNXN-Lats2 respectively, PCR primer object fragment and the digestion products of expression vector pPB-CAG-EBNXN skeleton reclaim respectively and to be connected with T4 DNA ligase afterwards, obtain recombinant expression vector pPB-CAG-EBNXN-Lats2.
In step (3), described drug screening is tetracycline drug screening, can adopt this area ordinary method.
In step (3), the method for transfection is this area ordinary method.
Present invention also offers kinases Lats2 in minimizing animal tallow deposition, improve the application in lean ratio.
Present invention also offers the application of kinases Lats2 in animal optimization genetic breeding.
In addition, the present invention yet forms both the method that a set of research Lats2 regulates and controls Preadipocyte In Vitro propagation:
1, build Lats2 carrier for expression of eukaryon and obtain the Preadipocyte In Vitro system of high level expression Lats2
Extract mouse brain and organize RNA, carry out with high-fidelity enzyme the CDS district that pcr amplification obtains Lats2 after reverse transcription becomes cDNA, be connected on expression vector pPB-CAG-EBNXN, obtain recombinant expression vector.Recombinant expression vector transfection Preadipocyte In Vitro is screened the cell of stable integration Lats2, obtain the Preadipocyte In Vitro of process LAN Lats2.
With the expression level of the activity form p-Lats2 of Western blot examination Lats2 and Lats2.
2, in Preadipocyte In Vitro, Lats2 improves phosphorylation level and the cytoplasmatic accumulation of YAP and TAZ
With Western blot examination in Preadipocyte In Vitro after process LAN Lats2, the expression level of p-YAP and p-TAZ, and the anchor station observing YAP and TAZ after Lats2 process LAN by immunofluorescence.
3, in Preadipocyte In Vitro, Lats2 reduces the expression level of Hippo signal path target gene
With Western blot examination expression level of Hippo signal path target gene after Lats2 process LAN in Preadipocyte In Vitro.
4, Lats2 suppresses the propagation of Preadipocyte In Vitro
Lats2 is studied on Preadipocyte In Vitro propagation and the impact of cell cycle from the experiment of following three aspects.The experiment of this three aspect comprises: MTS cell proliferation experiment, BrdU cell proliferation experiment and PI dyeing-Flow cytometry.
(1) MTS cell proliferation experiment
Detect the speed of growth of Preadipocyte In Vitro within 72 hours.MTS be a kind of can by the compound of viable cell institute metabolism, the product of generation has color, can be detected by microplate reader, as the indication molecule that high cell growth speed is slow.
(2) BrdU cell proliferation experiment
Detect the proliferative conditions of Preadipocyte In Vitro within 72 hours.BrdU can be incorporated in DNA double chain in the S phase as base surrogate, utilizes antibody to detect the content of BrdU in cell chromosome by ELISA experiment, as the indication molecule of DNA resultant quantity and cell proliferation rate.
In order to observe the difference of cell proliferation more intuitively, resisting with fluorescently-labeled two and Immunofluorescence test is done to the BrdU introduced in cell, the content of the BrdU introduced in cell is detected.
(3) the PI staining examine cell cycle
PI intercalation of DNA double-strand can send red fluorescence, therefore can with the incorporation of Flow cytometry PI thus the ratio divided shared by each cell cycle.Cell cycle comprises interval and division stage, the pre-synthesis phase that interval, being divided into again DNA (G1 phase), and DNA synthesis phase (S phase) and DNA post-synthesis phase (G2 phase).It is main in the present invention that what detect is the interval of cell cycle.
The invention provides the application of kinases Lats2 in the cell proliferation of regulation and control animal tallow, disclose the regulating and controlling effect that Lats2 and Hippo signal path is grown for animal tallow first, especially regulate and control the effect of Preadipocyte In Vitro propagation.The present invention can be applicable to reduce animal tallow deposition, improves lean ratio; Also can be the genetic breeding of livestock industry, improve meat etc. new candidate gene and signal path are provided.
Accompanying drawing explanation
Fig. 1 is the expression level detecting Lats2 in Preadipocyte In Vitro with Western blot, and wherein, Tubulin is internal reference.
Fig. 2 is the phosphorylation level analysis chart that Lats2 improves YAP and TAZ in Preadipocyte In Vitro, and wherein Tubulin is internal reference.
Fig. 3 is the cellular localization of YAP and TAZ after Immunofluorescence test Lats2 process LAN, and wherein, scale represents 20 μm.
Fig. 4 is the change of Hippo signal path target gene in mRNA level in-site after quantitative PCR detection Lats2 process LAN, and wherein, legend is from left to right followed successively by the cell of process LAN Lats2, Vector control cells and blank cell.
