CN104232628A - Primer applied to DNA target sequence reconstruction and reconstruction method - Google Patents
Primer applied to DNA target sequence reconstruction and reconstruction method Download PDFInfo
- Publication number
- CN104232628A CN104232628A CN201310233803.7A CN201310233803A CN104232628A CN 104232628 A CN104232628 A CN 104232628A CN 201310233803 A CN201310233803 A CN 201310233803A CN 104232628 A CN104232628 A CN 104232628A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- target sequence
- sense
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000000034 method Methods 0.000 title claims abstract description 39
- 108091008146 restriction endonucleases Proteins 0.000 claims abstract description 73
- 238000003776 cleavage reaction Methods 0.000 claims abstract description 69
- 230000007017 scission Effects 0.000 claims abstract description 69
- 230000000295 complement effect Effects 0.000 claims abstract description 32
- 238000012217 deletion Methods 0.000 claims abstract description 21
- 230000037430 deletion Effects 0.000 claims abstract description 21
- 230000003321 amplification Effects 0.000 claims description 65
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 65
- 230000000692 anti-sense effect Effects 0.000 claims description 53
- 108020004414 DNA Proteins 0.000 claims description 49
- 238000001976 enzyme digestion Methods 0.000 claims description 37
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 36
- 238000012986 modification Methods 0.000 claims description 29
- 230000004048 modification Effects 0.000 claims description 29
- 238000006243 chemical reaction Methods 0.000 claims description 23
- 238000003780 insertion Methods 0.000 claims description 19
- 230000037431 insertion Effects 0.000 claims description 19
- 230000004075 alteration Effects 0.000 claims description 11
- 238000006467 substitution reaction Methods 0.000 claims description 11
- 238000011144 upstream manufacturing Methods 0.000 claims description 11
- 108020004638 Circular DNA Proteins 0.000 claims description 5
- 230000002255 enzymatic effect Effects 0.000 claims description 3
- 102000004190 Enzymes Human genes 0.000 abstract description 23
- 108090000790 Enzymes Proteins 0.000 abstract description 23
- 238000012408 PCR amplification Methods 0.000 abstract description 23
- 238000002741 site-directed mutagenesis Methods 0.000 abstract description 15
- 230000035772 mutation Effects 0.000 abstract description 14
- 239000012634 fragment Substances 0.000 description 40
- 239000013598 vector Substances 0.000 description 13
- 108090000623 proteins and genes Proteins 0.000 description 12
- 125000006850 spacer group Chemical group 0.000 description 12
- 101100263837 Bovine ephemeral fever virus (strain BB7721) beta gene Proteins 0.000 description 10
- 101100316840 Enterobacteria phage P4 Beta gene Proteins 0.000 description 10
- 238000013461 design Methods 0.000 description 10
- 108091081021 Sense strand Proteins 0.000 description 8
- 238000012163 sequencing technique Methods 0.000 description 6
- 241000282414 Homo sapiens Species 0.000 description 5
- 230000001681 protective effect Effects 0.000 description 5
- 102000053602 DNA Human genes 0.000 description 4
- 102000001554 Hemoglobins Human genes 0.000 description 4
- 108010054147 Hemoglobins Proteins 0.000 description 4
- 230000037429 base substitution Effects 0.000 description 4
- 230000029087 digestion Effects 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- 238000002715 modification method Methods 0.000 description 4
- 102000004169 proteins and genes Human genes 0.000 description 4
- 108010042407 Endonucleases Proteins 0.000 description 3
- 102000004533 Endonucleases Human genes 0.000 description 3
- 206010064571 Gene mutation Diseases 0.000 description 3
- 108091034117 Oligonucleotide Proteins 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 241000588724 Escherichia coli Species 0.000 description 2
- 101000702488 Rattus norvegicus High affinity cationic amino acid transporter 1 Proteins 0.000 description 2
- 108010064978 Type II Site-Specific Deoxyribonucleases Proteins 0.000 description 2
- 230000001404 mediated effect Effects 0.000 description 2
- 108020004999 messenger RNA Proteins 0.000 description 2
- 238000002703 mutagenesis Methods 0.000 description 2
- 231100000350 mutagenesis Toxicity 0.000 description 2
- 239000013612 plasmid Substances 0.000 description 2
- 239000013600 plasmid vector Substances 0.000 description 2
- 238000011426 transformation method Methods 0.000 description 2
- 108010076491 BsaI endonuclease Proteins 0.000 description 1
- 230000009946 DNA mutation Effects 0.000 description 1
- 101150076211 TH gene Proteins 0.000 description 1
- 230000009471 action Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 239000013078 crystal Substances 0.000 description 1
- 239000005547 deoxyribonucleotide Substances 0.000 description 1
- 125000002637 deoxyribonucleotide group Chemical group 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000009509 drug development Methods 0.000 description 1
- 238000001415 gene therapy Methods 0.000 description 1
- 238000000338 in vitro Methods 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 229940046166 oligodeoxynucleotide Drugs 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000006916 protein interaction Effects 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 230000010076 replication Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a reconstruction primer applied to connection of DNA target sequences, or substitute, insert or delete one or more bases of the target sequence and a reconstruction method. The 5' end of the primer comprises a recognition site of IIs type restriction endonuclease. The reconstruction method comprises: employing the primer with the 5' end containing the recognition site of IIs type restriction endonuclease to perform PCR amplification on the target sequence, then performing enzyme cleavage and connection on the PCR amplification product, utilizing a complementary cohesive end generated after a designed complementary paired cleavage site is cleaved in order to connect the PCR amplification product, so as to obtain the reconstructed target sequence. The characteristics of IIs type restriction endonuclease are ingeniously applied to site directed mutagenesis, the efficiency is high, the time is short, the cost is low, single point mutation and continuous multipoint mutation can be performed, and also reconstruction such as addition, deletion and the like of enzyme cutting sites can be performed.
Description
Technical Field
The invention relates to the field of gene mutation, in particular to a primer and a method for connecting DNA target sequences or modifying the target sequences by substituting, inserting or deleting one or more bases.
Background
The in vitro site-directed mutagenesis technology is an important experimental means in the research of various fields of biology and medicine at present, can quickly and efficiently improve the character and the representation of target protein expressed by DNA, is an effective means for modifying and optimizing genes, exploring promoter regulatory elements, carrying out vector modification and the like, and is a powerful tool for researching the complex relation between the structure and the function of the protein. The site-directed mutagenesis technology has a wide range of potential applications, such as studying the structure of protein interaction sites, modifying different activities or kinetic properties of enzymes, modifying promoters or DNA acting elements, increasing the antigenicity or stability of proteins, activity, studying the crystal structure of proteins, and in drug development, gene therapy, etc.
