CN104250656A - IRTKS gene-knocked out mouse model, construction method and application thereof - Google Patents
IRTKS gene-knocked out mouse model, construction method and application thereof Download PDFInfo
- Publication number
- CN104250656A CN104250656A CN201310267704.0A CN201310267704A CN104250656A CN 104250656 A CN104250656 A CN 104250656A CN 201310267704 A CN201310267704 A CN 201310267704A CN 104250656 A CN104250656 A CN 104250656A
- Authority
- CN
- China
- Prior art keywords
- irtks
- mouse
- mouse model
- gene
- construction process
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a construction method for an IRTKS gene-knocked out mouse model. According to the method, homologous recombination is adopted, and a 2.0-kb PGK/Neo sequence is adopted to substitute for the exon1 sequence containing the ATG initiation codon in the mouse IRTKS gene so as to obtain the IRTKS gene-knocked out mouse model. The present invention further discloses the IRTKS gene-knocked out mouse model constructed by using the method, and the application of the model in diabetes research. According to the present invention, results of pathological analysis and detection of carbohydrate, insulin and the like confirmed that the IRTKS gene-knocked out mouse can produce hyperglycemia, hyperinsulinemia, impaired glucose tolerance, decreased insulin sensitivity and the like, and are consistent with the disease characteristics of human so as to provide the good animal model for study on the diabetes pathogenesis and evaluation and screening of the treatment drugs.
Description
Technical field
The present invention relates to the animal model in biological technical field, more particularly, relate to a kind of mouse model of IRTKS gene knockout, its construction process, and the application in diabetes study.
Background technology
Under diabetology branch of Chinese Medical Association tissue, year May in June, 2007 to 2008 has carried out the epidemiology survey of diabetes to 14 provinces and cities in the whole nation, grownup's diabetes prevalence that result shows China more than 20 years old is 9.7%, the male sex is higher than women, and with advancing age, sickness rate increases gradually (20 years old ~ 39 years old, 40 years old ~ 59 years old, the sickness rate being more than or equal to 60 years old crowd is respectively 3.2%, 11.5%, 20.4%), and wherein the sickness rate of city resident is higher than urban residents' (being respectively 11.4% and 8.2%), the hypokinesis come with urbanization is described, unhealthy diet, the generation development of the living-pattern preservation such as obesity to diabetes is an important factor.It should be noted that epidemiological study finds, the incidence of diabetic subject's malignant tumour is in rising trend.Epidemiological study report from Japan and Korea S shows, and the cancer of the stomach incidence of diabetic subject and mortality ratio are apparently higher than ND.
In order to further investigate the pathogenesis of diabetes, relevant animal model is a very reliable research tool.In early days, researchist is by manual-induced experimental animal models with diabetic character of paathogenic factor such as physics, biology, chemistry; Spontaneous heredity diabetes model is not owing to having artificial intervention factor, more can simulating human pathogenesis of diabetes mellitus, its scientific research value being applied to pathogenesis of diabetes mellitus and complication aspect is larger, comparatively common are ob/ob, db/db mouse etc., be respectively the obesity that causes due to the sudden change of leptin gene or leptin gene acceptor with serious insulin resistant, but the limitation of these animal models be it based on transgenation genetic background uncommon in human patients.In recent years, that understands the pathogenesis of diabetes along with researchist gos deep into, and the reaching its maturity of transgenic animal model technology, and applies increase gradually based on the transgenosis of disease-related key signal path or knockout animal model in the research of diabetes.On the other hand, because diabetes are one group of clinical syndromes being interacted by multiple genetic background and environmental factors and caused, although the diabetes animal model of exploitation is at present a lot, still has deviation with human diabetes, there is no the animal model fitted like a glove with human diabetes so far.Based on the New research progress of pathogenesis of diabetes mellitus, exploitation obtain the animal model of better simulating human diabetes remain we explore diabetes, insulin resistant effective tool and study required.
Summary of the invention
One of the technical problem to be solved in the present invention is to provide a kind of construction process of mouse model of IRTKS gene knockout, and it can provide research model for the discussion of the research of diabetes and Molecular pathogenesis.
