CN104232628A - Primer applied to DNA target sequence reconstruction and reconstruction method - Google Patents
Primer applied to DNA target sequence reconstruction and reconstruction method Download PDFInfo
- Publication number
- CN104232628A CN104232628A CN201310233803.7A CN201310233803A CN104232628A CN 104232628 A CN104232628 A CN 104232628A CN 201310233803 A CN201310233803 A CN 201310233803A CN 104232628 A CN104232628 A CN 104232628A
- Authority
- CN
- China
- Prior art keywords
- primer
- transformation
- target sequence
- enzyme
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a reconstruction primer applied to connection of DNA target sequences, or substitute, insert or delete one or more bases of the target sequence and a reconstruction method. The 5' end of the primer comprises a recognition site of IIs type restriction endonuclease. The reconstruction method comprises: employing the primer with the 5' end containing the recognition site of IIs type restriction endonuclease to perform PCR amplification on the target sequence, then performing enzyme cleavage and connection on the PCR amplification product, utilizing a complementary cohesive end generated after a designed complementary paired cleavage site is cleaved in order to connect the PCR amplification product, so as to obtain the reconstructed target sequence. The characteristics of IIs type restriction endonuclease are ingeniously applied to site directed mutagenesis, the efficiency is high, the time is short, the cost is low, single point mutation and continuous multipoint mutation can be performed, and also reconstruction such as addition, deletion and the like of enzyme cutting sites can be performed.
Description
Technical field
The present invention relates to transgenation field, particularly relate to and a kind of DNA target sequence to be connected, or target sequence is carried out to primer and the method for the transformations such as the replacement of one or more base, insertion or disappearance.
Background technology
External site-directed mutagenesis technique is the important laboratory facilities of one in current biological, each area research of medical science, proterties and the sign of the target protein expressed by DNA can be improved rapid, efficiently, being transformation, optimized gene, exploration modulator promoter element, carrying out the effective means of vector modification etc., is the powerful of the complex relationship between Study on Protein structure and function.The potential Application Areas of site-directed mutagenesis technique is very wide, the structure in such as Way for Studying Protein-Protein Interactions site, the different activities of transformation enzyme or dynamics, transformation promotor or DNA functional element, improve the crystalline structure of the antigenicity of albumen or stability, activity, research albumen, and medicament research and development, gene therapy etc. aspect.
The type of current rite-directed mutagenesis mainly contains following several: one is use oligonucleotide mediated transgenation, refers to, with containing the oligonucleotide fragment of mutating alkali yl as primer, start DNA molecular and copy under the effect of polysaccharase.This kind of method needs the few core deoxyribonucleotide of synthesis one section as primer, needs template strand to be ring-type, the laggard row filter of transformation of E. coli after amplification.Two is cassette mutagenesises, is the oligonucleotide fragment containing transgenation sequence utilizing one section of synthetic, replaces the corresponding sequence in wild type gene.This kind of method needs synthesis DNA double chain short-movie section, needs the operation such as transformation of E. coli and plasmid extraction.Three is sudden changes that PCR mediates.
Restriction enzyme enzyme classification cuts the differences such as position, recognition site and cofactor according to subunit composition, enzyme, traditionally restriction enzyme is divided into four large classes.II wherein more common type restriction enzyme is a so-called II s type enzyme, and as FokI and AlwI, their recognition site is different with cleavage site, cuts DNA double chain outside recognition site, the DNA double chain normally sticky end of cutting.
Summary of the invention
The invention provides a kind of primer for the transformation of DNA target sequence, and based on primer of the present invention, DNA target sequence is connected, or to the method that DNA target sequence replaces, inserts or lacks.The characteristic of the present invention contriver's ingenious utilization II s type restriction enzyme is made, and IIs type restriction enzyme enzyme recognition site is different with cleavage site, cuts DNA double chain outside recognition site, and the DNA double chain of cutting is sticky end.
An aspect of of the present present invention discloses a kind of primer for the transformation of DNA target sequence, the recognition site of 5 ' end containing II s type restriction enzyme of this primer.Preferably, transformation of the present invention comprises and connecting target sequence, or carries out the replacement of one or more base, insertion or disappearance to target sequence.The present invention cleverly by the recognition site of II s type restriction enzyme and cleavage site not in the feature of same position, II s type restriction enzyme is used in the transformations such as the replacement of DNA target sequence, insertion, disappearance and connection, because recognition site is positioned at the upstream of cleavage site, after enzyme cuts process, recognition site can be cut, and the key that enzyme is cut only is recognition site, and no matter to be what kind of sequence can carry out enzyme to cleavage site cuts, therefore, cleavage site can design arbitrarily according to demand; Based on above-mentioned principle, the primer of the recognition site of design 5 ' end containing II s type restriction enzyme, the cleavage site of this primer is the sequence that can combine with target sequence complementation, after cutting through enzyme, the base of recognition site and cleavage site upstream is automatically cut off, and only leaves the sticky end of cleavage site.In a kind of implementation of the present invention, the primer that have employed the recognition site of at least two 5 ' ends containing II s type restriction enzyme carries out pcr amplification to target sequence respectively, obtain at least two sections of pcr amplification products, after enzyme is cut, by the sticky end of complementation, pcr amplification product is coupled together, due to the sequence on cleavage site inherently target, therefore, except one or more bases that design needs transformation, other base can not be introduced in the product cutting connection through enzyme, the integrity of target sequence can not be affected.
It should be noted that, when needing target sequence is carried out to replacement, the insertion of one or more base or lacked, basic conception of the present invention is, the transformation of the replacement of this one or more base, insertion or disappearance is introduced in the primer of the recognition site with II s type restriction enzyme, by this improvement and design in primer, when adopting this primer pair target sequence to increase, namely with this transformation in amplified production, then by connecting the target sequence namely obtained with this transformation.Also it should be noted that, under normal circumstances, the sequence of cleavage site is matched with target sequence, if but replace, insert or disappearance one or more bases be design in the sequence of cleavage site time, be appreciated that, cleavage site now does not then need completely and target sequence is matched, and even cleavage site is and the unallied base needing to insert of target sequence milli; But, in order to can by respectively amplification after target sequence couple together, cleavage site produce sticky end be complementary all the time.
In a specific embodiment of the present invention, target sequence refers to the double-stranded DNA needing to carry out processing, and this double-stranded DNA comprises sense strand and antisense strand; The DNA single chain that sense strand is namely consistent with the mRNA sequence of transcribing generation, in order to characterize target sequence; 5 ' end of sense strand is defined as upstream, and 3 ' end of sense strand is defined as downstream.