Fig. 5 is that after Western blotting detection Lats2 process LAN, Hippo signal path target gene is in the change of protein level, and wherein, Tubulin is internal reference.
Fig. 6 is that MTS cell proliferation experiment detects Lats2 to the impact of the Preadipocyte In Vitro speed of growth.
Fig. 7 is the impact that BrdU cell proliferation experiment (ELISA) detects Lats2 and breeds Preadipocyte In Vitro.
Fig. 8 is that BrdU cell proliferation experiment (immunofluorescence) detects cell DNA resultant quantity, and scale represents 20 μm.
Fig. 9 be PI staining examine Lats2 on the impact of the cell cycle progression of Preadipocyte In Vitro, wherein, legend is from left to right followed successively by the cell of process LAN Lats2, Vector control cells and blank cell.
Wherein, in Fig. 4,6,7,9, calculate P value with T inspection, P<0.05 is significant difference, and P<0.01 is that difference is extremely remarkable.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.Without departing from the spirit and substance of the case in the present invention, the amendment do the inventive method, step or condition or replacement, all belong to scope of the present invention.
If do not specialize, experiment material used in the embodiment of the present invention, reagent and instrument etc. are all commercially available, if specifically do not indicate, and the conventional means that technique means used in embodiment is well known to the skilled person.
Testing cell used in following examples is mouse Preadipocyte In Vitro system 3T3L1, purchased from American Type culture center (ATCC).
C57 mouse is purchased from Beijing Vital River Experimental Animals Technology Co., Ltd..
Expression vector pPB-CAG-EBNXN is obtained (see Kosuke Yusa etc. by Wellcome Trust Sanger Institute; Generation of transgene-free induced pluripotent mouse stem cells by the piggyBac transposon, Nat Methods.2009May; 6 (5): 363-369.).
Total protein extraction test kit is purchased from green skies biotechnology research institute.
BCA determination of protein concentration test kit is purchased from green skies biotechnology research institute.
RNA extracts test kit purchased from QIAGEN company, and Reverse Transcription box is purchased from Promega company.
PCR kit for fluorescence quantitative is purchased from Roche company.
MTS cell proliferation immue quantitative detection reagent box is purchased from Promega company.
Brdu cell proliferation detecting kit is purchased from Cell Signaling company.
PI staining fluid is purchased from green skies biotechnology research institute.
The preparation of the structure of embodiment 1 carrier for expression of eukaryon and the mouse Preadipocyte In Vitro of process LAN Lats2
(1) in mouse brain tissue, Lats2 expression amount is higher, from the cerebral tissue of C57 mouse, therefore obtain the CDS district of Lats2 gene.First dissect C57 mouse, be separated and obtain cerebral tissue sample, extract C57 mouse brain and organize RNA.After successful for extraction RNA is measured concentration, reverse transcription becomes cDNA(reverse transcription to become the method for cDNA to be M-MLV ThermoScript II reverse transcription method), take cDNA as template, with primers F 1 and primer R1 for guiding, carrying out pcr amplification with KOD high-fidelity enzyme, obtaining the CDS district of Lats2 gene.
Wherein, primers F 1:AGATCTATGAGGCCAAAGACTTTTCC(SEQ ID No.1);
Primer R1:CTCGAGTTACACGTACACCGGCTGGC(SEQ ID No.2).
Pcr amplification the primer is F1 and R1, and the reaction system of pcr amplification is 50 microlitre KOD high-fidelity enzyme PCR amplification system, as shown in table 1:
Table 1
Response procedures is:
(2) PCR primer is run after glue purification reclaims and measure concentration, PCR reclaims product and expression vector pPB-CAG-EBNXN carries out BglII and XhoI double digestion respectively, object fragment and the digestion products of carrier framework reclaim respectively and to be connected with T4 DNA ligase afterwards, obtain recombinant expression vector pPB-CAG-EBNXN-Lats2.
(3) the recombinant expression vector pPB-CAG-EBNXN-Lats2 transfected Preadipocyte In Vitro system 3T3L1 will obtained, through strict tetracycline drug screening, namely obtains the mouse Preadipocyte In Vitro of process LAN Lats2.
Simultaneously by carrier pPB-CAG-EBNXN transfected Preadipocyte In Vitro system 3T3L1, obtain Vector control cells; And using the mouse Preadipocyte In Vitro system 3T3L1 without any carrier transfection as blank cell.