The types of site-directed mutagenesis are mainly as follows: one is to use oligonucleotide-mediated gene mutation, which means that an oligonucleotide fragment containing a mutated base is used as a primer to initiate the replication of a DNA molecule by the action of a polymerase. The method needs to synthesize a segment of oligodeoxynucleotide deoxyribonucleotide as a primer, needs a template chain to be circular, and carries out screening after escherichia coli is transformed after amplification. The second is box mutation, which is to replace the corresponding sequence in wild gene with artificially synthesized oligonucleotide segment containing gene mutation sequence. The method needs to synthesize a DNA double-chain short fragment, transform escherichia coli, extract plasmids and the like. Third, PCR mediated mutation.
Restriction enzymes are classified into four major groups according to differences in subunit composition, cleavage site, recognition site, cofactor, and the like. One of the more common type II restriction enzymes is the so-called type IIs enzyme, such as FokI and AlwI, which differ in recognition and cleavage sites and cleave the double strand of DNA beyond the recognition site, which is usually a sticky end.
Disclosure of Invention
The invention provides a primer for modifying a DNA target sequence and a method for connecting the DNA target sequence or substituting, inserting or deleting the DNA target sequence based on the primer. The invention is made by skillfully utilizing the characteristics of the IIs type restriction enzyme, the recognition site and the cutting site of the IIs type restriction enzyme are different, a DNA double strand is cut outside the recognition site, and the cut DNA double strand is a sticky end.
One aspect of the invention discloses a primer for DNA target sequence modification, wherein the 5' end of the primer contains a recognition site of IIs type restriction endonuclease. Preferably, the modification of the invention comprises ligation of the target sequence, or substitution, insertion or deletion of one or more bases of the target sequence. The invention skillfully uses the characteristic that the recognition site and the cutting site of the IIs type restriction endonuclease are not in the same position, and uses the IIs type restriction endonuclease in the modification of substitution, insertion, deletion, connection and the like of a DNA target sequence, because the recognition site is positioned at the upstream of the cutting site, the recognition site can be cut after the enzyme cutting treatment, and the key of the enzyme cutting is only the recognition site, and the sequence of the cutting site can be cut, therefore, the cutting site can be designed randomly according to the requirement; based on the principle, a primer containing a recognition site of the IIs type restriction endonuclease at the 5' end is designed, the cutting site of the primer is a sequence which can be complementarily combined with a target sequence, and after the primer is subjected to enzyme cutting, the recognition site and the base upstream of the cutting site are automatically cut off, and only the sticky end of the cutting site is left. In one implementation mode of the invention, at least two primers with the 5' ends containing recognition sites of IIs type restriction enzymes are adopted to carry out PCR amplification on a target sequence respectively to obtain at least two sections of PCR amplification products, after enzyme digestion, the PCR amplification products are connected by complementary cohesive ends, and as the cutting sites are sequences on the target, except for designing one or more bases to be modified, other bases cannot be introduced into the products connected by enzyme digestion, and the integrity of the target sequence cannot be influenced.
It should be noted that, when one or more base substitutions, insertions or deletions are required for the target sequence, the basic idea of the present invention is to introduce the one or more base substitutions, insertions or deletions into the primer carrying the recognition site of the type IIs restriction enzyme, i.e., to design the modification into the primer, and when the target sequence is amplified by using the primer, the modification is carried in the amplification product, and then the modified target sequence is obtained by ligation. It is also noted that, in general, the sequence of the cleavage site is paired with the target sequence, but if one or more bases of substitution, insertion or deletion are designed in the sequence of the cleavage site, it is understood that the cleavage site need not be completely paired with the target sequence, even if the cleavage site is a base requiring insertion unrelated to the target sequence; however, in order to be able to ligate the target sequences after the respective amplifications, the cohesive ends generated by the cleavage sites are always complementary.
In one embodiment of the invention, the target sequence refers to a double-stranded DNA to be treated, the double-stranded DNA comprising a sense strand and an antisense strand; the sense strand is a single strand of DNA identical to the mRNA sequence produced by transcription, which is used to characterize the target sequence; the 5 'end of the sense strand is defined as upstream and the 3' end of the sense strand as downstream.
In one embodiment of the invention, the sense primer, the sense end point primer, the sense alteration primer and the sense ligation primer refer to primers that are identical or partially identical to the sequence of the sense strand and can be used to amplify the sequence of the sense strand or a portion of the sense strand; antisense primers, antisense endpoint primers, antisense engineered primers, and antisense ligated primers are primers that are complementary or partially complementary to the sense strand and can be used to amplify the sequence of the antisense strand or a portion of the antisense strand.
In one embodiment of the invention, the primer containing a recognition site for a type IIs restriction enzyme at the 5' end has the general sequence:
5’-（N）x-E1-（N）y-E2-E3-3’；
wherein N represents A, G, C, T, x represents having x arbitrary bases, and y represents having y arbitrary bases; the E1 area is the recognition site sequence of type IIs restriction enzyme; e2The region is the sequence of the cleavage site of the type IIs restriction enzyme, E2Of a regionThe sequence is capable of binding complementarily to the target sequence; e3A region is a sequence that binds complementary to a target sequence.
In general, E is2The region, i.e., the cleavage site sequence, is a sequence capable of complementary pairing with the target sequence, including the case of being capable of complete complementary pairing and partial complementary pairing, and when the target sequence is modified by substitution, insertion or deletion of one or more bases, and the substitution, insertion or deletion of one or more bases is designed exactly at the cleavage site, the sequence of the cleavage site is not necessarily completely paired with the target sequence, or is merely an inserted sequence unrelated to the target sequence. Furthermore, it will be understood that in the ligation of the target sequence, it is only necessary to introduce a recognition site for a type IIs restriction enzyme, E, at the 5' end of the primer for amplifying the sequence to be ligated2The region is a sequence matched with the target sequence, and a cutting site E is formed when a PCR amplification product is subjected to enzyme digestion treatment2Sequences preceding the region, i.e., "(N)x-E1-（N）y"are excised and the target sequences are ligated by splicing through the cohesive ends of the complementary cleavage sites. It is also noted that, when the target sequence is modified by substitution, insertion or deletion of one or more bases, the one or more bases of the substitution, insertion or deletion are designed for E2Region and/or E3Of a region.
In one embodiment of the present invention, E3The region consists of 18-30 bases, x represents the number of protected bases, and x is more than or equal to 6 and more than or equal to 2; y represents the number of spacer bases between the recognition site and the cleavage site of the IIs type restriction enzyme, and usually 4. gtoreq.y.gtoreq.1. The protective base before the cleavage site is intended to ensure the effect of the cleavage, and the number of the protective base is generally 1 to 10, preferably 2 to 6. Furthermore, for most type IIs restriction enzymes, the recognition site and cleavage site are not co-located, and thus there may be several bases between the recognition site and the cleavage site downstream thereof, as described in one embodiment of the inventionA spacer sequence, the base type of which is not limited; for some type IIs restriction enzymes, the recognition and cleavage sites may also be without spacer bases, and thus the specific number of spacer sequences or spacer bases is not a limitation of the present invention. In one embodiment of the invention, the IIs type restriction enzyme is BsaI, has 3bp of protective bases before the recognition site of BsaI, and has 1bp of spacer bases between the recognition site and the cleavage site of BsaI; or the IIs type restriction enzyme is BbsI, a protective base of 3bp is arranged in front of the recognition site of the BbsI, and a spacing base of 2bp is arranged between the recognition site and the cutting site of the BbsI.