For solving the problems of the technologies described above, the construction process of the mouse model of IRTKS gene knockout of the present invention, by homologous recombination, replace the exon1 sequence containing ATG initiator codon in mouse IRTKS gene by 2.0-kb PGK/Neo sequence, obtain the mouse model of IRTKS gene knockout.
Preferably, the mouse model of IRTKS gene knockout can be built according to following concrete steps:
1) IRTKS-KO plasmid is built;
2) ES cell targeting screen positive ES and clone;
3) positive ES clone is injected into Mouse Blastocysts, obtains gomphosis mouse;
4) gomphosis mouse and female mice are hybridized, obtain the mouse model of IRTKS gene knockout.
Two of the technical problem to be solved in the present invention is to provide the mouse model of the IRTKS gene knockout utilizing aforesaid method to build.
Three of the technical problem to be solved in the present invention is to provide the application in the research of mouse model at pathogenesis of diabetes mellitus of the IRTKS gene knockout utilizing aforesaid method to build, the evaluation of Diagnosis and Treat and Remedies for diabetes and screening.
The present invention, by the method for homologous recombination, replaces the exon1 sequence containing ATG initiator codon in IRTKS by 2.0-kb PGK/Neo sequence, constructs the mouse model of reliable IRTKS gene knockout.By the detection analysis of the blood sugar, serum insulin, glucose sugar tolerance amount, insulin tolerance etc. of the mouse model to IRTKS gene knockout, find that the mouse of IRTKS gene knockout there will be hyperglycemia, hyperinsulinism, glucose tolerance reduction, insulin sensitivity reduction, conform to the pathogeneticing characteristic of the mankind, thus provide good animal model for the research of pathogenesis of diabetes mellitus and the evaluation of medicine and screening.
Accompanying drawing explanation
Fig. 1 is the structure of embodiment of the present invention 1IRTKS-KO mouse and the first genotype identification for heterozygote.Wherein, (A) is IRTKS-KO mouse target practice plasmid construction schematic diagram, 5L & neoR, 3R & neoF be for the identification of PCR primer design; (B) be the first PCR qualification result for heterozygote.
Fig. 2 is the genotype identification of embodiment of the present invention 2IRTKS-KO mouse and the expression identification of IRTKS.Wherein, (A) be the genotype identification of homozygote (IRTKS-/-), heterozygote (IRTKS+/-) and wild-type mice (WT), below is primer schematic diagram IRTKS-F1/IRTKS-F2, IRTKS-F3/IRTKS-neo-F4 of design, is abbreviated as F1/F2, F3/F4; (B) and (C) be homozygote (IRTKS-/-) respectively, detect RT-PCR result (B figure) and western-blot(immunoblotting that IRTKS expresses in multiple histoorgans (heart, liver, spleen, lung, kidney, prostate gland, testis) of heterozygote (IRTKS+/-) and wild-type mice (WT)) result (C figure).
Fig. 3 is the carbohydrate metabolism detected result figure of the embodiment of the present invention 3 three groups of mouse.(A) Male homozygous (IRTKS-/-), heterozygosis (IRTKS+/-), wild (WT) mouse fasting blood sugar (n=5-8); (B) insulin levels (n=5-8) in Male homozygous (IRTKS-/-), heterozygosis (IRTKS+/-), wild (WT) mice serum; (C) Male homozygous (IRTKS-/-), heterozygosis (IRTKS+/-), wild (WT) mouse glucose tolerance curve (n=5-8); (D) Male homozygous (IRTKS-/-), heterozygosis (IRTKS+/-), wild (WT) mouse islets element tolerance curve (n=5-8).
Fig. 4 is that embodiment of the present invention 4IRTKS expresses reduction in diabetics and mouse.(A) expression (n=10) of IRTKS in diabetes B patient and Normal Human Liver; (B) expression (n=5-6) of IRTKS in the liver of db/db mouse and littermate control mouse, fatty tissue; (C) expression (n=5) of IRTKS in the mouse of high fat diet (HFD) inducing obesity and normal diet (RD) mouse liver, fatty tissue.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, the people such as such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.