Embodiment 2 Western Blot detects
From the cell of process LAN Lats2, Vector control cells and blank cell, extract total protein be Western blotting, make with Tubulin the expression level that internal reference analyzes Lats2.
Total protein extraction test kit is utilized to prepare total protein of cell.Utilize the concentration of determination of protein concentration kit measurement total protein of cell, then carry out SDS-PAGE electrophoresis, utilize electric transferring film instrument by protein delivery on pvdf membrane, respectively with the antibody hybridization of various target protein, Tubulin is as the internal reference of total protein.Primary antibodie is according to the dilution proportion of 1:1000, and two resist the dilution proportion according to 1:20000.
Specific experiment step is as follows:
1, protein electrophorese (SDS-PAGE)
(1) preparation work: cleaned by sheet glass with deionized water, dries, and glue support fixes.
(2) separation gel is prepared: the separation gel (in detail see " Molecular Cloning: A Laboratory guide ") preparing different concns according to target protein molecular size range difference.Join carefully in sheet glass interlayer after the separation gel prepared is mixed, avoid producing bubble, add to when to be about 2cm from top and close with deionized water, after about 30min, between water layer and glue-line, there will be obvious separation surface, show that separation gel solidifies.
(3) the concentrated glue of preparation: discard water layer, the deionized water that exhaustion is remaining, join after the concentrated glue mixing prepared carefully in sheet glass interlayer, avoid producing bubble, plug comb, after about 30min, concentrated gelling is solid.
(4) sample preparation: add appropriate 5 × SDS sample-loading buffer in protein sample, 100 DEG C are boiled 5min.
(5) loading: be fixed to by offset plate on electrophoresis apparatus, add 1 × electrophoretic buffer, extract comb carefully, joins protein sample in glue hole.
(6) electrophoresis: open electrophoresis apparatus switch, arranging voltage is 60V, enters regulating voltage after separation gel, to 90V, time bottom tetrabromophenol sulfonphthalein electrophoresis to offset plate, stop electrophoresis, prepare transferring film until sample.
2, protein transferring film (PVDF)
(1) preparation work: preparation 1 × transfering buffering liquid, is positioned over 4 DEG C of precoolings.Ice chest is positioned over-70 DEG C of precoolings.
(2) film process: according to size cutting pvdf membrane and the filter paper of separation gel.Pvdf membrane soaks 10sec in methyl alcohol, soaks 5min in deionized water, then is placed in transfering buffering liquid and soaks 10min.Filter paper and sponge are also placed in transfering buffering liquid and soak.
(3) transferring film " sandwich " is prepared: standby according to the sequential system of " 3 metafiltration paper-separation gel-pvdf membrane-3 metafiltration paper ", drive bubble away with glass stick and (note necessarily can not having bubble between glue and film, otherwise affect transferring film effect), two-layerly up and down all place Sponge cushion, step up clip.
(4) transferring film: put into the ice chest frozen in advance in transferring film groove, pour 1 × transfering buffering liquid into, put into clip, in 4 DEG C with 350mA current stabilization transferring film 30 to 120min(according to the time of protein size determination transferring film, protein is larger, and the transferring film time is longer).
3, antibody incubation
(1) close: after transferring film terminates, take out pvdf membrane and put into plastic caddy, add appropriate confining liquid, be placed on horizontal shaker, room temperature is closed 1h or 4 DEG C and is spent the night closed.
(2) primary antibodie is hatched: according to certain dilution proportion primary antibodie (according to the dilution proportion of 1:1000, available confining liquid makes diluent to primary antibodie), discard confining liquid, add primary antibodie diluent, incubated at room 1h or 4 DEG C night incubation.
(3) wash film: wash unconjugated primary antibodie off, on horizontal shaker, wash film 3 times with TBST, each 10min.
(4) two anti-hatch: according to certain ratio confining liquid dilution two anti-(general 1:10000-1:20000), incubated at room 1h.
(5) film is washed: wash unnecessary two off and resist, on horizontal shaker, wash film 3 times with TBST, each 10min.
4, develop
(1) nitrite ion is prepared: by ECL developer A and the mixing of B equal-volume in plastic caddy.
(2) compressing tablet: in darkroom, puts into nitrite ion by film and infiltrates 1-2min, then put into valve bag, drive bubble away, put into magazine, is placed by X-ray film on film, and compressing tablet 5sec to 5min(is according to the time length of bright dark intensity determination compressing tablet of fluorescence).
(3) development and fixing: the film of exposure is put into developing solution immediately, rocks back and forth, put into water and rock and wash developing solution off after band displays, it is fixing that horse back is placed in stop bath.