In a specific embodiment of the present invention, sense primer, just end points primer, justice transformation primer are connected primer refer to justice, identical with sense strand sequence or part is identical, can be used in the primer amplifying sense strand or sense strand partial sequence; Antisense primer, antisense end points primer, antisense transformation primer is connected primer with antisense and refers to, the complementary or partial complementarity with sense strand, can in order to amplify the primer of antisense strand or antisense strand partial sequence.
In a specific embodiment of the present invention, the primer of the recognition site of 5 ' end containing II s type restriction enzyme has general sequences:
5’-（N）
x-E
1-（N）
y-E
2-E
3-3’；
Wherein, N represents any base in A, G, C, T, and x represents to have x base arbitrarily, and y represents to have y base arbitrarily; E1 region is the recognition site sequence of II s type restriction enzyme; E
2region is the cleavage sequences of II s type restriction enzyme, E
2the sequence in region can combine with target sequence complementation; E
3region is the sequence combined with target sequence complementation.
It should be noted that, under normal circumstances, E
2region and cleavage sequences, be can with the sequence of target sequence complementary pairing, comprise can complete complementary pairing and partial complementarity match situation, target sequence is carried out the replacement of one or more base, insertion or disappearance transformation time, and, this replacement, insertion or lack one or more base and just in time design when this cleavage site, the sequence of cleavage site also not necessarily match with target sequence completely, or is only the sequence had nothing to do with target sequence of insertion.In addition, being appreciated that when carrying out connection handling to target sequence, only needing the recognition site needing 5 ' end introducing II s type restriction enzyme of the primer of the sequence connected in amplification, E
2region is then the sequence of matching with target sequence, when pcr amplification product enzyme cuts process, and cleavage site E
2sequence before region, i.e. " (N)
x-E
1-(N)
y" all can be cut, then target sequence can be coupled together by complementary cleavage site sticky end.Also it should be noted that, target sequence is carried out the replacement of one or more base, insertion or disappearance transformation time, one or more bases of this replacement, insertion or disappearance design in E
2region and/or E
3region.
In a specific embodiment of the present invention, E
3region is by 18-30 based composition, and x represents the number of protection base, and 6>=x>=2; Y represents the interval base number between the recognition site of II s type restriction enzyme and cleavage site, usual 4>=y>=1.It should be noted that, the protection base before restriction enzyme site is to ensure the effect that enzyme is cut, and the number of protection base is generally 1-10, and preferably, the number of protection base is 2-6.In addition, for most II s type restriction enzyme, recognition site and cleavage site are not at same place, therefore, some bases may be there is between recognition site and the cleavage site in its downstream, i.e. said intervening sequence in the present invention's specific embodiment, the base type of this intervening sequence is unrestricted; Also can not have interval base for recognition site some II s type restriction enzyme and cleavage site, therefore the concrete number of intervening sequence or interval base does not limit in the present invention.In one embodiment of the present invention, II s type restriction enzyme is BsaI, has the protection base of 3bp before the recognition site of BsaI, has the interval base of 1bp between the recognition site and cleavage site of BsaI; Or II s type restriction enzyme is BbsI, has the protection base of 3bp before the recognition site of BbsI, has the interval base of 2bp between the recognition site and cleavage site of BbsI.
Further, in a specific embodiment of the present invention, IIs type restriction enzyme is selected from AcuI, AlwI, AceIII, BbvII, BveI, BslFI, BsoMAI, Bst71I, BsaI, BspMI, BtgZI, BbsI, BccI, BceAI, BspCNI, BtsCI, BciVI, BmrI, BpmI, BpuEI, BseRI, BsgI, BsrDI, BtsI, BmuI, BsbI, BbvI, BbvI, BsmAI, BsmFI, BsmAI, BsmFI, BfuAI, BspQI, Bce83I, BcefI, HphI, HpyAV, MboII, PleI, EarI, EciI, MmeI, NmeAIII, SapI, Hin4II, LguI, HgaI, SfaNI, FokI, HgaI, SfaNI, MnlI, at least one in SgeI and FaqI.As long as be appreciated that recognition site and cleavage site be not at same place, and the enzyme that can produce sticky end after cutting may be used to implement a concrete scheme of the present invention, and therefore, the enzyme that can use is not limited to these and enumerates.
Another side of the present invention discloses a kind of method transformed DNA target sequence, and the method comprises, and needs the sequences Design primer of the present invention transforming region, namely transform primer according to target sequence; The sequence of transformation region comprises the sequence of upstream 50bp to downstream 50bp of described transformation; Transformation primer comprises an antisense transformation primer and a justice transformation primer, antisense transformation primer can be bonded to the upstream region of transformation nidus, namely transform in the upstream 50bp sequence of nidus, justice transformation primer can be bonded to the downstream area of described transformation nidus, namely transforms in the downstream 50bp sequence of nidus; Utilize the antisense primer of transformation primer and sense primer to increase to target sequence respectively, obtain amplified production; Enzyme is carried out to amplified production and cuts connection, obtain transformation target sequence.Preferably, enzyme is cut to be connected in same reaction system and is carried out.Preferably, transformation of the present invention comprises at least one of target sequence being carried out to the replacement of base, insertion and disappearance.According to embodiments of the invention, DNA target sequence remodeling method is the design based on primer on the one hand, be appreciated that, after adopting the primer pair target sequence of the recognition site of 5 ' end containing II s type restriction enzyme to increase, the product of end with the recognition site of II s type restriction enzyme can be amplified, cut by enzyme, connect product end with complementary cohesive tennini and couple together, thus realize the connection transformation of target sequence.Thus, utilize described remodeling method, only need to carry out an enzyme and cut ligation, in 8h, just can obtain the DNA sequence dna of the replacement of one or more base, insertion or disappearance, efficiency can reach 100%.Because the recognition site of II s type restriction enzyme and cleavage site are at different positions, therefore, the base of the introducing beyond the transformation effectively can excising design, thus ensure that the integrity of the target sequence of transformation.It is also understood that, need to target sequence carry out the replacement of one or more base, insertion or disappearance transformation time, in the primer of the recognition site of 5 ' end containing II s type restriction enzyme, introduce the replacement of this one or more base, insertion or disappearance can realize transformation.Described remodeling method is not by the restriction of base sequence, not by the restriction of target sequence restriction enzyme site, not only can carry out the multipoint mutation of simple point mutation, continuous print multipoint mutation, different sites accurately, the transformation of the restriction enzyme site on carrier can also be carried out, as restriction enzyme site interpolation, deletion etc., and the method time is short, efficiency is high, cost is low.It should be noted that, according to a specific embodiment of the present invention, need in the antisense transformation primer of the sequences Design transforming region and just transformation primer according to target sequence, the position that antisense transformation primer can be incorporated into target sequence be positioned at justice transformation primer can in conjunction with the upstream of position, the pair of primers that PCR is generally made up of sense primer and antisense primer completes the exponential amplification of double-stranded DNA, antisense transformation primer and the justice transformation primer of the sequences Design transforming region is needed according to target sequence, both generally can not combine the double-strand target sequence for amplifying exponential growth.In a kind of implementation of the present invention, the upstream and downstream of the position of target is attached to according to primer, said " antisense primer " and the sense primer of its upstream combine and are used for increasing above, " sense primer " combines with the antisense primer in its downstream and increases, thus completes the amplification respectively to target sequence different piece.