The structure of embodiment 1IRTKS-KO mouse
The structure of 1.IRTKS-KO plasmid
See Fig. 1 (A), by 80 μ g IRTKS KO Vector plasmid DNA NotI(enzyme dosage: 100U) enzyme cuts, and enzyme cuts volume 200 μ l, and 37 DEG C of digestion are spent the night; Walk glue separation and purification, glue reclaims test kit QIA quick Gel Extraction Kit (Cat No.28706); Alcohol settling subsequently, the PBS(phosphate buffer soln that 100 μ l are aseptic) resuspended.
2.ES cell targeting and screening
Above-mentioned IRTKS-KO linearization plasmid is used for ES cell targeting.
ES cell (embryonic stem cell): SCR012
DNA measures: 35 μ g
Electroporation model: Bio-Rad Gene Pulser(Cat.No.165-2105)
Electroporation conditions: setting voltage 240V, electric capacity 500 μ F, actual conduction time 10.5ms, virtual voltage 256V
Colony screening condition: 300 μ g/ml G418,2 μMs of GanC screen 8 days
Picking resistance clone totally 96, provides DNA sample 96 parts.
3. the qualification of positive ES clone
Design two pairs of PCR primers designed respectively, see Fig. 1 (A).
5 ' PCR qualification: primers designed 5L and neo-R, object fragment is 5.2K.PCR primer sequence:
Neo-R：CTGAGCCCAGAAAGCGAAGGA（SEQ?ID?No:1）
5L：TCGCCGGCCAGTCTAGTCAAGTCAGG（SEQ?ID?No:2）
PCR reaction system (50 μ l): 5units/ μ l TaKaRa rTaq0.25 μ l, 10 × TaKaRa rTaq damping fluid 5 μ l, dNTP mixing solutions (often kind of concentration 2.5mM) 4 μ l, below DNA profiling 500ng, forward primer and each 0.2-1.0 μM of reverse primer, sterile purified water supplies volume to 50 μ l.
PCR reaction conditions: 95 DEG C 10 minutes; 95 DEG C 10 seconds, 62 DEG C of 1min, 72 DEG C of 5min, totally 35 circulations; 72 DEG C 10 minutes.
3 ' PCR qualification: primers designed 3R and neo-F, object fragment is 3.6K.PCR primer sequence:
Neo-F:CCTCCCCCGTGCCTTCCTTGAC（SEQ?ID?No:3）
3R:CCGAGGGCAAATTCTGGGCACACTAT（SEQ?ID?No:4）
PCR reaction system (50 μ l): 5units/ μ l TaKaRa rTaq0.25 μ l, 10 × TaKaRa rTaq damping fluid 5 μ l, dNTP mixing solutions (often kind of concentration 2.5mM) 4 μ l, below DNA profiling 500ng, forward primer and each 0.2-1.0 μM of reverse primer, sterile purified water supplies volume to 50 μ l.
PCR reaction conditions: 95 DEG C 10 minutes; 95 DEG C 10 seconds, 62 DEG C of 1min, 72 DEG C of 4min, totally 35 circulations; 72 DEG C 10 minutes.
4. blastaea injection
Microinjection blastaea is originated: the superovulation of C57BL/6J mouse, natural conception, is developed to blastocyst stage in body.
The embryonic stem cell positive colony that homologous recombination occurs is injected the blastaea of C57BL/6J mouse, inject 87 pieces of embryos altogether, make 6 acceptors.Be born 3 mouse altogether, and wherein, the chimeric male mice 3 of rate more than 50% is gomphosis mouse.
5. the breeding of gomphosis mouse
The ripe male mice of chimeric rate more than 50% and C57BL/6J female mice are carried out mating, offspring's grey mouse carries out the PCR qualification (qualification that authentication method is cloned with positive ES through extracting coda gene group DNA, qualification result is shown in Fig. 1 (B)), obtain the head of 5 IRTKS gene knockouts altogether for chimeric mice.