(4) interpretation of result is carried out after the film reserving shadow dries.
As shown in Figure 1, the cell of Western blot result display process LAN Lats2, Lats2 presents high-caliber expression, and the activity form p-Lats2 of Lats2 also presents high level expression.
Fig. 2 is the protein level of p-YAP and p-TAZ after Western blotting analysis Lats2 process LAN, makes internal reference with Tubulin.As shown in Figure 2, in Preadipocyte In Vitro, process LAN Lats2 makes the expression level of p-YAP and p-TAZ rise.
Embodiment 3 immunofluorescent staining
After fixing the cell of process LAN Lats2, Vector control cells and blank cell with paraformaldehyde, punch to cytolemma with Triton, hatch by the primary antibodie for various target protein after closing, resist with corresponding two after washing primary antibodie off and hatch, with DAPI to nuclear targeting, can examine under a microscope after PBS washes 3 times.Fluorescently-labeled two is anti-purchased from Santa Cruz company.
Specific experiment step is as follows:
(1) fixing: sop up cell culture medium, wash one time with PBS, add 4% paraformaldehyde of 4 DEG C of precoolings, room temperature fixes 15min.
(2) permeate: sop up paraformaldehyde stationary liquid, wash 3 times with PBS, each 5min.Add 0.3%Triton X-100 penetrating fluid, room temperature infiltration 10min.
(3) close: sop up Triton penetrating fluid, wash 3 times with PBS, each 5min.Add 2%BSA confining liquid, room temperature closes 30min.
(4) primary antibodie is hatched: according to certain dilution proportion primary antibodie (general 1:100-1:500).Sop up confining liquid, add primary antibodie diluent, incubated at room 1h.
(5) two anti-hatch: according to certain dilution proportion two anti-(general 1:100-1:500).Sop up primary antibodie diluent, wash 3 times with PBS, each 5min.Add two anti-diluents, incubated at room 30min.From this step, want lucifuge to operate.
(6) nuclear targeting: according to certain proportions DAPI working fluid (calculating Dilution ratio according to original liquid concentration).Sop up two anti-diluents, add DAPI diluent, room temperature dyeing 5min.
(7) observations: sop up DAPI diluent, washes 3 times with PBS, each 5min.Coloration result is observed under fluorescence inverted microscope.
Fig. 3 is the cellular localization of YAP and TAZ after Immunofluorescence test Lats2 process LAN, YAP and TAZ uses two of green fluorescent label anti-detections respectively, and nucleus DAPI dyes.Scale represents 20 μm.As shown in Figure 3, immunofluorescence results shows that process LAN Lats2 makes YAP and TAZ be anchored at tenuigenin.
Embodiment 4 fluorescence real-time quantitative PCR
Utilize RNA to extract total serum IgE that test kit extracts the cell of process LAN Lats2, Vector control cells and blank cell respectively, utilizes M-MLV ThermoScript II to synthesize cDNA.Become 20 μ l reaction systems with quantification PCR primer with SYBR Green mix preparation of reagents, utilize Roche quantitative real time PCR Instrument to detect the mRNA level in-site of various goal gene.
Specific experiment step is as follows:
(1) reaction system (20 μ l) of fluorescence real-time quantitative PCR is as shown in table 2:
Table 2
Wherein, in table 2 each gene to carry out fluorescence real-time quantitative PCR the primer as follows:
CyclinE: primers F 2:TGTTACAGATGGCGCTTGCTC(SEQ ID No.3);
Primer R2:TTCAGCCAGGACACAATGGTC(SEQ ID No.4);
CTGF: primers F 3:GGGCCTCTTCTGCGATTTC(SEQ ID No.5);
Primer R3:ATCCAGGCAAGTGCATTGGTA(SEQ ID No.6)
Survivin: primers F 4:GAGGCTGGCTTCATCCACTG(SEQ ID No.7);
Primer R4:CTTTTTGCTTGTTGTTGGTCTCC(SEQ ID No.8).
(2) reaction conditions:
(3) statistical method: often kind of process is done three biology and repeated and three technology repetitions.By 2-Δ Δ Ct method statistic analysis of fluorescence quantitative PCR result, and calculate standard deviation and the significance of difference, P<0.05 represents significant difference, and P<0.01 represents that difference is extremely remarkable.
Carry out three times independently to test, each experiment is done three technology and is repeated, and data represent with " mean value+standard deviation ".Fig. 4 is Hippo signal path target gene (cyclinE, survivin, CTGF) change in mRNA level in-site after quantitative PCR detection Lats2 process LAN.As shown in Figure 4, in Preadipocyte In Vitro, process LAN Lats2 makes the expression level of Hippo signal path target gene (cyclinE, survivin, CTGF) decline.