Also it should be noted that, owing to needing enzyme to cut after amplification, connecting the complete target sequence obtaining and there is transformation, antisense transformation primer and the binding site sequence except the transformation part of design except of justice transformation primer on target of design are tightly adjacent, namely base intervals is not had in the middle of, and, when the transformation of insertion base is not cleavage site itself, antisense transformation primer and justice transform cleavage site the same area in conjunction with target of primer; Be appreciated that, when this transform the transformation lacking one or more base as, the antisense transformation primer of design and justice transformation primer make in target sequence with it can the one or more base in interval in the middle of complementary pairing two pieces of regions, and namely one or more bases at this interval make a reservation for the part that will lack; Whatsoever situation, after utilizing target sequence to need the antisense transformation primer of the sequences Design transforming region and justice to transform primer amplification target, can make amplified production after certain enzyme enzyme is cut, produce complementary sticky end.
According to a specific embodiment of the present invention, comprise at the concrete grammar transformed linear target sequence, according to two ends sequences Design two primers of linear target sequence, i.e. just end points primer and antisense end points primer; Hold from 5 ' end of linear DNA sequence dna to 3 ', by just end points primer, antisense transformation primer, justice transformation primer and antisense end points primer according to the sequence that can be bonded to the position on linear DNA sequence dna, from just end points primer, combination of two increases to linear DNA sequence dna respectively successively, obtains amplified production; Described enzyme is carried out to amplified production and cuts connection, obtain the linear DNA sequence dna of transformation.Wherein combination of two refers to successively, from just end points primer, according to a sense primer and the nearest antisense primer combination of two being positioned at its downstream, in order to increase to linear DNA sequence dna.
It should be noted that, according to the present invention's specific embodiment, antisense transformation primer can be identical with 5 ' the II s type restriction enzyme enzyme recognition site held of justice transformation primer, also can not be identical, time II s type restriction enzyme enzyme recognition site is identical, the II s type restriction enzyme adopting this recognition site corresponding carries out enzyme and cuts; Time II s type restriction enzyme enzyme recognition site is not identical, the II s type restriction enzyme adopting these two recognition sites corresponding carries out double digestion.In connection procedure after enzyme is cut, the key that amplified production couples together can be the sticky end of cleavage site, and cleavage site is separated with recognition site, therefore, no matter whether recognition site is identical, as long as cleavage site is complementary.
Also it should be noted that, according in a specific embodiment of the present invention, common just end points primer and antisense end points primer are the primer of conveniently primer design method design, be appreciated that, in the needs of some characteristics, just end points primer and antisense end points primer also can carry out some special designs; Such as, in just end points primer and antisense end points primer, also restriction enzyme site etc. is designed.
In a kind of implementation of the present invention, the first amplified reaction and the second amplified reaction are comprised to the amplification of linear DNA sequence dna, be that the first primer pair carries out the first amplified reaction with just end points primer and antisense transformation primer, obtain the first amplified production; With justice transformation primer and antisense end points primer be that the second primer pair carries out the second amplified reaction, obtain the second amplified production; Enzyme is carried out to the first amplified production and the second amplified production and cuts connection, obtain the linear DNA molecule of transformation.
It should be noted that, in a specific embodiment of the present invention, justice end points primer and antisense end points primer refer to, the primer mated with two end points of target sequence, these two combination of primers can amplify complete target sequence, if the target sequence through transforming, the complete target sequence through transformation can be amplified with these two primers.
In another one embodiment of the present invention, the concrete grammar that circular target sequence is transformed is comprised, adopt justice transformation primer and antisense transformation primer pair circle DNA sequence to increase respectively, obtain amplified production; Enzyme is carried out to amplified production and cuts connection, obtain the DNA sequence dna of the ring-type of transformation.Same, the II s type restriction enzyme enzyme recognition site held of 5 ' of two primers can identical also can not be identical, but in any case, its cleavage site is complementary all the time.
One side more of the present invention discloses a kind of method connected multiple linear DNA molecule, the method comprises, need in n the linear DNA molecule connected, total 2*(n-1) end that connects of individual needs, according to the primers needing the end connected, obtain 2*(n-1) bar connection primer; Utilize linear DNA molecule described in connection primer pair to increase respectively, obtain n amplified production; Enzyme is carried out to n amplified production and cuts connection, obtain the connection product of n linear order; Optionally, enzyme is cut to be connected in a reaction system and is carried out.Connect 5 ' end of primer all with II s type restriction enzyme enzyme recognition site, these recognition sites can be identical, also can be different, as previously described because recognition site is separated with cleavage site, as long as after cutting for the amplified production enzyme of the target sequence connected, the sticky end that its two ends produce is different, just can realize its directed connection, even if adopt identical recognition site, adopt identical enzyme to carry out enzyme and cut also passable.In one embodiment of the present of invention, enzyme is cut and is connected in a reaction system and carries out.Thus, in multiple target sequence, introduce identical enzyme and cut recognition site, only adopt an enzyme to cut the orientation connection that ligation rulyly can realize multiple target.Thus, utilize described method of attachment, only need to carry out an enzyme and cut ligation, in 8h, just can obtain the connection product of multiple sequence, efficiency can reach 100%.