Further, in one embodiment of the invention, the type IIs restriction enzyme is selected from at least one of AcuI, AlwI, AceIII, BbvII, BveI, BslFI, BsoMAI, Bst71I, BsaI, BspMI, BtgZI, BbsI, BcccI, BceAI, BspCI, BtsCI, BciVI, BmrI, BpuEI, BseRI, BsgI, BsrDI, BtsrDI, BtsI, BmuI, Bbsbi, BbvI, BsmmI, BsmBsmI, BsmFI, BfuAI, BspQI, Bce83I, BbeFI, HphI, HpylII, HpoI, EarI, EciI, MeI, NmeII, AIpI, SapiI, Hin, SgaI, SfaI, SfalI, BqvI, BspI, BsmI, BspI, BspII, BspI, BsmII, BsmI, BsmII, BspII. It is to be understood that any enzyme that has a recognition site that is not identical to the cleavage site and that generates a sticky end after cleavage may be used in the practice of one embodiment of the present invention, and therefore, the enzymes that can be used are not limited to these lists.
The invention also discloses a method for modifying a DNA target sequence, which comprises the steps of designing a primer of the invention according to the sequence of a region where the target sequence needs to be modified, namely a modified primer; the sequence of the region where the modification is located comprises a sequence from the upstream 50bp to the downstream 50bp of the modification; the modified primers comprise an antisense modified primer and a sense modified primer, wherein the antisense modified primer can be combined to the upstream region of the modified place, namely the upstream 50bp sequence of the modified place, and the sense modified primer can be combined to the downstream region of the modified place, namely the downstream 50bp sequence of the modified place; amplifying the target sequence by respectively using the antisense primer and the sense primer of the modified primer to obtain an amplification product; and carrying out enzyme digestion connection on the amplified product to obtain a modified target sequence. Preferably, the enzymatic ligation is carried out in the same reaction system. Preferably, the alteration of the present invention comprises at least one of a substitution, insertion and deletion of a base for the target sequence. According to the embodiment of the invention, on one hand, the DNA target sequence modification method is based on primer design, and can be understood that after a primer of which the 5' end contains a recognition site of the IIs type restriction enzyme is adopted to amplify the target sequence, a product of which the tail end is provided with the recognition site of the IIs type restriction enzyme can be amplified, and the products of which the tail ends are provided with complementary cohesive tail ends can be connected through enzyme digestion and connection, so that the connection modification of the target sequence is realized. Therefore, by utilizing the transformation method, the DNA sequence with substitution, insertion or deletion of one or more bases can be obtained within 8h only by carrying out enzyme digestion and ligation reaction once, and the efficiency can reach 100%. Because the recognition site and the cutting site of the IIs type restriction endonuclease are at different positions, the introduced base except for the designed modification can be effectively cut off, and the integrity of the modified target sequence is ensured. It will also be appreciated that where one or more base substitutions, insertions or deletions are desired in the target sequence, the modification may be effected by introducing such one or more base substitutions, insertions or deletions into a primer which comprises a recognition site for a type IIs restriction enzyme at the 5' end. The transformation method is not limited by a base sequence and a target sequence enzyme cutting site, not only can be used for accurately carrying out single-point mutation, continuous multi-point mutation and multi-point mutation of different parts, but also can be used for carrying out transformation on the enzyme cutting site on a carrier, such as enzyme cutting site addition, deletion and the like, and the method has the advantages of short time, high efficiency and low cost. It should be noted that, according to an embodiment of the present invention, in the antisense modified primer and the sense modified primer designed according to the sequence of the region where the target sequence needs to be modified, the position where the antisense modified primer can bind to the target sequence is located upstream of the position where the sense modified primer can bind, PCR is generally performed by performing exponential amplification of double-stranded DNA using a pair of primers consisting of the sense primer and the antisense primer, and the antisense modified primer and the sense modified primer designed according to the sequence of the region where the target sequence needs to be modified cannot be combined to amplify exponentially-increased double-stranded target sequences. In one embodiment of the invention, the "one antisense primer" is used in combination with the sense primer upstream thereof for amplification, and the "one sense primer" is used in combination with the antisense primer downstream thereof for amplification, depending on the upstream and downstream of the position where the primers bind to the target, thereby completing the respective amplification of different portions of the target sequence.
It should be further noted that, because the complete target sequence with modification is obtained by digestion and ligation after amplification, the designed antisense modified primer and sense modified primer have closely adjacent sequences except the designed modified part of the binding site on the target, i.e. there is no base gap in the middle, and when the modification of the inserted base is not the cleavage site itself, the cleavage sites of the antisense modified primer and the sense modified primer bind to the same region of the target; it will be appreciated that where the alteration is one in which one or more bases are deleted, the antisense and sense altered primers are designed such that the target sequence is complementarily paired with it with one or more bases spaced apart in the region between the two regions, i.e. the portion intended to be deleted; in any case, after the target is amplified by using the antisense modified primer and the sense modified primer designed by the sequence of the region where the target sequence needs to be modified, the amplification product is cut by a specific enzyme to generate a complementary sticky end.
According to a specific embodiment of the present invention, the specific method for modifying a linear target sequence comprises designing two primers, namely a sense end primer and an antisense end primer, according to sequences at two ends of the linear target sequence; from the 5 'end to the 3' end of the linear DNA sequence, respectively amplifying the linear DNA sequence by combining a sense endpoint primer, an antisense modified primer, a sense modified primer and an antisense endpoint primer in sequence two by two from the sense endpoint primer according to the sequence of the positions capable of being combined on the linear DNA sequence to obtain an amplification product; and carrying out enzyme digestion connection on the amplified product to obtain a modified linear DNA sequence. The sequential pairwise combination means that, starting from a sense endpoint primer, a sense primer and the nearest antisense primer located at the downstream of the sense primer are pairwise combined to amplify a linear DNA sequence.
It should be noted that, according to a specific embodiment of the present invention, the iis-type restriction enzyme recognition sites at the 5' ends of the antisense modified primer and the sense modified primer may be the same or different, and when the iis-type restriction enzyme recognition sites are the same, the iis-type restriction enzyme corresponding to the recognition sites is used for enzyme digestion; when the IIs type restriction enzyme recognition sites are different, carrying out double enzyme digestion by adopting IIs type restriction enzymes corresponding to the two recognition sites. During the ligation process after the cleavage, the key to be able to ligate the amplification products is the sticky end of the cleavage site, which is separate from the recognition site, so that the cleavage sites are complementary regardless of whether they are identical or not.
It should be noted that, according to a specific embodiment of the present invention, the normal sense end point primer and the antisense end point primer are primers designed according to the conventional primer design method, and it can be understood that, in some specific requirements, the sense end point primer and the antisense end point primer can also be designed specifically; for example, a restriction site is also designed in the sense-end primer and the antisense-end primer.