The genotype identification of embodiment 2IRTKS-KO mouse and the expression identification of IRTKS
1. isozygoty, the genotype identification of heterozygosis and wild mouse
First, design that the qualification of the two pairs of PCR primers designed is isozygotied, heterozygosis and wild mouse, see Fig. 2 (A).Primer sequence is as follows:
F1：CTGCGGGCTGTTAAAGGTTA（SEQ?ID?No:5）
F2：ACTCAGCGCTTGAGACTTG（SEQ?ID?No:6）
F3：GATCTGCCAAGGAAAGACA（SEQ?ID?No:7）
F4：GGGAACTTCCTGACTAGGG（SEQ?ID?No:8）
PCR reaction system (50 μ l): 5units/ μ l TaKaRa rTaq0.25 μ l, 10 × TaKaRa rTaq damping fluid 5 μ l, dNTP mixing solutions (often kind of concentration 2.5mM) 4 μ l, below DNA profiling 500ng, forward primer and each 0.2-1.0 μM of reverse primer, sterile purified water supplies volume to 50 μ l.
PCR reaction conditions: 95 DEG C 10 minutes; 95 DEG C 10 seconds, 59 DEG C 30 seconds, 72 DEG C 40 seconds, totally 33 circulations; 72 DEG C 5 minutes.
2. the extraction of mouse tissue RNA, reverse transcription and semiquantitive PCR
Mouse cervical dislocation good for genotype identification is put to death, dissects, get each histoorgan (heart, liver, spleen, lung, kidney, prostate gland, testis) quick-frozen move to-70 DEG C of Refrigerator stores in liquid nitrogen.Adopt TRIzol reagent (Invitrogen) reagent to extract and organize RNA, carry out RT-PCR qualification.
The primer that RT-PCR identifies is:
IRTKS-F：TTGGCAGGCTACGTCTACCT（SEQ?ID?No:9）
IRTKS-R：GCGCCTAGGACTTGAGACTG（SEQ?ID?No:10）
Actin-F：AATCGTGCGTGACATTAAGGAG（SEQ?ID?No:11）
Actin-R:ACTGTGTTGGCGTACAGGTCTT（SEQ?ID?No:12）
PCR reaction system (50 μ l): 5units/ μ l TaKaRa rTaq0.25 μ l, 10 × TaKaRa rTaq damping fluid 5 μ l, dNTP mixing solutions (often kind of concentration 2.5mM) 4 μ l, below RNA template 500ng, forward primer and each 0.2-1.0 μM of reverse primer, sterile purified water supplies volume to 50 μ l.
PCR reaction conditions: 95 DEG C 10 minutes; 95 DEG C 10 seconds, 55 DEG C 30 seconds, 72 DEG C 40 seconds, totally 30 circulations; 72 DEG C 5 minutes.
RT-PCR qualification result is shown in Fig. 2 (B).
3. the extraction of mouse tissue albumen and immunoblotting assay
Prepare the protein lysate containing proteolytic enzyme and inhibitors of phosphatases in advance: 20mM Tris pH8.0,137mM NaCl, 10% glycerine, 1%NP-40(Nonidet P40), 2mM EDTA(contains protease and phosphatase inhibitor cocktails, Roche), be placed on ice, ground tissue is put into lysate cracking 20min, then 4 DEG C centrifugal (12000rpm) 20 minutes, get supernatant, carry out immunoblotting assay.Immunoblotting assay Anti-IRTKS rabbit used resists the self-control antibody for our laboratory more, and Anti-actin mouse monoclonal antibody is purchased from Santa Cruz.Results of immunoblot analysis is shown in Fig. 2 (C).
By above-mentioned Analysis and Identification, demonstrate the reliability of the mouse model of the IRTKS gene knockout that embodiment 1 builds.