Fig. 5 is that after Western blotting detects Lats2 process LAN, Hippo signal path target gene (cyclinE, survivin, CTGF), in the change of protein level, makes internal reference with Tubulin.As shown in Figure 5, Western blot result shows that process LAN Lats2 makes the expression level of Hippo signal path target gene (cyclinE, survivin, CTGF) decline in Preadipocyte In Vitro.
From Fig. 4 and Fig. 5, in Preadipocyte In Vitro, process LAN Lats2 can reduce the expression level of Hippo signal path target gene.
Embodiment 5 MTS cell proliferation detects
MTS is a kind of tetrazotized zole compound (tetrazolium), can by the metabolism of cell institute, by biological reducing effect Sheng Cheng formazan (formazan) of cell, this product has color, and be solubility in cell culture medium, therefore can weigh how many MTS by the detection of absorption values and be reduced into formazan by cell, and the size of absorbance is proportional with the quantity of viable cell, that is, the cell grown is more, then absorbance is larger.With the cell of process LAN Lats2, Vector control cells and blank cell for object is tested, specific experiment step is as follows:
Preparation work:
(1), after cell counting, according to the speed of growth and the characteristic of cell, cultivate in appropriate passage to 96 well culture plate.Notice that the cell concentration put in every hole will be consistent.
(2) take out frozen MTS reagent, be melted up to room temperature completely, thaw process probably needs 90min, or melts 10min 37 C water bath.Notice that MTS reagent is put immediately to room temperature after melting.
(3) prepare MTS Incubating Solution, according to the proportions adding 20 μ l MTS reagent in 100 μ l cell culture mediums, after mixing, room temperature is placed stand-by.
Step:
(1) MTS is hatched: inhale and abandon archeocyte substratum, every hole adds the freshly prepared MTS Incubating Solution of 120 μ l, puts back to cell culture incubator, hatches 1-4h for 37 DEG C.Notice that the volume of the MTS Incubating Solution that every hole adds will be consistent.
(2) absorbance detection: detect immediately after hatching, or after often hole adds 25 μ l10%SDS solution termination reactions, lucifuge room temperature is placed, in 18h, complete detection.Detect at 490nm wavelength place by microplate reader, record absorption values.
(3) interpretation of result and drawing.
Within every 24 hours, detect once with MTS reagent, detect the speed of growth of Preadipocyte In Vitro within 72 hours.MTS be a kind of can by the compound of viable cell institute metabolism, the product of generation has color, can be detected by microplate reader, as the indication molecule that high cell growth speed is slow.
As shown in Figure 6, process LAN Lats2 can suppress the growth of Preadipocyte In Vitro, and in 48 hours, Lats2 can suppress the growth of Preadipocyte In Vitro significantly.
Embodiment 6 BrdU cell proliferation detects
BrdU, 5-bromodeoxyuridine nucleosides, it is a kind of thymidine analog, it can synthesize period (S phase) as base surrogate and is incorporated in DNA double chain at DNA, therefore, the antibody of available BrdU and two of the mark anti-content removing to detect BrdU in the cell of breeding, thus reflect the DNA amount of new synthesis in proliferative cell number and the speed of cell proliferation rate.With the cell of process LAN Lats2, Vector control cells and blank cell for object is tested, specific experiment step is as follows:
Preparation work:
(1), after cell counting, according to the speed of growth and the characteristic of cell, cultivate in appropriate passage to 96 well culture plate.Notice that the cell concentration put in every hole will be consistent.
(2) washing lotion is prepared: 20 × Wash Buffer ultrapure water is diluted to 1 × Wash Buffer.
(3) primary antibodie and two anti-diluents are prepared: respectively 100 × BrdU antibody and 100 × HRP are marked two and be anti-ly diluted to 1 × antibody working fluid respectively.
(4) BrdU Incubating Solution is prepared: by 1000 × BrdU stoste cell culture medium to 1 × BrdU Incubating Solution.
Step:
(1) BrdU is hatched: inhale and abandon archeocyte substratum, every hole adds the freshly prepared BrdU Incubating Solution of 110 μ l, puts back to cell culture incubator, hatches 1-24h for 37 DEG C.Notice that the volume of the BrdU Incubating Solution that every hole adds will be consistent.
(2) fixing and sex change: inhale and abandon BrdU Incubating Solution, every hole adds 100 μ l and fixes/sex change liquid, and room temperature is fixed and sex change 30min.