In a specific embodiment of the present invention, the method that multiple target sequence connects also is comprised, needing in n the linear DNA molecule connected, the end of the connection product having two to be positioned to connect, according to the sense primer of sequences Design routine of two ends and the antisense primer that connect product; Carry out amplification to linear DNA molecule to comprise, adopt conventional sense primer and antisense primer, and connect n primer pair of primer sets synthesis, respectively n linear DNA molecule is increased, obtain a described n amplified production; Connect in primer, the justice for i-th linear DNA molecule that increase connects primer, is connected primer has complementary cleavage site with the antisense for the i-th-1 linear DNA molecule that increases; Antisense for i the linear DNA molecule that increase connects primer, is connected primer has complementary cleavage site with the justice for the i-th+1 linear DNA molecule that increases; Utilize complementary cleavage site to realize the connection of n amplified production, obtain described connection product, wherein, n-1 >=i >=2.
In specific embodiments of the invention, transformation site is arranged in the middle of primer, therefore, and can designed, designed as required, not by the restriction of restriction enzyme site; Cut for making enzyme and act on predetermined transformation region, II s type restriction enzyme directly can not select the target sequence containing this II s type restriction enzyme enzyme recognition site when selecting, to a certain IIs restriction enzyme of choice for use and target with this enzyme recognition site, can first select another IIs type restriction enzyme to transform this target.It should be noted that, enzyme to cut in used enzyme and primer the restriction endonuclease with II s type restriction enzyme digestion sites, and enzyme is cut, the method that connects and condition adopt conventional method and condition.In a specific embodiment of the present invention, enzyme is cut and is connected in same reaction system and carries out.Thus, reactions steps can be reduced and reduce the operating time.
Although include in the DNA target sequence remodeling method that an aspect of of the present present invention proposes and carry out concrete transformation of different nature to dissimilar target sequence, but, 5 ' end of the transformation primer that it uses all contains the recognition site of II s type restriction enzyme, and all there is general sequences, 5 '-(N)
x-E
1-(N)
y-E
2-E
3-3 '; Wherein, N represents any base in A, G, C, T, and x represents to have x base arbitrarily, and y represents to have y base arbitrarily; E
1region is the recognition site sequence of II s type restriction enzyme; E
2region is the cleavage sequences of II s type restriction enzyme; E
3region is the sequence that can combine with target sequence complementation.
Further, in specific embodiments of the invention, in the primer used in target sequence remodeling method, E
3region is by 18-30 based composition, and x represents the number of protection base, and 6>=x>=2, y represents the interval base number between the recognition site of II s type restriction enzyme and cleavage site, IIs type restriction enzyme is selected from AcuI, AlwI, AceIII, BbvII, BveI, BslFI, BsoMAI, Bst71I, BsaI, BspMI, BtgZI, BbsI, BccI, BceAI, BspCNI, BtsCI, BciVI, BmrI, BpmI, BpuEI, BseRI, BsgI, BsrDI, BtsI, BmuI, BsbI, BbvI, BbvI, BsmAI, BsmFI, BsmAI, BsmFI, BfuAI, BspQI, Bce83I, BcefI, HphI, HpyAV, MboII, PleI, EarI, EciI, MmeI, NmeAIII, SapI, Hin4II, LguI, HgaI, SfaNI, FokI, HgaI, SfaNI, MnlI, at least one in SgeI and FaqI.
Further aspect of the present invention also proposed a kind of test kit containing primer.Test kit comprises the primer of the recognition site with II s type restriction enzyme, may be used for the transformation of DNA target sequence.Different primers can be positioned in different vessels in the mode of liquid or solid, and test kit can comprise reaction soln system further.
Additional aspect of the present invention and advantage also will part provide in the following description, and part will become obvious from the following description, or be recognized by practice of the present invention.
Accompanying drawing explanation
Fig. 1: be transform design of primers schematic diagram in the embodiment of the present invention;
Fig. 2: the design of primers schematic diagram being the directed seamless link of DNA fragmentation in the embodiment of the present invention.
Embodiment
The remodeling methods such as DNA mutation of the present invention and primer, make use of the recognition site of II s type restriction enzyme and restriction enzyme site cleverly not in the feature of same position, select the IIs type restriction enzyme being applicable to target sequence, not containing this enzyme recognition sequence in target sequence; About needing the position of rite-directed mutagenesis, design the recognition site with this II s type restriction enzyme, and two of cleavage site complementation primer, and sudden change waited the base design of transformation in primer, increased to the carrying out of target sequence respectively by primer, the feature then utilizing II s type restriction enzyme the recognition site added can be excised, cuts after connection handling through enzyme, target sequence is coupled together, obtains the complete target sequence with transformation.
In one embodiment of the present of invention, the rite-directed mutagenesis of single-point or multiple spot is carried out in a position of relatively concentrating of linear target sequence, therefore, need the position of rite-directed mutagenesis to devise an antisense holding primer to mate with linear target sequence 5 ' to transform primer at this, and one is held the justice transformation primer of primer coupling with target sequence 3 ', and, antisense transformation primer and the justice cleavage site transformed in primer are the complementary sequences in target sequence, namely in the binding site shown in target sequence, the cleavage site of antisense primer and sense primer is equitant, carry out after enzyme is cut, namely producing complementary sticky end to PCR primer like this, thus fragment is coupled together, and the complementary sequence of this sticky end inherently in target sequence, therefore, the base of unnecessary interpolation can not be produced.Be appreciated that, if need to carry out rite-directed mutagenesis to the multiple scattered different site in target sequence, equally, only need to design a pair antisense transformation primer and justice transformation primer respectively to these scattered sites, utilize the principle that DNA fragmentation connects, in the primer of band II s type restriction enzyme enzyme recognition site, design predetermined mutating alkali yl, then primer pairing, target sequence is increased, enzyme is carried out to amplified production and cuts, connect, each section of amplified production is coupled together.
It should be noted that, the characteristic of II s type restriction enzyme is applied to the rite-directed mutagenesis of DNA, and in the transformation such as DNA fragmentation connection, be one of inventive point of the present invention; The DNA target sequence remodeling methods such as DNA rite-directed mutagenesis of the present invention, the rite-directed mutagenesis not being only DNA provides a kind of new thinking and skill, and, mutation time, efficiency and cost also all improve to some extent.