In one implementation of the invention, amplification of a linear DNA sequence comprises a first amplification reaction and a second amplification reaction, the first amplification reaction is performed with a sense endpoint primer and an antisense engineering primer as a first primer pair to obtain a first amplification product; carrying out a second amplification reaction by taking the sense modification primer and the antisense endpoint primer as a second primer pair to obtain a second amplification product; and carrying out enzyme digestion connection on the first amplification product and the second amplification product to obtain a modified linear DNA sequence.
It should be noted that, in an embodiment of the present invention, the sense end point primer and the antisense end point primer refer to primers matched with two end points of the target sequence, and the two primers can be combined to amplify a complete target sequence, and if the target sequence is an altered target sequence, the two primers can be used to amplify the complete altered target sequence.
In another embodiment of the present invention, the specific method for modifying the circular target sequence comprises amplifying the circular DNA sequence with a sense modified primer and an antisense modified primer, respectively, to obtain an amplification product; and carrying out enzyme digestion and connection on the amplified product to obtain a modified circular DNA sequence. Similarly, the type IIs restriction enzyme recognition sites at the 5' ends of the two primers may be the same or different, but in any case the cleavage sites are always complementary.
The invention also discloses a method for connecting a plurality of linear DNA sequences, which comprises the steps of, in the n linear DNA sequences to be connected, totally 2 x (n-1) terminals to be connected, designing primers according to the sequences of the terminals to be connected, and obtaining 2 x (n-1) connecting primers; amplifying the linear DNA sequences by using connecting primers respectively to obtain n amplification products; performing enzyme digestion connection on the n amplification products to obtain connection products of n linear sequences; optionally, the enzymatic ligation is performed in one reaction system. The 5' ends of the connecting primers are provided with IIs type restriction endonuclease recognition sites which can be the same or different, for example, as the recognition sites and the cutting sites are separated, the directional connection can be realized as long as the cohesive ends generated at the two ends of the amplification product for connecting target sequences are different after the amplification product is subjected to enzyme digestion, and even if the same recognition sites are adopted, the same enzyme can be used for enzyme digestion. In one embodiment of the present invention, the cleavage and ligation are performed in a single reaction system. Therefore, completely identical enzyme digestion recognition sites are introduced into a plurality of target sequences, and the targeted connection of a plurality of targets can be orderly realized by only adopting one enzyme digestion connection reaction. Therefore, by using the connection method, the connection products of a plurality of sequences can be obtained within 8h only by carrying out enzyme digestion connection reaction once, and the efficiency can reach 100%.
In one embodiment of the present invention, the method for ligating a plurality of target sequences further comprises, among the n linear DNA sequences to be ligated, two of which are located at the ends of the ligated ligation products, and designing a conventional sense primer and antisense primer based on the sequences of the two ends of the ligation products; amplifying the linear DNA sequences comprises respectively amplifying n linear DNA sequences by adopting n primer pairs formed by combining a conventional sense primer, an antisense primer and a connecting primer to obtain n amplification products; among the ligation primers, a sense ligation primer for amplifying the ith linear DNA sequence has a complementary cleavage site with an antisense ligation primer for amplifying the (i-1) th linear DNA sequence; an antisense junction primer for amplifying the i linear DNA sequences, having a complementary cleavage site to a sense junction primer for amplifying the (i + 1) th linear DNA sequence; and (3) realizing the connection of n amplification products by utilizing complementary cutting sites to obtain the connection products, wherein n-1 is more than or equal to i and more than or equal to 2.
In the specific embodiment of the invention, the modification site is arranged in the primer, so the modification site can be designed according to the requirement and is not limited by the restriction of the enzyme cutting site; in order to ensure that enzyme digestion acts on a preset modification region, a target sequence containing a type IIs restriction enzyme recognition site cannot be directly selected when the type IIs restriction enzyme is selected, and if a certain type IIs restriction enzyme is selected and used and the target carries the enzyme recognition site, another type IIs restriction enzyme can be selected to modify the target. The enzyme used for the cleavage is an endonuclease having a type IIs restriction enzyme cleavage site in the primer, and the method and conditions for the cleavage and ligation may be any conventional method and conditions. In one embodiment of the present invention, the cleavage and ligation are performed in the same reaction system. Thus, the reaction step can be reduced to reduce the operation time.
The method for modifying a DNA target sequence according to one aspect of the present invention includes specific modification of different types of target sequences with different propertiesHowever, the 5 'ends of the modified primers used contained the recognition site for the type IIs restriction enzyme and all had the general sequence, 5' - (N)x-E1-（N）y-E2-E3-3'; wherein N represents A, G, C, T, x represents having x arbitrary bases, and y represents having y arbitrary bases; e1The region is the recognition site sequence of IIs type restriction endonuclease; e2The region is the sequence of the cutting site of the IIs type restriction endonuclease; e3A region is a sequence that is capable of binding complementarily to a target sequence.
In addition, in the embodiment of the present invention, in the primer used in the target sequence modification method, E is3The region consists of 18-30 bases, x represents the number of protected bases, and x is more than or equal to 6 and more than or equal to 2; y represents the number of spaced bases between the recognition site and the cutting site of the IIs type restriction endonuclease; the type IIs restriction enzyme is selected from at least one of AcuI, AlwI, AceIII, BbvII, BveI, BslFI, BsoMAI, Bst71I, BsaI, BspMI, BtgZI, BbsI, BccI, BceAI, BspCI, BciVI, BmrI, BpmI, BpuEI, BseRI, BsgI, BsrDI, BtmI, BsbI, BbvI, mBspI, BsmFI, BsmmFI, BfuAI, BspQI, Bce83I, Bcoefi, HphI, HpyAV, MboII, EarI, Mqii, NmeII, NmepI, LguNI 4II, LguI, HgaI, SkgAI, SgaI, Fokfai, SgaI, Foqfai, SgaI, SqfaI, and SqfaI.
In another aspect, the invention also provides a kit containing the primer. The kit comprises a primer with a recognition site of the IIs type restriction endonuclease, and can be used for modifying a DNA target sequence. The different primers can be placed in different containers in a liquid or solid manner, and the kit can further comprise a reaction solution system.
Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
FIG. 1: is a schematic design diagram of a modified primer in the embodiment of the invention;
FIG. 2: is a primer design schematic diagram of the directional seamless connection of the DNA fragments in the embodiment of the invention.
Detailed Description
The modification methods and primers of DNA mutation and the like skillfully utilize the characteristic that the recognition site and the enzyme cutting site of the IIs type restriction enzyme are not in the same position, and the IIs type restriction enzyme suitable for the target sequence is selected, and the target sequence does not contain the enzyme recognition sequence; designing recognition sites with IIs type restriction endonuclease about positions needing site-directed mutagenesis, designing two primers with complementary cutting sites, designing modified bases such as mutagenesis and the like in the primers, amplifying target sequences through the primers respectively, then connecting the target sequences by utilizing the characteristic that the IIs type restriction endonuclease can cut off the added recognition sites after enzyme digestion connection treatment, and obtaining the complete target sequence with modification.