(3) antibody incubation: inhale and abandon fixing/sex change liquid, every hole adds 100 μ l primary antibodie diluents, incubated at room 1h.Primary antibodie is abandoned in suction, washes 3 times with Wash Buffer.Attention will as far as possible residual unconjugated primary antibodie wash clean.Every hole adds the anti-diluent of 100 μ l bis-, incubated at room 30min.Suction is abandoned two and is resisted, and washes 3 times with Wash Buffer.Attention will as far as possible residual unconjugated two anti-wash cleans.
(4) develop the color: every hole adds 100 μ l tmb substrates, incubated at room 30min.Observe colour-change.
(5) absorbance detection: after colour developing, every hole adds 100 μ l stop buffers with termination reaction, immediately (preferably in 30min) detect at 450nm wavelength place with microplate reader, record absorption values.
(6) interpretation of result and drawing.
Every 24 hours with BrdU agent treated once, with the content of antibody test BrdU in cell, detect the proliferative conditions of Preadipocyte In Vitro within 72 hours.BrdU can be incorporated in DNA double chain in the S phase as base surrogate, utilizes antibody to detect the content of BrdU in cell chromosome by ELISA experiment, as the indication molecule of DNA resultant quantity and cell proliferation rate.
Fig. 7 is the impact that BrdU cell proliferation experiment (ELISA) detects Lats2 and breeds Preadipocyte In Vitro, and as shown in Figure 7, process LAN Lats2 can suppress the propagation of Preadipocyte In Vitro.
In order to observe the difference of cell proliferation more intuitively, resisting with fluorescently-labeled two and Immunofluorescence test is done to the BrdU introduced in cell.As shown in Figure 7, differing greatly of 48 hr-control cells and Lats2 overexpressing cell, therefore choose the content of 48 hours these time points to the BrdU introduced in cell and detect.
Fig. 8 is Immunofluorescence test cell DNA resultant quantity.BrdU is directly proportional to cell DNA resultant quantity by the amount that cell is introduced, the number of the cell DNA resultant quantity that therefore be can visually see by Immunofluorescence test BrdU.With two anti-detection BrdU of green fluorescent label, nucleus DAPI dyes, and scale represents 20 μm.As shown in Figure 8, process LAN Lats2 can suppress the DNA of Preadipocyte In Vitro to synthesize.
The embodiment 7 PI staining examine cell cycle
PI, propidium iodide, the analogue of Ethidum Eremide is a kind of fluorescence dye, can discharge red fluorescence after intercalation of DNA double-strand.Therefore can by the ratio shared by Flow cytometry each cell cycle after PI dyeing.Cell cycle comprises interval and division stage, the pre-synthesis phase that interval, being divided into again DNA (G1 phase), and DNA synthesis phase (S phase) and DNA post-synthesis phase (G2 phase).What carry out in the G1 phase is the preparation work of DNA replication dna, and the G1 phase mainly carries out RNA and ribosomal synthesis; The S phase mainly carries out the DNA synthesis enlivened, and histone and the enzyme required for DNA synthesis also synthesize in the S phase in addition; The G2 phase is that mitotic division is prepared, and synthesizes RNA and protein in a large number at this first phase.It is main in this experiment that what detect is the interval of cell cycle.
Specific experiment step is as follows:
Preparation work:
(1), after cell counting, according to the speed of growth and the characteristic of cell, appropriate passage is cultivated to 10cm culture dish.Notice that the cell concentration put in each ware will be consistent.According to the speed of growth and the experimental design of dissimilar cell, cultivate in 24-72h and all can detect.
(2) 70% ethanol stationary liquid and PI staining fluid is prepared, in 4 DEG C of precoolings.
Step:
(1) collecting cell: trypsin digestion cell, after stopping digestion, 4 DEG C, the centrifugal 5min collecting cell of 1000rpm, abandons supernatant, washes cell precipitation 2 times with the PBS of precooling.
(2) ethanol is fixed: the 70% ethanol stationary liquid adding 1ml precooling in each sample, fixedly spends the night in 4 DEG C, or fixing for a long time in-20 DEG C.Note, if fix at 4 DEG C, within best second day, just detecting; If fix at-20 DEG C, also preferably in one week, just complete detection, otherwise impact effect.
(3) cell dyeing: 4 DEG C, the centrifugal 5min collecting cell of 1000rpm, abandons supernatant, washes cell 1 time with PBS.Add 500 μ l PI staining fluids in each sample, 4 DEG C of lucifuges hatch 30min.