In addition, utilize the recognition site of II s type restriction enzyme and cleavage site not in the feature of same place, primer of the present invention can be used in DNA rite-directed mutagenesis, DNA fragmentation deletion, the insertion of DNA small segment, DNA fragmentation connection etc.Be appreciated that in the primer of the recognition site introducing II s type restriction enzyme, mutating alkali yl is designed to the Sequence wherein mated with target sequence, then cut connection by amplification, enzyme, the sequence of rite-directed mutagenesis can be obtained; Fragment is deleted, optionally segmentation amplification being carried out to the fragment in target sequence when increasing, then each section being coupled together, the deletion of DNA fragmentation can be realized; The insertion of DNA small segment, can in the primer of the recognition site of band II s type restriction enzyme, after its recognition site, the sequence of insertion is designed in primer sequence after cleavage site or cleavage site, then through amplification, the target sequence containing Insert Fragment can after enzyme cuts connection, be obtained.Be appreciated that, for the insertion of DNA large fragment, the same principle be connected with DNA fragmentation is adopted to realize, only to insert section of DNA larger sequence fragment in a target sequence, two sections, front and back are divided to increase respectively target sequence needing the place of inserting DNA large fragment, amplification needs the DNA large fragment of insertion separately simultaneously, and, II different s type restriction enzyme cleavage sites is designed in the amplimer at two ends needing the DNA large fragment inserted, and introducing II s type restriction enzyme cleavage sites corresponding in the primer that target sequence segmentation is increased, namely II s type restriction enzyme cleavage sites of 5 ' of the Insert Fragment primer held is complementary with II s type restriction enzyme cleavage sites of the antisense primer of amplification target gene leading portion sequence, II s type restriction enzyme cleavage sites of the primer that 3 ' of Insert Fragment is held is complementary with II s type restriction enzyme cleavage sites of the sense primer of amplification target gene back segment sequence, finally amplified production is carried out enzyme to cut to connect and be about to three sections of sequences and couple together, thus obtain the target sequence being inserted with DNA large fragment.Wherein, the endonuclease recognized site of each primer can be identical, also can be different.
It should be noted that, feature during amplification in view of linear target sequence and circular target sequence, the present invention proposes the remodeling method of linear target sequence and circular target sequence respectively.
In addition, present invention also offers the method for the multiple linear DNA molecule connections based on II s type restriction enzyme.To different DNA fragmentations, design primer respectively and carry out pcr amplification, and hold the recognition site of design II s type restriction enzyme at 5 ' of its primer, and the cleavage site that design is complementary, after enzyme is cut, deleted by restriction enzyme site, each DNA fragmentation then couples together by the cleavage site of its complementation; And the cleavage site of complementation can be 5 ' end or the 3 ' sequence of holding needing the DNA fragmentation connected, therefore, after enzyme is cut, other sequence can not be introduced in each DNA fragmentation connected, thus realize seamless link.
Also by reference to the accompanying drawings the present invention is described in further detail below by specific embodiment.Following examples are only further detailed the present invention, should not be construed as limitation of the present invention.
Embodiment one technical scheme
Utilize IIs restriction enzyme to carry out the base mutation of DNA fragmentation, the DNA fragmentation in this example namely and design of primers as shown in Figure 1, by as follows for the method that the A in former sequence sports T base:
1, two suitable type restriction enzymes are selected
Target sequence is carried out restriction enzyme site analysis, and choose the two type restriction enzymes do not comprised in target sequence, this example is for BsaI.Recognition site and the cleavage site of BsaI are as follows:
2, PCR primer design
Design of primers is as follows: F1 and R2 for binding site, designs conventional PCR primer with target sequence two ends.According to the sticky end base number of BsaI cleavage site, choose 4 base N before mutating alkali yl A
1n
2n
3n
4, as core cutting and sticky end binding site, the i.e. cleavage site of BsaI restriction endonuclease; It is the recognition site of restriction endonuclease before cleavage site.Primer sequence in principle after N1 is the sequence of mating with target sequence, and from N
1afterwards can mutating alkali yl be set.
F2 design of primers is as follows: 5 '-NNN+GGTCTC+N
0+ N
1n
2n
3n
4+ T+N
11n
12n
13n
14... .-3 '
R1 design of primers is as follows: 5 '-NNN+GGTCTC+N
0+ N
8n
7n
6n
5nNNN ...-3 '
Wherein, N represents any base, the recognition site that " GGTCTC " is BsaI, and three N before recognition site are protection base, N
0for recognition site and cleavage site directly between intervening sequence or interval base, " N
1n
2n
3n
4" and " N
8n
7n
6n
5" be the sticky end that namely cleavage site cuts rear generation, and, " N
1n
2n
3n
4" and " N
8n
7n
6n
5" complementary.In F2 primer, from N
1be all the sequence of mating with target sequence afterwards, namely mutating alkali yl is arranged at N
1in base afterwards; In R1 primer, from N
8be all the sequence of mating with target sequence afterwards, namely mutating alkali yl is arranged at N
8in base afterwards.
Use primers F 1 and R1, F2 and R2 respectively, pcr amplification is carried out to target sequence.By two pcr amplification products obtained, cut through BsaI enzyme and connect and namely obtain the complete target sequence with mutating alkali yl.The system of pcr amplification is with reference to conventional pcr amplification.The enzyme of amplified production is cut, linked system is as follows:
Supplement the straight 20 μ l of aqua sterilisa.
Reaction conditions: first carry out 10 circulations: 37 DEG C of 5min, 16 DEG C of 10min; After circulation completes, 50 DEG C of 5min, 80 DEG C of 5min, complete reaction; Complete the rear constant temperature standby temperature 12 DEG C of reaction.
Getting enzyme, to cut ligation liquid 2 μ l be masterplate, re-uses primers F 1 and R2 carries out pcr amplification, then carries out sequence verification to amplified production.
Embodiment two Homo sapiens hemoglobin, beta (HBB), mRNA cds suddenly change
One, single base mutation
This test adopts the technical scheme of embodiment one to suddenly change to Homo sapiens hemoglobin beta gene, and Homo sapiens hemoglobin beta gene is as shown in Seq ID No.1; Concrete, the 202nd bit base " G " of this gene is sported " C ".
Through DNAMAN software analysis, do not comprise the recognition site " GGTCTC " of BsaI in the target sequence of this test, therefore, this enzyme can be used.The principle of design of primers is identical with embodiment one, and design primer is as table 1:
Table 1 Homo sapiens hemoglobin beta site-directed point mutation primer
Note: in table 1, N represents any base, " C " base of second place's underscore and mutating alkali yl in primer HSH-F2, in this example, N is G
Employing primer HSH-F1 and HSH-R1, HSH-F2 and HSH-R2 increase to beta gene respectively, and amplification system is identical with embodiment one with condition.Then, enzyme is cut, connection handling to adopt the system identical with embodiment one and condition to carry out amplified production, obtains the beta gene with mutating alkali yl.
Finally, adopt HSH-F1 and HSH-R2 to the beta gene with mutating alkali yl, namely connect product, carry out pcr amplification, amplification system and condition adopt conventional PCR amplification system and condition; Then sequence verification is carried out to amplified production.Sequencing result is as shown in Seq ID No.6, and the 202nd bit base " G " sudden change of beta gene is in order to " C ", and all the other are constant.Visible, primer and directed mutagenesis method respond well.