The carbohydrate metabolism analysis of embodiment 3 three groups of mouse (Male homozygous, heterozygosis, wild)
1. detect the homozygote of IRTKS-KO(IRTKS gene knockout by Roche blood glucose meter (Roche Accu-chek)), IRTKS-WT(wild-type) with IRTKS-HET(heterozygote) mouse fasting blood sugar, the results are shown in Figure 3(A);
2.3.5 the mouse fasting at monthly age is after 6 hours, blood 50 μ l-100 μ l is got in eye socket puncture, centrifugal 5 minutes of 5000rpm, get supernatant, detect IRTKS-KO, IRTKS-WT and IRTKS-HET mice serum insulin levels by mouse islets element ELISA kit (Cat#EZRMI-13K) of millipore company, the results are shown in Figure 3(B);
3.3.5 the mouse at monthly age, overnight fasting, with 1ml syringe abdominal injection 1.5g/kg glucose, distinguish the blood glucose value of (0) and 15,30,60,90,120 minutes these 6 time point determining every mouse after injecting before the injection, calculate mean value and standard error (s.e.m.) that each time point often organizes mouse blood sugar, and carry out student ' s t-test statistical analysis, draw p value.With the time (Time) for X-coordinate, blood sugar mean value (Blood glucose) is ordinate zou, and standard is mistaken for error amount, draws glucose tolerance curve, the results are shown in Figure 3(C);
4.3.5 the mouse at monthly age, with the Regular Insulin of 1ml syringe abdominal injection 1unit/kg, distinguish the blood glucose value of (0) and 15,30,60,90,120 minutes these 6 time point determining every mouse after injecting before the injection, (100%) is worth based on the blood glucose value of 0, calculate the per-cent of each time point blood sugar relative to starting point blood sugar, calculate average and the standard error of the blood sugar per-cent often organizing each time point of mouse, and carry out statistical analysis with student ' s t-test, draw p value.With the time (Time) for X-coordinate, blood sugar per-cent is ordinate zou, draws insulin tolerance curve, the results are shown in Figure 3(D).
From carbohydrate metabolism detected result, IRTKS-KO mouse presents hyperglycemia, hyperinsulinemia, and glucose tolerance and insulin tolerance reduce, after showing IRTKS genetically deficient, can there is insulin resistant in mouse, this analysis meets the pathogeneticing characteristic of diabetes B clinically.
Embodiment 4IRTKS expresses reduction in diabetics and mouse
1. from Zhong Shan hospital of Fudan University liver grind institute and Huashan Endocrinology Department of hospital receive 10 couples of diabetes B people and the clinical operation on liver sample of non-diabetic people altogether, grinding extracting RNA, carry out the quantitative PCR analysis of IRTKS.
Quantitative PCR reaction uses Thermal Cycler
real Time System(TP800 real-time fluorescence quantitative PCR instrument, TaKaRa) and
premix Ex Taq
tM(Perfect Real Time) test kit (TaKaRa Biotechnology Inc.Dalian, China) carries out.
PCR primer:
IRTKS-F:TTGGCAGGCTACGTCTACCT（SEQ?ID?No:9）
IRTKS-R:GCGCCTAGGACTTGAGACTG（SEQ?ID?No:10）
Actin-F:AATCGTGCGTGACATTAAGGAG（SEQ?ID?No:11）
Actin-R:ACTGTGTTGGCGTACAGGTCTT（SEQ?ID?No:12）
PCR reaction system (25 μ l):
premix Ex Taq
tM12.5 μ l, cDNA template 2 μ l, 10 μMs of forward primers and reverse primer each 0.5 μ l, ddH
2o supplies volume to 25 μ l.
PCR reaction conditions (two step method amplification): 95 DEG C of sex change 10 seconds; 95 DEG C 5 seconds, 60 DEG C 30 seconds, totally 40 circulations.
The PCR primer that obtains of increasing carries out solubility curve analysis, and the response procedures that solubility curve generates is: 95 DEG C 15 seconds, 60 DEG C 30 seconds, 95 DEG C 15 seconds, Dissociation time is 4 seconds.
The results are shown in Figure 4(A), in diabetic subject's liver, the expression level of IRTKS is far below normal people.
2. buy db/db mouse from Chinese Academy of Sciences Shanghai Experimental Animal Center (SLAC) and only often organize 5-6 with the brood thin mouse (lean) that contrasts, get liver and fatty tissue extracting RNA, PCR qualification is carried out to the expression of IRTKS, PCR authentication method and primer, reaction system, reaction conditions etc. are all identical with the part 1 of the present embodiment 4, quantitative PCR qualification result is shown in Fig. 4 (B), and in the liver of db/db mouse and fatty tissue, the expression level of IRTKS is lower than the thin mouse of littermate control.