(4) flow cytometer showed: setting PI staining examine program, generally counts 2 × 10
4individual cell.Record data.
(5) interpretation of result and drawing.
As shown in Figure 9, process LAN Lats2 can suppress the cell cycle progression of Preadipocyte In Vitro.The cell being in the S phase in the cell of process LAN Lats2 is less, the pre-synthesis phase that most cell being in this DNA of G1 phase (these cells may become resting cell or not proliferative cell) and normally can not enter into the S phase and carry out DNA synthesis, cell cycle progression is suppressed, and DNA synthesis is inactive in cell, further confirmation Lats2 suppresses propagation and the DNA synthesis of Preadipocyte In Vitro, and the suppression of Lats2 cell cycle mainly occurs in this artis of G1/S phase.
Although above with general explanation, embodiment and test, the present invention is described in detail, and on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.
Claims (10)
1. the application of kinases Lats2 in the cell proliferation of regulation and control animal tallow.
2. application according to claim 1, is characterized in that, described in be applied as process LAN kinases Lats2, activate Hippo signal path, suppress animal tallow cell proliferation.
3. application according to claim 1 and 2, is characterized in that, described adipocyte is Preadipocyte In Vitro.
4. application according to claim 1 and 2, is characterized in that, described animal is Mammals; Preferably, described animal is mouse, ox or sheep.
5. a preparation method for the mouse Preadipocyte In Vitro of process LAN kinases Lats2, is characterized in that, described method comprises the steps:
(1) extract mouse brain and organize RNA, reverse transcription becomes cDNA, take cDNA as template, carrying out pcr amplification, obtaining Lats2 gene with primers F 1 and R1 for guiding;
Primers F 1:AGATCTATGAGGCCAAAGACTTTTCC;
Primer R1:CTCGAGTTACACGTACACCGGCTGGC;
(2) by Lats2 gene clone to expression vector pPB-CAG-EBNXN, obtain recombinant expression vector pPB-CAG-EBNXN-Lats2;
(3) by recombinant expression vector pPB-CAG-EBNXN-Lats2 transfected Preadipocyte In Vitro, drug screening obtains the cell of stable integration Lats2, namely obtains the mouse Preadipocyte In Vitro of process LAN kinases Lats2.
6. method according to claim 5, is characterized in that, in step (1), the reaction system of pcr amplification is 50 microlitre KOD high-fidelity enzyme PCR amplification system:
The response procedures of pcr amplification is: 94 DEG C of denaturations 2 minutes; 94 DEG C of sex change 30 seconds, 62 DEG C of annealing 30 seconds, 72 DEG C extend 3 minutes, repeat 30 times; 72 DEG C extend 7 minutes.
7. method according to claim 5, it is characterized in that, in step (2), PCR primer in step (1) and expression vector pPB-CAG-EBNXN are carried out BglII and XhoI double digestion by the preparation method of recombinant expression vector pPB-CAG-EBNXN-Lats2 respectively, PCR primer object fragment and the digestion products of expression vector pPB-CAG-EBNXN skeleton reclaim respectively and to be connected with T4 DNA ligase afterwards, obtain recombinant expression vector pPB-CAG-EBNXN-Lats2.
8. method according to claim 5, is characterized in that, in step (3), described drug screening is tetracycline drug screening.
9. kinases Lats2 is in minimizing animal tallow deposition, improves the application in lean ratio.