Two, many base mutations
202nd gene " G " of Homo sapiens hemoglobin beta gene, the 206th, 207 gene " TC " and the 211st gene " G " are suddenlyd change; Concrete, " G " of the 202nd is sported " C ", " TC " of the 206th, 207 is sported " AA ", " G " of the 211st is sported " A ".
Concrete grammar is identical with the simple point mutation that the 202nd gene " G " is sported " C " with step; Just, adopt the primer HSH-F2 in primer HSH-F2 ' substitution table 1, all the other are constant.HSH-F2 ' primer sequence is as shown in Seq ID No.7:
Seq?ID?No.7：5’-NNN
GGTCTC?GGAAA
CTGC
AAGGT
ACCTTTAGTG-3’
In the primer of sequence shown in Seq ID No.7, N represents any base, "
gGTCTC" cut recognition site for enzyme, "
c" "
aA" and "
a" i.e. mutating alkali yl.
Except the part replacement of primer, other step is all identical with simple point mutation.
Finally, adopt HSH-F1 and HSH-R2 to carry out pcr amplification to the beta gene with mutating alkali yl, amplification system and condition adopt conventional PCR amplification system and condition; Then sequence verification is carried out to amplified production.Sequencing result is as shown in Seq ID No.8, and the 202nd bit base " G " sudden change of beta gene is in order to " C ", and meanwhile, " TC " sudden change of the 206th, 207 is in order to " AA ", and " G " sudden change of the 211st is in order to " A ", and all the other are constant.Visible, primer and the directed mutagenesis method of this test are respond well.
The deletion of embodiment three cyclic plasmid restriction enzyme site
This example adopts the conventional puc18 carrier used to test, concrete, is deleted by the EcoRI recognition site of puc18 carrier.The IIs restriction enzyme that this example uses is BbsI, its recognition site and cleavage site as follows:
Need the sequence around the EcoRI site of excision as follows:
GACTCTAGAGGATCCCCGGGTACCGA
GCTC?
GAATTC?
GTAATCATGGTCATAGCTGTTTCC
CTGAGATCTC
CTAGGGGCCCATGGCT?
CGAG?
CTTAAG?CATTAGTACCAGTATCGACAAAGG
Wherein, "
gAATTC" be namely the site needing to delete, during design primer, according to the feature that BbsI enzyme is cut, adopt "
aGCTC" be the sticky end after cleavage site and cutting.Design of primers is as follows:
3F:5--NNN(protects base)+GAAGAC(Bbs I recognition sequence)+NN(intervening sequence)+GCTC (cleavage site)+GTAATCATGGTCATAGCTGT--3
3R:5--NNN(protects base)+GAAGAC(Bbs I recognition sequence)+NN(intervening sequence)+GAGC (cleavage site)+TCGGTACCCGGGGATC--3
The primer that table 2 is deleted for the EcoRI recognition site of puc18 carrier
Note: in table 2, N represents any base, in this example, N is G
With puc18 carrier for template, respectively with F and R for primer carries out pcr amplification, carry out after having increased that enzyme is cut, connection handling; Pcr amplification adopts conventional PCR amplification system and condition; Enzyme is cut, linked system is identical with embodiment one with condition.Processed the rear puc18 carrier to deleting EcoRI site to check order, the method for order-checking is identical with general puc18 carrier sequence measurement, and result shows, and in the puc18 carrier of this example, EcoRI site is deleted, and other is constant.Visible, the example method and primer effectively can delete the specified segment in target sequence.
The insertion of restriction enzyme site in embodiment four cyclic plasmid
This example with the product of embodiment three for template, the restriction enzyme site (restriction enzyme site of insertion can be already contg restriction enzyme site on original vector) of the place insertion EcoR V in EcoRI site is deleted at script, concrete, the restriction enzyme site of EcoR V is namely inserted in the X blank space of following sequence:
GACTCTAGAGGATCCCCGGGTACCGA
GCTC?
X?
GAATTCGTAATCATGGTCATAGCTGTTTCC
CTGAGATCTCC
TAGGGGCCCATGGCT?
CGAG?
X?CTTAAGCATTAGTACCAGTATCGACAAAGG
Wherein, " X " represents blank, and be namely the continuous print sequence do not had in script sequence, " X " is in order to express easily.This example adopts BbsI enzyme to realize the insertion of restriction enzyme site equally, and design of primers is as follows:
4F:5--NNN(protects base)+GAAGAC(Bbs I is identified as a little)+NN(intervening sequence)+GCTC (cutting and connection site)+GATATC (EcoR V site)+GAATTCGTAATCATGGTCATA--3
4R:5--NNN(protects base)+GAAGAC(Bbs I is identified as a little)+NN(intervening sequence)+GAGC (cutting and connection site)+TCGGTACCCGGGAT--3
The primer that table 3 inserts for EcoR V recognition site
Note: in table 3, N represents any base, in this example, N is G, the sequence that wherein in 4F, namely underscore italic thickened portion inserts
With the puc18 carrier deleting EcoRI site of embodiment three for template, respectively with F and R for primer carries out pcr amplification, carry out after having increased that enzyme is cut, connection handling; Pcr amplification adopts conventional PCR amplification system and condition; Enzyme is cut, linked system is identical with embodiment one with condition.Processed and to have checked order to puc18 carrier afterwards, the method for order-checking is identical with general puc18 carrier sequence measurement, and result shows, in the puc18 carrier of this example, the place deleting EcoRI site at script adds EcoR V site, and namely newly increased " GATATC " fragment, other is constant.Visible, the example method and primer effectively can increase the fragment of specifying in target sequence.
Embodiment five is based on the multiple clips seamless link of IIs restriction enzyme
Three fragments shown in Seq ID No.13, Seq ID No.14 and Seq ID No.15 couple together by this example.The structural representation of design of primers as shown in Figure 2, (1), (2) in figure, (3) three fragment seamless links are got up, (1), (2), (3) in figure represents sequence shown in Seq ID No.13, Seq ID No.14 and Seq ID No.15 respectively.