In one embodiment of the present invention, a single-point or multi-point site-directed mutagenesis is performed at a more concentrated position of the linear target sequence, and therefore, an antisense modified primer matching with the 5 'end primer of the linear target sequence and a sense modified primer matching with the 3' end primer of the target sequence are designed at the position where site-directed mutagenesis is required, and the cleavage sites in the antisense modified primer and the sense modified primer are complementary sequences in the target sequence, i.e., the cleavage sites of the antisense primer and the sense primer are overlapped in the binding site shown on the target sequence, so that complementary sticky ends can be generated after the PCR product is enzymatically cleaved, thereby linking the fragments together, and the sticky ends themselves are complementary sequences in the target sequence, thereby, no extra additional bases are generated. It can be understood that if multiple scattered different sites in the target sequence need to be subjected to site-directed mutagenesis, similarly, only a pair of antisense modified primer and sense modified primer needs to be designed for the scattered sites respectively, a predetermined mutation base is designed in the primer with the IIs type restriction enzyme recognition site by using the principle of DNA fragment connection, then the primers are paired, the target sequence is amplified, the amplified product is subjected to enzyme digestion and connection, and the amplified products of all sections are connected.
It should be noted that, the application of the characteristics of the IIs type restriction enzyme to the site-directed mutagenesis of DNA, the modification of DNA fragment ligation and the like is one of the inventions of the present invention; the DNA target sequence modification methods such as DNA site-directed mutagenesis of the invention not only provide a new idea and skill for site-directed mutagenesis of DNA, but also improve the mutagenesis time, efficiency and cost.
In addition, the primers can be used for site-directed mutagenesis of DNA, deletion of DNA fragments, insertion of small DNA fragments, connection of DNA fragments and the like by utilizing the characteristic that the recognition site and the cutting site of the IIs type restriction endonuclease are not in the same position. It can be understood that in the primer of the recognition site of the IIs type restriction endonuclease, the mutant base is designed for the sequence part matched with the target sequence, and then the site-directed mutant sequence can be obtained by amplification and enzyme digestion connection; for fragment deletion, selectively carrying out segmented amplification on fragments in a target sequence during amplification, and then connecting the segments to realize deletion of DNA fragments; the small DNA fragment can be inserted into a primer with a recognition site of IIs type restriction endonuclease, an inserted sequence is designed in a cutting site or a primer sequence behind the cutting site behind the recognition site, and then a target sequence containing the inserted fragment can be obtained after amplification and enzyme digestion connection. It can be understood that the insertion of the large DNA fragment can be realized by adopting the same principle of connection with the DNA fragment, for example, only inserting a large DNA fragment sequence into a target sequence, the target sequence is amplified in two sections, namely front section and back section, respectively, at the position where the large DNA fragment is required to be inserted, and simultaneously the large DNA fragment is required to be inserted, different IIs type restriction endonuclease cleavage sites are designed in the amplification primers at the two ends of the large DNA fragment to be inserted, the IIs type restriction endonuclease cleavage sites are correspondingly introduced into the primers for amplifying the target sequence in sections, namely the IIs type restriction endonuclease cleavage site of the primer at the 5 'end of the inserted fragment is complementary with the IIs type restriction endonuclease cleavage site of the antisense primer of the front section of the amplification target gene, and the IIs type restriction endonuclease cleavage site of the primer at the 3' end of the inserted fragment is complementary with the IIs type restriction endonuclease cleavage site of the sense primer of the back section of the amplification target gene Point complementation; and finally, carrying out enzyme digestion connection on the amplified product, namely connecting three sections of sequences together, thereby obtaining the target sequence inserted with the DNA large fragment. Wherein, the endonuclease recognition sites of the primers can be the same or different.
In view of the characteristics of amplification of the linear target sequence and the circular target sequence, the present invention proposes methods for modifying the linear target sequence and the circular target sequence, respectively.
In addition, the invention also provides a method for connecting a plurality of linear DNA sequences based on IIs type restriction enzymes. Respectively designing primers for different DNA fragments to carry out PCR amplification, designing a recognition site of a IIs type restriction enzyme at the 5' end of the primer, designing a complementary cutting site, deleting the cutting site after enzyme cutting, and connecting the DNA fragments by the complementary cutting site; and the complementary cutting sites can be sequences at the 5 'end or the 3' end of the DNA fragments to be connected, so that other sequences cannot be introduced into the connected DNA fragments after enzyme digestion, thereby realizing seamless connection.
The present invention will be described in further detail below with reference to specific embodiments and with reference to the accompanying drawings. The following examples are merely illustrative of the present invention and should not be construed as limiting thereof.
Example one technical solution
The base mutation of the DNA fragment using the IIs restriction enzyme, in this example, the primer design is shown in FIG. 1, and the method for mutating A in the original sequence to T base is as follows:
1. selecting appropriate type II restriction enzyme
And (3) carrying out enzyme cutting site analysis on the target sequence, and selecting the type II restriction enzymes which are not contained in the target sequence, wherein BsaI is taken as an example in the example. The recognition and cleavage sites for BsaI are as follows:
2. PCR primer design
The primers were designed as follows: f1 and R2 use both ends of the target sequence as binding sites, and conventional PCR primers are designed. Selecting 4 bases N before the mutant base A according to the number of sticky end bases of the BsaI cutting site1N2N3N4As the core cleavage and cohesive end binding site of BsaI endonuclease, i.e., cleavage site; the cleavage site is preceded by the recognition site of the endonuclease. In principle, the primer sequences after N1 are all sequences that match the target sequence and are derived from N1The mutant base can then be set.
The F2 primer was designed as follows: 5' -NNN + GGTCTC + N0+N1N2N3N4+T+N11N12N13N14....-3’
The R1 primer was designed as follows: 5' -NNN + GGTCTC + N0+N8N7N6N5…NNNN…-3’
Wherein N represents any base group, and "GGTCTC" is a recognition site of BsaIThree N before the recognition site are protective bases, N0For the spacer sequence or spacer base between the recognition site and the cleavage site directly, ` N `1N2N3N4"and" N8N7N6N5"all are cleavage sites, i.e.cohesive ends which arise after cleavage, and" N1N2N3N4"and" N8N7N6N5"complementary. F2 primer from N1Followed by a sequence matching the target sequence, the mutated base being located at N1In the following bases; in the R1 primer, from N8Followed by a sequence matching the target sequence, the mutated base being located at N8In the following bases.
The target sequence was PCR amplified using primers F1 and R1, F2 and R2, respectively. And carrying out enzyme digestion and connection on the obtained two PCR amplification products by BsaI to obtain a complete target sequence with mutant bases. The PCR amplification system may be based on conventional PCR amplification. The enzyme digestion and connection system of the amplification product is as follows:
sterilized water was added until 20. mu.l was obtained.