3. the nursing of high fat diet mouse (HFD)
1) buy C57BL/6 mouse in male 6 week age totally 10 from Chinese Academy of Sciences Shanghai Experimental Animal Center (SLAC), be divided into two groups, often organize 5, cut toe numbering; One group of regular diet (RD), another organizes high fat diet (HFD) (55%fat calories, Harlan-Teklad93075), after feeding 12 weeks, measures body weight and the blood glucose value of every mouse.
2) mouse is dissected, get liver and fatty tissue extracting RNA, quantitative PCR qualification is carried out to the expression of IRTKS, PCR authentication method and primer, reaction system, reaction conditions etc. are all identical with the part 1 of the present embodiment 4, quantitative PCR qualification result is shown in Fig. 4 (C), and in the liver of high fat diet mouse and fatty tissue, the expression level of IRTKS is starkly lower than the mouse of normal diet.
Synthesizing map 4 is visible, and IRTKS expresses reduction in diabetics, db/db mouse and high fat diet mouse.
Claims (10)
- The construction process of the mouse model of 1.IRTKS gene knockout, it is characterized in that, by the method for homologous recombination, replace the exon1 sequence containing ATG initiator codon in mouse IRTKS gene by 2.0-kbPGK/Neo sequence, obtain the mouse model of IRTKS gene knockout.
- 2. the construction process of mouse model as claimed in claim 1, it is characterized in that, the concrete steps of the method comprise:1) IRTKS-KO plasmid is built;2) ES cell targeting screen positive ES and clone;3) positive ES clone is injected into Mouse Blastocysts, obtains gomphosis mouse;4) gomphosis mouse and female mice are hybridized, obtain the mouse model of IRTKS gene knockout.
- 3. the construction process of mouse model as claimed in claim 2, it is characterized in that, step 1), IRTKS KO Vector plasmid DNA is cut through NotI enzyme, digestion, separation and purification, alcohol settling, and aseptic PBS is resuspended, obtains IRTKS-KO plasmid.
- 4. the construction process of mouse model as claimed in claim 2, is characterized in that, step 2), ES cell is SCR012, and colony screening condition is that 300 μ g/ml G418,2 μMs of GanC screen 8 days.
- 5. the construction process of mouse model as claimed in claim 2, is characterized in that, step 2) also comprise and identify that positive ES clones by PCR method.
- 6. the construction process of mouse model as claimed in claim 5, is characterized in that, step 2), the primer pair sequence of 5 ' PCR qualification is as shown in SEQ ID No:1 ~ 2; The primer pair sequence of 3 ' PCR qualification is as shown in SEQ ID No:3 ~ 4.
- 7. the construction process of mouse model as claimed in claim 2, it is characterized in that, step 3), described gomphosis mouse is the male mice of chimeric rate more than 50%.
- 8. the construction process of mouse model as claimed in claim 2, it is characterized in that, step 3) provides the mouse of blastaea and the female mice described in step 4) to be C57BL system mouse.
- 9. the application in the evaluation and screening of the research of pathogenesis of diabetes mellitus, Diagnosis and Treat and Remedies for diabetes of the mouse model of the IRTKS gene knockout utilizing the method in claim 1-8 described in any one to obtain.