IIs restriction enzyme BbsI and BsaI that have employed in this example does not have in three fragment sequences carries out directed seamless link to three fragments.Design the primer of band BbsI and BsaI recognition site respectively at the two ends of middle one section of sequence (2), as shown in Figure 2, primer is specific as follows for structural representation:
The primer of directed connection that table 4 is seamless
Note: in table 4, N represents any base, the N in this example in 5R1 and 5F2 is the N in G, 5R2 and 5F3 is T
In this example, Seq ID No.13, in fact three fragments shown in Seq ID No.14 and Seq ID No.15 are selected from the sequence of puc18 plasmid vector, therefore, with puc18 plasmid vector for template, adopt primer sets 5F1-5R1 respectively, 5F2-5R2, 5F2-5R2, pcr amplification is carried out to template, obtain three fragments, BbsI and BsaI double digestion is carried out to three fragments, then connect, obtain the sequence of directed for three fragments seamless link, sequencing result is as shown in Seq ID No.22, result shows, three fragments are according to intact the linking together of expection, centre does not have other to insert base or sequence.
Above content is in conjunction with concrete embodiment further description made for the present invention, can not assert that specific embodiment of the invention is confined to these explanations.For general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, some simple deduction or replace can also be made, all should be considered as belonging to protection scope of the present invention.
Claims (10)
1. for a primer for DNA target sequence transformation, it is characterized in that: the recognition site of 5 ' end containing II s type restriction enzyme of described primer.
2. primer according to claim 1, is characterized in that: described primer has general sequences: 5 '-(N)
x-E
1-(N)
y-E
2-E
3-3 ';
Wherein, N represents any base in A, G, C, T, and x, y are natural number, and x, y represent base number;
E
1comprise the base of the recognition site of described II s type restriction enzyme;
E
2comprise the base of the cleavage site of described II s type restriction enzyme;
E
3comprise can with the base of described target sequence complementary pairing.
3. primer according to claim 2, is characterized in that: the E of described primer general sequences
3partly by 18-30 based composition,
Preferably, (N) of described primer general sequences
xpart represents protection base, 6>=x>=2;
Preferably, (N) of described primer general sequences
ypart represents the interval base between the recognition site of described II s type restriction enzyme and cleavage site.
4. primer according to claim 2, it is characterized in that: described IIs type restriction enzyme is selected from AcuI, AlwI, AceIII, BbvII, BveI, BslFI, BsoMAI, Bst71I, BsaI, BspMI, BtgZI, BbsI, BccI, BceAI, BspCNI, BtsCI, BciVI, BmrI, BpmI, BpuEI, BseRI, BsgI, BsrDI, BtsI, BmuI, BsbI, BbvI, BbvI, BsmAI, BsmFI, BsmAI, BsmFI, BfuAI, BspQI, Bce83I, BcefI, HphI, HpyAV, MboII, PleI, EarI, EciI, MmeI, NmeAIII, SapI, Hin4II, LguI, HgaI, SfaNI, FokI, HgaI, SfaNI, MnlI, at least one in SgeI and FaqI.
5. to the method that DNA target sequence is transformed, it is characterized in that, comprise the following steps:
Need the arbitrary described primer of sequences Design claim 1-4 transforming region according to described target sequence, obtain transformation primer; The sequence of described transformation region comprises the sequence of the upstream 50bp to downstream 50bp of transformation nidus;
Described transformation primer comprises an antisense transformation primer and a justice transformation primer, and described antisense transformation primer can be bonded to the upstream region of described transformation nidus, and described justice transformation primer can be bonded to the downstream area of described transformation nidus;
Utilize the antisense of described transformation primer to transform target sequence described in primer and justice transformation primer pair respectively to increase, obtain amplified production;
Enzyme is carried out to described amplified production and cuts connection, obtain transformation target sequence;
Preferably, described transformation comprises at least one of described target sequence being carried out to the replacement of base, insertion and disappearance;
Wherein,
Preferably, described enzyme is cut to be connected in a reaction system and is carried out;
Preferably, the reaction system that described enzyme cuts connection comprises IIs type restriction enzyme, described IIs type restriction enzyme is selected from AcuI, AlwI, AceIII, BbvII, BveI, BslFI, BsoMAI, Bst71I, BsaI, BspMI, BtgZI, BbsI, BccI, BceAI, BspCNI, BtsCI, BciVI, BmrI, BpmI, BpuEI, BseRI, BsgI, BsrDI, BtsI, BmuI, BsbI, BbvI, BbvI, BsmAI, BsmFI, BsmAI, BsmFI, BfuAI, BspQI, Bce83I, BcefI, HphI, HpyAV, MboII, PleI, EarI, EciI, MmeI, NmeAIII, SapI, Hin4II, LguI, HgaI, SfaNI, FokI, HgaI, SfaNI, MnlI, at least one in SgeI and FaqI.
6. method according to claim 5, is characterized in that: described target sequence is linear DNA sequence dna, and described method specifically comprises, and according to two ends sequences Design two primers of described linear DNA sequence dna, obtains just end points primer and antisense end points primer;
Hold from 5 ' end of described linear DNA sequence dna to 3 ', by described just end points primer, described antisense transformation primer, described justice transformation primer and described antisense end points primer according to the sequence that can be bonded to the position on described linear DNA sequence dna, from described just end points primer, combination of two increases to described linear DNA sequence dna respectively successively, obtains amplified production;
Described enzyme is carried out to described amplified production and cuts connection, obtain the linear DNA sequence dna of transformation.
7. method according to claim 6, is characterized in that: described amplification comprises the first amplified reaction and the second amplified reaction,
Transforming primer with described just end points primer and described antisense is that the first primer pair carries out described first amplified reaction, obtains the first amplified production;
With described justice transformation primer and described antisense end points primer be that the second primer pair carries out described second amplified reaction, obtain the second amplified production;
Described enzyme is carried out to described first amplified production and described second amplified production and cuts connection, obtain the linear DNA molecule of described transformation.
8. method according to claim 5, is characterized in that: described target sequence is the DNA sequence dna of ring-type, and described method specifically comprises,
Adopt circle DNA sequence described in described justice transformation primer and described antisense transformation primer pair to increase respectively, obtain amplified production;
Described enzyme is carried out to described amplified production and cuts connection, obtain the DNA sequence dna of the ring-type of transformation.
9., to the method that multiple linear DNA molecule connects, described method comprises:
Need in n the linear DNA molecule connected, total 2*(n-1) end that individual needs connect, according to the primer described in the described any one of sequences Design claim 1-4 needing the end connected, obtain 2*(n-1) bar connection primer;
Utilize linear DNA molecule described in described connection primer pair to increase respectively, obtain n amplified production;
Enzyme is carried out to a described n amplified production and cuts connection, obtain the connection product of a described n linear order;
Optionally, described enzyme is cut to be connected in a reaction system and is carried out.