Reaction conditions are as follows: first 10 cycles were performed: 5min at 37 ℃ and 10min at 16 ℃; after the circulation is finished, the reaction is finished at 50 ℃ for 5min and 80 ℃ for 5 min; after the reaction was completed, the temperature was kept constant at 12 ℃.
Taking 2 mu l of enzyme digestion ligation reaction liquid as a template, carrying out PCR amplification by using primers F1 and R2, and then carrying out sequencing verification on an amplification product.
Example two Homo sapiens hepatoglobins, beta (HBB), mRNA cds mutations
Single, single base mutation
The experiment adopts the technical scheme of the first embodiment to mutate the wisdom human hemoglobin beta gene, and the wisdom human hemoglobin beta gene is shown as Seq ID No. 1; specifically, the 202 nd base "G" of the gene is mutated to "C".
The target sequence of this experiment did not contain the BsaI recognition site "GGTCTC" as analyzed by DNAMAN software, and therefore, the enzyme could be used. The principle of primer design is the same as in the first example, and the design of primers is shown in table 1:
TABLE 1 homo sapiens hemoglobin beta Gene site-directed mutagenesis primers
Note: in Table 1, N represents an arbitrary base, and the second underlined "C" base in the primer HSH-F2, i.e., a mutant base, in this example, N is G
The primers HSH-F1 and HSH-R1, HSH-F2 and HSH-R2 are respectively adopted to amplify beta gene, and the amplification system and conditions are the same as those in the first example. Then, the amplified product is subjected to enzyme digestion and ligation by using the same system and conditions as in the first example, so as to obtain a beta gene with a mutant base.
Finally, performing PCR amplification on the beta gene with the mutant base, namely a connecting product, by adopting HSH-F1 and HSH-R2, wherein the amplification system and conditions adopt a conventional PCR amplification system and conditions; and then sequencing and verifying the amplification product. As a result of sequencing, the 202 nd base "G" of beta gene was mutated to "C" as shown in Seq ID No.6, and the rest was unchanged. It can be seen that the primer and site-directed mutagenesis methods work well.
Double or multiple base mutation
Mutating 202 nd gene "G", 206 th and 207 th genes "TC" and 211 th gene "G" of wisdom human hemoglobin beta gene; specifically, the 202 nd "G" is mutated to "C", the 206 nd and 207 th "TC" is mutated to "AA", and the 211 th "G" is mutated to "A".
The specific method and steps are the same as the single point mutation of mutating the 202 nd gene 'G' into 'C'; only, primer HSH-F2' was used in place of primer HSH-F2 in Table 1, the remainder being unchanged. The sequence of the HSH-F2' primer is shown in Seq ID No. 7:
Seq ID No.7：5’-NNNGGTCTC GGAAACTGCAAGGTACCTTTAGTG-3’
in the primer of the sequence shown in Seq ID No.7, N represents an arbitrary base "GGTCTC"is a restriction enzyme recognition site"C”“AA"and"A"i.e., a mutated base.
The procedure is identical to single point mutation except for partial replacement of the primers.
Finally, performing PCR amplification on the beta gene with the mutant base by adopting HSH-F1 and HSH-R2, wherein the amplification system and conditions adopt a conventional PCR amplification system and conditions; and then sequencing and verifying the amplification product. As a result of sequencing, as shown in Seq ID No.8, the base "G" at position 202 of beta gene was mutated to "C", the "TC" at positions 206 and 207 was mutated to "AA", the "G" at position 211 was mutated to "A", and the rest was unchanged. Therefore, the primer and the site-directed mutagenesis method in the experiment have good effects.
EXAMPLES deletion of the Tricycloid cleavage site
In this example, the conventionally used puc18 vector was used for the test, and specifically, the EcoRI recognition site of the puc18 vector was deleted. The IIs restriction enzyme used in this example was BbsI, whose recognition and cleavage sites are as follows:
the sequences around the EcoRI site to be excised are as follows:
GACTCTAGAGGATCCCCGGGTACCGAGCTC GAATTC GTAATCATGGTCATAGCTGTTTCC
CTGAGATCTCCTAGGGGCCCATGGCT CGAG CTTAAG CATTAGTACCAGTATCGACAAAGG
wherein "GAATTC"is the site to be deleted, and is adopted according to the characteristics of BbsI enzyme digestion when designing the primer"AGCTC"is the cleavage site and the cohesive end after cleavage. The primers were designed as follows:
3F: 5- -NNN (protecting base) + GAAGAC (Bbs I recognition sequence) + NN (spacer) + GCTC (cleavage site) + GTAATCATGGTCATAGCTGT- -3
3R: 5- -NNN (protecting base) + GAAGAC (Bbs I recognition sequence) + NN (spacer) + GAGC (cleavage site) + TCGGTACCCGGGGATC- -3
TABLE 2 primers for EcoRI recognition site deletion of the puc18 vector
Note: in Table 2, N represents an arbitrary base, and in this example N is G
Performing PCR amplification by taking a puc18 vector as a template and F and R as primers respectively, and performing enzyme digestion and connection treatment after the amplification is finished; PCR amplification adopts a conventional PCR amplification system and conditions; the digestion, ligation system and conditions were the same as in example one. After the completion of the treatment, the puc18 vector deleted of the EcoRI site was sequenced in the same manner as the general puc18 vector, and the result showed that the EcoRI site was deleted in the puc18 vector of this example and the others were not changed. As can be seen, the methods and primers of the present example are effective in deleting a designated fragment of a target sequence.
Example insertion of cleavage sites in a Tetracircular plasmid
In this example, the product of example three is used as a template, and an ecorv cleavage site is inserted into a place where an ecorv site is originally deleted (the inserted cleavage site may be a cleavage site already contained in the original vector), specifically, the ecorv cleavage site is inserted into an X blank of the following sequence:
GACTCTAGAGGATCCCCGGGTACCGAGCTC X GAATTCGTAATCATGGTCATAGCTGTTTCC
CTGAGATCTCCTAGGGGCCCATGGCT CGAG X CTTAAGCATTAGTACCAGTATCGACAAAGG
where "X" represents a blank, i.e., a contiguous sequence that is not present in the original sequence, and "X" is for convenience of description only. In this example, the BbsI enzyme was also used to insert the cleavage site, and the primers were designed as follows:
4F: 5- -NNN (protecting base) + GAAGAC (Bbs I recognition as point) + NN (spacer sequence) + GCTC (cleavage and ligation site) + GATATC (EcoR V site) + GAATTCGTAATCATGGTCATA- -3
4R: 5- -NNN (protecting base) + GAAGAC (Bbs I recognition as point) + NN (spacer sequence) + GAGC (cleavage and ligation site) + TCGGTACCCGGGAT- -3
TABLE 3 primers for EcoRV recognition site insertion
Note: in Table 3, N represents an arbitrary base, in this case N is G, and in 4F, the sequence in which the underlined italic portion is inserted
Taking the puc18 vector deleted with the EcoRI site in the third embodiment as a template, respectively taking F and R as primers to perform PCR amplification, and performing enzyme digestion and connection treatment after the amplification is completed; PCR amplification adopts a conventional PCR amplification system and conditions; the digestion, ligation system and conditions were the same as in example one. After the treatment, the puc18 vector is sequenced by the same method as the general puc18 vector, and the result shows that in the puc18 vector of the present example, an EcoR v site is added to the place where the EcoRI site is originally deleted, that is, a "gatac" fragment is newly added, and the rest is unchanged. As can be seen, the methods and primers of the present example are effective in increasing the amount of the designated fragment in the target sequence.