- 10. utilize the mouse model of the IRTKS gene knockout that method described in any one builds in claim 1-8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310267704.0A CN104250656A (en) | 2013-06-28 | 2013-06-28 | IRTKS gene-knocked out mouse model, construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310267704.0A CN104250656A (en) | 2013-06-28 | 2013-06-28 | IRTKS gene-knocked out mouse model, construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104250656A true CN104250656A (en) | 2014-12-31 |
Family
ID=52185907
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310267704.0A Pending CN104250656A (en) | 2013-06-28 | 2013-06-28 | IRTKS gene-knocked out mouse model, construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104250656A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106139165A (en) * | 2016-08-23 | 2016-11-23 | 中国科学院上海药物研究所 | A kind of method for building up of non-human mammal obesity or its relevant disease animal model and application thereof |
| CN106755094A (en) * | 2016-11-30 | 2017-05-31 | 上海交通大学 | Mouse model and build and application that IRTKS genes liver specificity is rejected |
| CN110461146A (en) * | 2017-02-27 | 2019-11-15 | 再生元制药公司 | The non-human animal model of retinoschisis |
-
2013
- 2013-06-28 CN CN201310267704.0A patent/CN104250656A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106139165A (en) * | 2016-08-23 | 2016-11-23 | 中国科学院上海药物研究所 | A kind of method for building up of non-human mammal obesity or its relevant disease animal model and application thereof |
| WO2018036491A1 (en) * | 2016-08-23 | 2018-03-01 | 中国科学院上海药物研究所 | Method for building model of animal suffering from non-human mammal obesity or related disease and use thereof |
| CN106139165B (en) * | 2016-08-23 | 2023-10-27 | 中国科学院上海药物研究所 | Method for establishing animal model of non-human mammal obesity or related diseases thereof and application thereof |
| CN106755094A (en) * | 2016-11-30 | 2017-05-31 | 上海交通大学 | Mouse model and build and application that IRTKS genes liver specificity is rejected |
| CN110461146A (en) * | 2017-02-27 | 2019-11-15 | 再生元制药公司 | The non-human animal model of retinoschisis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kamberov et al. | Modeling recent human evolution in mice by expression of a selected EDAR variant | |
| Freeman | Studies on the biology of Taenia crassiceps (Zeder, 1800) Rudolphi, 1810 (Cestoda) | |
| Hori et al. | Deletion of SERP1/RAMP4, a component of the endoplasmic reticulum (ER) translocation sites, leads to ER stress | |
| Vuppaladhadiam et al. | Corticotropin-releasing factor family: a stress hormone-receptor system’s emerging role in mediating sex-specific signaling | |
| Karrow et al. | Genetics of helminth resistance in sheep | |
| Qiu et al. | Figla favors ovarian differentiation by antagonizing spermatogenesis in a teleosts, Nile tilapia (Oreochromis niloticus) | |
| Bramwell et al. | Lysosomal β-glucuronidase regulates Lyme and rheumatoid arthritis severity | |
| Voss et al. | Natural killer cell biology illuminated by primary immunodeficiency syndromes in humans | |
| CN104250656A (en) | IRTKS gene-knocked out mouse model, construction method and application thereof | |
| CN106755094A (en) | Mouse model and build and application that IRTKS genes liver specificity is rejected | |
| Arindkar et al. | Antigen peptide transporter 1 is involved in the development of fructose‐induced hepatic steatosis in mice | |
| Kalujnaia et al. | Seawater acclimation and inositol monophosphatase isoform expression in the European eel (Anguilla anguilla) and Nile tilapia (Orechromis niloticus) | |
| Liu et al. | NCOA5, a molecular link between type 2 diabetes and liver cancer | |
| Kuma et al. | Chromosomal mapping of the GFP-LC3 transgene in GFP-LC3 mice | |
| Motta et al. | Identification of the inflammasome Nlrp1b as the candidate gene conferring diabetes risk at the Idd4. 1 locus in the nonobese diabetic mouse | |
| Kesaraju et al. | Experimental autoimmune breast failure: a model for lactation insufficiency, postnatal nutritional deprivation, and prophylactic breast cancer vaccination | |
| US20220192165A1 (en) | Non-human animals having a humanized tslp gene, a humanized tslp receptor gene, and/or a humanized il7ra gene | |
| Izzard et al. | The cardiovascular phenotype of a mouse model of acromegaly | |
| Wang et al. | A new mouse model of metabolic syndrome and associated complications | |
| CN108261540B (en) | Application of CREG in treatment of non-alcoholic fatty liver disease and type 2 diabetes | |
| Chen et al. | Construction of the experimental rat model of gestational diabetes | |
| US11602134B2 (en) | Mouse model of myocarditits | |
| EP2918166A1 (en) | TTP/MRP14 double knock out mouse model of psoriasis | |
| Sarver et al. | Hypermetabolism in mice carrying a near-complete human chromosome 21 | |
| CN114146180B (en) | Application of substance inhibiting CHCHCHD 2 activity in preparation of product for treating NASH and hepatic fibrosis caused by liver injury |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20141231 |