10. method according to claim 9, it is characterized in that: described method also comprises, need in n the linear DNA molecule connected, two ends of the described connection product having two to be positioned to connect, according to sense primer and the antisense primer of the sequences Design routine of two ends of described connection product;
Describedly amplification is carried out to described linear DNA molecule comprise, adopt sense primer and the antisense primer of described routine, and described connection primer, respectively a described n linear DNA molecule is increased, obtain a described n amplified production;
In described connection primer, the justice for i-th linear DNA molecule that increase connects primer, is connected primer has complementary cleavage site with the antisense for the i-th-1 linear DNA molecule that increases; Antisense for i the linear DNA molecule that increase connects primer, is connected primer has complementary cleavage site with the justice for the i-th+1 linear DNA molecule that increases; Utilize the cleavage site of described complementation to realize the connection of n amplified production, obtain described connection product, wherein, n-1 >=i >=2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310233803.7A CN104232628A (en) | 2013-06-13 | 2013-06-13 | Primer applied to DNA target sequence reconstruction and reconstruction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310233803.7A CN104232628A (en) | 2013-06-13 | 2013-06-13 | Primer applied to DNA target sequence reconstruction and reconstruction method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104232628A true CN104232628A (en) | 2014-12-24 |
Family
ID=52221526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310233803.7A Pending CN104232628A (en) | 2013-06-13 | 2013-06-13 | Primer applied to DNA target sequence reconstruction and reconstruction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104232628A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018183612A1 (en) * | 2017-03-29 | 2018-10-04 | Editas Medicine, Inc. | Nucleic acid mutagenesis methods |
| CN110603334A (en) * | 2017-06-20 | 2019-12-20 | 深圳华大智造科技有限公司 | PCR primer pair and application thereof |
| CN113005119A (en) * | 2021-03-02 | 2021-06-22 | 通用生物系统（安徽）有限公司 | Gene multi-segment repeated connection cloning method |
| WO2021121391A1 (en) * | 2019-12-19 | 2021-06-24 | 南京金斯瑞生物科技有限公司 | Method for constructing a gene mutation library |
| WO2024067644A1 (en) * | 2022-09-26 | 2024-04-04 | 深圳瑞吉生物科技有限公司 | Method for cell-free preparation of mrna transcription template |
-
2013
- 2013-06-13 CN CN201310233803.7A patent/CN104232628A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| HAISU WAN ET AL.: "A site-directed mutagenesis method particularly useful for creating otherwise difficult-to-make mutants and alanine scanning", 《ANALYTICAL BIOCHEMISTRY》 * |
| JAE-KYUN KO ET AL.: "A rapid and efficient PCR-based mutagenesis method applicable to cell physiology study", 《AM J PHYSIOL CELL PHYSIOL》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018183612A1 (en) * | 2017-03-29 | 2018-10-04 | Editas Medicine, Inc. | Nucleic acid mutagenesis methods |
| CN110603334A (en) * | 2017-06-20 | 2019-12-20 | 深圳华大智造科技有限公司 | PCR primer pair and application thereof |
| CN110603334B (en) * | 2017-06-20 | 2024-01-16 | 深圳华大智造科技股份有限公司 | PCR primer pair and application thereof |
| WO2021121391A1 (en) * | 2019-12-19 | 2021-06-24 | 南京金斯瑞生物科技有限公司 | Method for constructing a gene mutation library |
| CN114829685A (en) * | 2019-12-19 | 2022-07-29 | 南京金斯瑞生物科技有限公司 | Construction method of gene mutation library |
| CN113005119A (en) * | 2021-03-02 | 2021-06-22 | 通用生物系统（安徽）有限公司 | Gene multi-segment repeated connection cloning method |
| WO2024067644A1 (en) * | 2022-09-26 | 2024-04-04 | 深圳瑞吉生物科技有限公司 | Method for cell-free preparation of mrna transcription template |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11964997B2 (en) | Methods of library construction for polynucleotide sequencing | |
| CN104232628A (en) | Primer applied to DNA target sequence reconstruction and reconstruction method | |
| Varshney et al. | A large-scale zebrafish gene knockout resource for the genome-wide study of gene function | |
| US11873480B2 (en) | Contiguity preserving transposition | |
| JP6982087B2 (en) | Building a Next Generation Sequencing (NGS) Library Utilizing Competitive Chain Substitution | |
| CN105121664B (en) | Mixture and its it is compositions related in nucleic acid sequencing approach | |
| JP2019536466A (en) | Compositions and methods for identifying nucleic acid molecules | |
| EP3730628B1 (en) | Polynucleotide adapter design for reduced bias | |
| EP3098324A1 (en) | Compositions and methods for preparing sequencing libraries | |
| JP2001514488A (en) | Methods for analyzing quantitative expression of genes | |
| CN103476950B (en) | To the high throughput analysis on transgenosis border | |
| JP2019503712A (en) | Methods and compositions for nucleic acid assembly | |
| McCooke et al. | The mitochondrial genome of a Texas outbreak strain of the cattle tick, Rhipicephalus (Boophilus) microplus, derived from whole genome sequencing Pacific Biosciences and Illumina reads | |
| JP7079029B2 (en) | Methods, Compositions, and Kits for Preparing Nucleic Acid Libraries | |
| WO2021051665A1 (en) | Enrichment method and system for gene target region | |
| WO2018144159A1 (en) | Capture probes using positive and negative strands for duplex sequencing | |
| Stage et al. | Origin of nascent lineages and the mechanisms used to prime second-strand DNA synthesis in the R1 and R2 retrotransposons of Drosophila | |
| CN101251510B (en) | Method for testing SNP combining restrictive zyme cutting method and mass spectrometry | |
| Pickett et al. | Efficient genome editing using CRISPR‐Cas‐mediated homology directed repair in the ascidian Ciona robusta | |
| CN116083423B (en) | Probe for target enrichment of nucleic acid | |
| CN113366119A (en) | Quantification of exogenous DNA in small blood samples using SNP profiling | |
| CN107083427B (en) | DNA ligase mediated DNA amplification technology | |
| CN109943628A (en) | The method that PGS and methylation analysis are carried out to biopsy cells using DedscRRBS analytic approach | |
| CN103890175B (en) | The method of the cyclized DNA formed by unit molecule is only selected in the cyclisation of DNA molecular | |
| WO2021058145A1 (en) | Phage t7 promoters for boosting in vitro transcription |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20141224 |
|
| RJ01 | Rejection of invention patent application after publication |