EXAMPLE V seamless ligation of multiple fragments based on IIs restriction endonuclease
This example connects three segments shown as Seq ID No.13, Seq ID No.14 and Seq ID No. 15. The schematic structure of the primer design is shown in FIG. 2, in which three fragments (1), (2) and (3) are seamlessly ligated together, and in which (1), (2) and (3) represent the sequences shown in Seq ID No.13, Seq ID No.14 and Seq ID No.15, respectively.
In this example, the three fragments were targeted for seamless ligation using IIs restriction enzymes BbsI and BsaI that were not present in the sequence of the three fragments. Primers with BbsI and BsaI recognition sites are respectively designed at two ends of the middle section of sequence (2), the structural schematic diagram is shown in figure 2, and the primers are specifically as follows:
TABLE 4 primers for seamless directed ligation
Note: n in Table 4 represents an arbitrary base, and in this case, N in 5R1 and 5F2 is G, and N in 5R2 and 5F3 is T
In this example, the three fragments shown in Seq ID No.13, Seq ID No.14 and Seq ID No.15 were actually selected from sequences of puc18 plasmid vector, so that, using puc18 plasmid vector as a template, PCR amplification was performed on the template using primer sets 5F1-5R1, 5F2-5R2 and 5F2-5R2, respectively, to obtain three fragments, the three fragments were subjected to double digestion with BbsI and BsaI, and then ligated to obtain sequences in which the three fragments were oriented to be seamlessly ligated, and the sequencing result is shown in Seq ID No.22, which revealed that the three fragments were ligated together as expected without any intervening bases or sequences.
The foregoing is a more detailed description of the present invention that is presented in conjunction with specific embodiments, and the practice of the invention is not to be considered limited to those descriptions. For those skilled in the art to which the invention pertains, several simple deductions or substitutions can be made without departing from the spirit of the invention, and all shall be considered as belonging to the protection scope of the invention.
Claims (10)
1. A primer for DNA target sequence engineering, characterized by: the 5' end of the primer contains a recognition site of the IIs type restriction enzyme.
2. The primer according to claim 1, characterized in that: the primers have the general sequence: 5' - (N)x-E1-（N）y-E2-E3-3’；
Wherein N represents any base in A, G, C, T, x and y are natural numbers, and x and y represent the number of bases;
E1a base comprising a recognition site for said type IIs restriction enzyme;
E2a base comprising a cleavage site for said type IIs restriction enzyme;
E3comprising a base that is capable of complementary pairing with the target sequence.
3. The primer according to claim 2, characterized in that: e of the general sequence of the primer3The part consists of 18 to 30 bases,
preferably, the primer is of the general sequence (N)xPart of the sequence represents a protected base, and x is more than or equal to 6 and more than or equal to 2;
preferably, the primer is of the general sequence (N)yAnd the part shows the interval base between the recognition site and the cutting site of the IIs type restriction enzyme.
4. The primer according to claim 2, characterized in that: the type IIs restriction enzyme is selected from at least one of AcuI, AlwI, AceIII, BbvII, BveI, BslFI, BsoMAI, Bst71I, BsaI, BspMI, BtgZI, BbsI, BccI, BceAI, BspCI, BciVI, BmrI, BpmI, BpuEI, BseRI, BsgI, BsrDI, BtmI, BsbI, BbvI, BsmmI, BsmmFI, BsmFI, BfuAI, BspQI, Bce83I, Bcoefi, HphI, HpyAV, MboII, eI, EarI, EciI, MmeI, NmeAIII, pINI, LguNI 4II, LguI, SagaI, SkgAI, SgaI, SqfaI, FolfaI, and FalfaI.
5. A method of modifying a DNA target sequence, comprising the steps of:
designing the primer of any one of claims 1-4 according to the sequence of the region of the target sequence to be modified to obtain a modified primer; the sequence of the region where the modification is located comprises a sequence from 50bp upstream to 50bp downstream of the site where the modification is to occur;
the alteration primers comprise an antisense alteration primer and a sense alteration primer, the antisense alteration primer can be combined with an upstream region of the alteration occurrence, and the sense alteration primer can be combined with a downstream region of the alteration occurrence;
amplifying the target sequence by respectively using the antisense modified primer and the sense modified primer of the modified primer to obtain an amplification product;
carrying out enzyme digestion connection on the amplification product to obtain a modified target sequence;
preferably, the alteration comprises at least one of a substitution, insertion and deletion of a base for the target sequence;
wherein,
preferably, the enzyme digestion is carried out in a reaction system;
preferably, the enzymatically ligated reaction system comprises a type IIs restriction enzyme selected from at least one of AcuI, AlwI, AceIII, BbvII, BveI, BslFI, BsoMAI, Bst71I, BsaI, BspMI, BtgZI, BbsI, BccI, BceAI, BspCI, BbciVI, BmrI, BpmI, BpuEI, BseRI, BsgI, BsrDI, BstsI, BmuI, BsbbI, BbvI, BsmFI, BfuAI, BspQI, Bce83I, BbeFI, HpyeI, HpyoII, PlyI, PlNI, EciI, MemI, NmeII, SapiI, Hin, SgaI, SfaI, SqgaI, SgaI, SfaI, SqyI, SgaI, BspII, BspI, BspII, Bsp.
6. The method of claim 5, wherein: the target sequence is a linear DNA sequence, and the method specifically comprises the steps of designing two primers according to sequences at two ends of the linear DNA sequence to obtain a sense endpoint primer and an antisense endpoint primer;
from the 5 'end to the 3' end of the linear DNA sequence, the sense endpoint primer, the antisense modification primer, the sense modification primer and the antisense endpoint primer are combined in pairs in sequence from the sense endpoint primer according to the sequence of the positions capable of being combined on the linear DNA sequence to amplify the linear DNA sequence respectively so as to obtain an amplification product;
and carrying out enzyme digestion connection on the amplification product to obtain a modified linear DNA sequence.
7. The method of claim 6, wherein: the amplification comprises a first amplification reaction and a second amplification reaction,
carrying out the first amplification reaction by taking the sense endpoint primer and the antisense modification primer as a first primer pair to obtain a first amplification product;
carrying out the second amplification reaction by taking the sense modification primer and the antisense endpoint primer as a second primer pair to obtain a second amplification product;
and carrying out enzyme digestion connection on the first amplification product and the second amplification product to obtain the modified linear DNA sequence.
8. The method of claim 5, wherein: the target sequence is a circular DNA sequence, and the method specifically comprises,
amplifying the circular DNA sequence by respectively adopting the sense modification primer and the antisense modification primer to obtain an amplification product;
and carrying out enzyme digestion connection on the amplification product to obtain a modified circular DNA sequence.