10. kinases Lats2 optimizes the application in genetic breeding animal.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310279922.6A CN104278054A (en) | 2013-07-04 | 2013-07-04 | Application of kinase Lats2 in regulation of precursor fat cell proliferation |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310279922.6A CN104278054A (en) | 2013-07-04 | 2013-07-04 | Application of kinase Lats2 in regulation of precursor fat cell proliferation |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104278054A true CN104278054A (en) | 2015-01-14 |
Family
ID=52253397
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310279922.6A Pending CN104278054A (en) | 2013-07-04 | 2013-07-04 | Application of kinase Lats2 in regulation of precursor fat cell proliferation |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104278054A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113943737A (en) * | 2021-09-22 | 2022-01-18 | 东北农业大学 | Application of chicken CTGF gene in inhibiting differentiation of chicken preadipocytes |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009018103A1 (en) * | 2007-07-27 | 2009-02-05 | Vesta Therapeutics, Inc. | Methods of reducing intracellular fats from mammalian cells |
CN102154237A (en) * | 2011-01-04 | 2011-08-17 | 深圳市绿微康生物工程有限公司 | Lipase capable of reducing cholesterol and blood fat levels in bodies of animals and use thereof |
-
2013
- 2013-07-04 CN CN201310279922.6A patent/CN104278054A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009018103A1 (en) * | 2007-07-27 | 2009-02-05 | Vesta Therapeutics, Inc. | Methods of reducing intracellular fats from mammalian cells |
CN102154237A (en) * | 2011-01-04 | 2011-08-17 | 深圳市绿微康生物工程有限公司 | Lipase capable of reducing cholesterol and blood fat levels in bodies of animals and use thereof |
Non-Patent Citations (2)
Title |
---|
QIUYUE LIU ET AL.: "Pig large tumor suppressor 2 (Lats2), a novel gene that may regulate the fat reduction in adipocyte", 《BMB REPORTS》 * |
单安山、徐友奇: "动物脂肪代谢与调控", 《东北农业大学学报》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113943737A (en) * | 2021-09-22 | 2022-01-18 | 东北农业大学 | Application of chicken CTGF gene in inhibiting differentiation of chicken preadipocytes |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Sharma et al. | Secreted protein acidic and rich in cysteine (SPARC) mediates metastatic dormancy of prostate cancer in bone | |
Huang et al. | TGF-β1-activated cancer-associated fibroblasts promote breast cancer invasion, metastasis and epithelial-mesenchymal transition by autophagy or overexpression of FAP-α | |
Shiozawa et al. | GAS6/AXL axis regulates prostate cancer invasion, proliferation, and survival in the bone marrow niche | |
Chiou et al. | Positive correlations of Oct-4 and Nanog in oral cancer stem-like cells and high-grade oral squamous cell carcinoma | |
Xiang et al. | Hippo signaling pathway reveals a spatio-temporal correlation with the size of primordial follicle pool in mice | |
Wang et al. | Secretome of human fetal mesenchymal stem cell ameliorates replicative senescence | |
Zhong et al. | Pyruvate dehydrogenase expression is negatively associated with cell stemness and worse clinical outcome in prostate cancers | |
Park et al. | Adipose-derived stem cells induced EMT-like changes in H358 lung cancer cells | |
Sun et al. | Loss of TMEM126A promotes extracellular matrix remodeling, epithelial-to-mesenchymal transition, and breast cancer metastasis by regulating mitochondrial retrograde signaling | |
Ueno et al. | Chloride intracellular channel protein 2 in cancer and non-cancer human tissues: relationship with tight junctions | |
Yuan et al. | Exosomal lncRNA ATB derived from ovarian cancer cells promotes angiogenesis via regulating miR-204-3p/TGFβR2 axis | |
Balvan et al. | Oxidative stress resistance in metastatic prostate cancer: Renewal by self-eating | |
CN105368853A (en) | Marker related to auxiliary diagnosis of non-small cell lung cancer and application thereof | |
Karoubi et al. | Identification of mesenchymal stromal cells in human lung parenchyma capable of differentiating into aquaporin 5-expressing cells | |
Chen et al. | Bovine pre-adipocyte adipogenesis is regulated by bta-miR-150 through mTOR signaling | |
WO2015017784A1 (en) | Tissue engineered models of cancers | |
CN105695463A (en) | Application of PIK3R2 in pig ovarian granular cells | |
Dong et al. | Downregulation of ROR2 promotes dental pulp stem cell senescence by inhibiting STK4‐FOXO1/SMS1 axis in sphingomyelin biosynthesis | |
Zhang et al. | Immortalized Mesenchymal Stem Cells: A Safe Cell Source for Cellular or Cell Membrane‐Based Treatment of Glioma | |
Wu et al. | Expression and significance of c-kit and epithelial-mesenchymal transition (EMT) molecules in thymic epithelial tumors (TETs) | |
CN105582525B (en) | Application of the CIRP in terms of preparing Telomerase bonding agent or telomerase activation adjusting control agent | |
Lu et al. | RETRACTION: Mechanism of MicroRNA-708 Targeting BAMBI in Cell Proliferation, Migration, and Apoptosis in Mice With Melanoma via the Wnt and TGF-β Signaling Pathways | |
CN104278054A (en) | Application of kinase Lats2 in regulation of precursor fat cell proliferation | |
Marzan et al. | Adipocyte derived paracrine mediators of mammary ductal morphogenesis controlled by retinoic acid receptors | |
Kondratyeva et al. | PDX1, a key factor in pancreatic embryogenesis, can exhibit antimetastatic activity in pancreatic ductal adenocarcinoma |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150114 |
|
RJ01 | Rejection of invention patent application after publication |