9. A method of ligating a plurality of linear DNA sequences, the method comprising:
in the n linear DNA sequences to be ligated, 2 x (n-1) ends to be ligated are obtained, and the primers of any one of claims 1 to 4 are designed based on the sequences of the ends to be ligated, to obtain 2 x (n-1) ligation primers;
amplifying the linear DNA sequences by using the connecting primers respectively to obtain n amplification products;
performing enzyme digestion connection on the n amplification products to obtain connection products of the n linear sequences;
optionally, the enzymatic cleavage is performed in one reaction system.
10. The method of claim 9, wherein: the method also comprises that two of the n linear DNA sequences to be connected are positioned at two ends of the connected connection products, and a conventional sense primer and an antisense primer are designed according to the sequences of the two ends of the connection products;
the amplification of the linear DNA sequences comprises the steps of respectively amplifying the n linear DNA sequences by using the conventional sense primer, the conventional antisense primer and the conventional connecting primer to obtain n amplification products;
among the ligation primers, a sense ligation primer for amplifying the ith linear DNA sequence has a complementary cleavage site with an antisense ligation primer for amplifying the (i-1) th linear DNA sequence; an antisense junction primer for amplifying the i linear DNA sequences, having a complementary cleavage site to a sense junction primer for amplifying the (i + 1) th linear DNA sequence; and (3) realizing the connection of n amplification products by utilizing the complementary cutting sites to obtain the connection products, wherein n-1 is more than or equal to i and more than or equal to 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310233803.7A CN104232628A (en) | 2013-06-13 | 2013-06-13 | Primer applied to DNA target sequence reconstruction and reconstruction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310233803.7A CN104232628A (en) | 2013-06-13 | 2013-06-13 | Primer applied to DNA target sequence reconstruction and reconstruction method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104232628A true CN104232628A (en) | 2014-12-24 |
Family
ID=52221526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310233803.7A Pending CN104232628A (en) | 2013-06-13 | 2013-06-13 | Primer applied to DNA target sequence reconstruction and reconstruction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104232628A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018183612A1 (en) * | 2017-03-29 | 2018-10-04 | Editas Medicine, Inc. | Nucleic acid mutagenesis methods |
| CN110603334A (en) * | 2017-06-20 | 2019-12-20 | 深圳华大智造科技有限公司 | PCR primer pair and application thereof |
| CN113005119A (en) * | 2021-03-02 | 2021-06-22 | 通用生物系统（安徽）有限公司 | Gene multi-segment repeated connection cloning method |
| WO2021121391A1 (en) * | 2019-12-19 | 2021-06-24 | 南京金斯瑞生物科技有限公司 | Method for constructing a gene mutation library |
| WO2024067644A1 (en) * | 2022-09-26 | 2024-04-04 | 深圳瑞吉生物科技有限公司 | Method for cell-free preparation of mrna transcription template |
-
2013
- 2013-06-13 CN CN201310233803.7A patent/CN104232628A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| HAISU WAN ET AL.: "A site-directed mutagenesis method particularly useful for creating otherwise difficult-to-make mutants and alanine scanning", 《ANALYTICAL BIOCHEMISTRY》 * |
| JAE-KYUN KO ET AL.: "A rapid and efficient PCR-based mutagenesis method applicable to cell physiology study", 《AM J PHYSIOL CELL PHYSIOL》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018183612A1 (en) * | 2017-03-29 | 2018-10-04 | Editas Medicine, Inc. | Nucleic acid mutagenesis methods |
| CN110603334A (en) * | 2017-06-20 | 2019-12-20 | 深圳华大智造科技有限公司 | PCR primer pair and application thereof |
| CN110603334B (en) * | 2017-06-20 | 2024-01-16 | 深圳华大智造科技股份有限公司 | PCR primer pair and application thereof |
| WO2021121391A1 (en) * | 2019-12-19 | 2021-06-24 | 南京金斯瑞生物科技有限公司 | Method for constructing a gene mutation library |
| CN114829685A (en) * | 2019-12-19 | 2022-07-29 | 南京金斯瑞生物科技有限公司 | Construction method of gene mutation library |
| CN113005119A (en) * | 2021-03-02 | 2021-06-22 | 通用生物系统（安徽）有限公司 | Gene multi-segment repeated connection cloning method |
| WO2024067644A1 (en) * | 2022-09-26 | 2024-04-04 | 深圳瑞吉生物科技有限公司 | Method for cell-free preparation of mrna transcription template |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107881184B (en) | Cpf 1-based DNA in-vitro splicing method | |
| Nowacki et al. | RNA-mediated epigenetic programming of a genome-rearrangement pathway | |
| McGrath et al. | Targeting specificity of APOBEC-based cytosine base editor in human iPSCs determined by whole genome sequencing | |
| JP6982087B2 (en) | Building a Next Generation Sequencing (NGS) Library Utilizing Competitive Chain Substitution | |
| Liu et al. | An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol | |
| US20180298391A1 (en) | Programmable Modification of DNA | |
| US8092991B2 (en) | De novo enzymatic production of nucleic acid molecules | |
| US10287590B2 (en) | Methods for generating libraries with co-varying regions of polynuleotides for genome modification | |
| Khosravi et al. | Site-directed RNA editing: recent advances and open challenges | |
| Su et al. | RNA-Seq analyses reveal the order of tRNA processing events and the maturation of C/D box and CRISPR RNAs in the hyperthermophile Methanopyrus kandleri | |
| CN104232628A (en) | Primer applied to DNA target sequence reconstruction and reconstruction method | |
| US20060223081A1 (en) | Ladder assembly and system for generating diversity | |
| US20230332184A1 (en) | Template guide rna molecules | |
| Wang et al. | Improved CRISPR‐Cas12a‐assisted one‐pot DNA editing method enables seamless DNA editing | |
| EP3867373A1 (en) | Improved ordered assembly of multiple dna fragments | |
| Callow et al. | Selective DNA amplification from complex genomes using universal double‐sided adapters | |
| Sorida et al. | An efficient cloning method to expand vector and restriction site compatibility of Golden Gate Assembly | |
| US20230348894A1 (en) | Method For Constructing A Gene Mutation Library | |
| Young et al. | Restriction enzyme-free mutagenesis via the light regulation of DNA polymerization | |
| Finney et al. | Molecular cloning of PCR products | |
| JP2005245297A (en) | Method for preparing genome library and genome library prepared by the same method | |
| Fuhrmann et al. | RNA-template dependent de novo telomere addition | |
| US20220177875A1 (en) | Compositions and Methods for Improved In Vitro Assembly of Polynucleotides | |
| CN116848244A (en) | Compositions and methods for improving polynucleotide in vitro assembly | |
| Zhou et al. | Assembly of a functional ribozyme from short oligomers by enhanced non-enzymatic ligation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20141224 |
|
| RJ01 | Rejection of invention patent application after publication |