CN104225593B - A kind of Water Soluble Compound immunologic adjuvant and the vaccine combination that contains this adjuvant - Google Patents
A kind of Water Soluble Compound immunologic adjuvant and the vaccine combination that contains this adjuvant Download PDFInfo
- Publication number
- CN104225593B CN104225593B CN201410508574.XA CN201410508574A CN104225593B CN 104225593 B CN104225593 B CN 104225593B CN 201410508574 A CN201410508574 A CN 201410508574A CN 104225593 B CN104225593 B CN 104225593B
- Authority
- CN
- China
- Prior art keywords
- phosphonitrile
- poly
- phenoxy group
- synthetic
- adjuvant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention belongs to immunologic adjuvant technical field, a kind of Water Soluble Compound immunologic adjuvant is disclosed, is it by many phosphonitriles high molecular polymer and comprise SEQ? ID? the recombinant plasmid of the CpG motif shown in NO:1 is formulated according to certain weight ratio, wherein the side chain of many phosphonitriles high molecular polymer is to sodium propionate phenoxy group, and molecular weight is between 70-100 ten thousand units. The invention also discloses the method for this compound immunological adjuvant of preparation, contain vaccine combination of this compound immunological adjuvant and preparation method thereof, and this compound immunological adjuvant is in the application of preparing in vaccine combination. The present invention is according to biology and the immunological characteristic of many phosphonitriles high molecular polymer and CpG recombinant plasmid, by two kinds of molecules in certain proportion compatibility be prepared into a kind of NEW TYPE OF COMPOSITE immunologic adjuvant, reach than safer, the efficient immunological enhancement of traditional oils adjuvant, there are more wide market prospects.
Description
Technical field
The present invention relates to immunologic adjuvant technical field, be specifically related to have the Water Soluble Compound of immunological enhancementImmunologic adjuvant and in the application of preparing in vaccine combination.
Background technology
Aftosa (FMD) be the artiodactyl being caused by foot and mouth disease virus (FMDV) acute, hot,Height contagious disease is one of the most serious infectious disease of harm animal husbandry, by World Organization for Animal Health (OIE)And FAO (Food and Agriculture Organization of the United Nation) (FAO) in International Animal Health code, classify as 18 kinds of category-A infectious diseases itHead, is listed in again whole world elimination plan and the biological weapons security pact tissue of great transnational animal epidemic in recent yearsEmphasis checks object. Still put prevention first with immunity for the control of aftosa at present, although various novel epidemic diseaseThe development of seedling is that the prevention of aftosa brings new opportunity. But because various new generation vaccines are imitated at immunoprotectionDeficiency in power, causes it can't replace traditional inactivated vaccine completely. In the world, some states in South AmericaFamily has obtained " without aftosa statehood " by inactivated foot-and-mouth disease vaccine immunoprophylaxis. At the mouth hoof of ChinaIn epidemic disease prevention and control, its inactivated vaccine is still main flow immune vaccine, and its market share is still very large, in China and weekIn the aftosa control of countries and regions, limit, bring into play important function.
At the beginning of inactivated foot-and-mouth disease vaccine research and development, be all generally to make water adjuvant carry out compatibility aftosa inactivation antigen,But british animal health research in 1997 two kinds of new oily adjuvants of Pirbright use for laboratoryMnotnadieISA25 and 206 prepares foot and mouth vaccine immune swine and cattle and sheep. Follow-up research is found, oil assistantAgent, than the prepared vaccine of water adjuvant compatibility inactivation antigen, can produce stronger resisting on pig and cattle and sheepPrecursor reactant, causes inactivated vaccine afterwards all to adopt oily adjuvant preparation. But the use of oily adjuvant but widelyImproved the cost of vaccine, and its side effect is larger, conventionally can cause injection site redness, pain,The problems such as fever is even irritated dead. Therefore, if can find the water assistant that a kind of and oily adjuvant effect is suitableInactivation antigen vaccine is prepared in agent, and the market prospects of so this safe and efficient vaccine will be more wide.
Many phosphonitriles composition is a kind of novel potential macromolecular compound with immunologic adjuvant effect, currentResearch has proved that it has immunological enhancement, itself and the compatible immune mouse of respiratory system epidemic disease pathogen antigenAfter, prove that many phosphonitriles not only improve the level that represents autarcetic IgA antibody, and at acquired immunityAspect not only can strengthen the IFN γ level that represents Th1 type, can also strengthen represent Th2 type IL-4 pointBleeding is flat. But many phosphonitriles molecule is by an organic main chain and the side that has multiple different organic substituentsThe high molecular polymer of chain composition, makes it have organic and performance inorganic polymer concurrently, introduces different side chains,Can prepare the Synthesis, Characterization of Polyphosphazenes with difference in functionality. At present, by many phosphonitriles molecule as immunologic adjuvant alsoIn research and development initial stage, its immunoenhancement result not yet reaches the level suitable with oily adjuvant effect.
In addition, current research both domestic and external has proved that CpG motif is a kind of based on body innate immunity signal wayMolecule footpath, that there is immune-stimulating effect, and inventor's research before has also proved containing CpG motifRecombinant plasmid be also a kind of well immunopotentiator. But, although above-mentioned CpG recombinant plasmid hasStrong antigen immune increased activity ability, but it also can't reach tradition completely as single adjuvant compositionThe effect of adjuvant.
Summary of the invention
For the above-mentioned defect existing in prior art, one aspect of the present invention provides a kind of Water Soluble Compound to exempt fromEpidemic disease adjuvant, it is by many phosphonitriles high molecular polymer and the weight that comprises the CpG motif shown in SEQIDNO:1The ratio that group plasmid is 5:2 according to weight ratio is formulated, the side of wherein said many phosphonitriles high molecular polymerChain is to sodium propionate phenoxy group, and molecular weight is between 70-100 ten thousand units.
In the preferred embodiment of the invention, this many phosphonitriles high molecular polymer is to prepare by following stepsAnd come:
1, polydichlorophosphazenes is synthetic
Ammonium chloride and phosphorus chloride are mixed using sulfamic acid, calcium sulphate dihydrate and trichloro-benzenes as solvent,Synthetic polydichlorophosphazenes;
2, synthesizing methyl propionate benzenpropanoic acid sodium
Para hydroxybenzene methyl propionate is mixed using oxolane as solvent with sodium hydride, synthetic to methyl propionateBenzenpropanoic acid sodium;
3, poly-[two (to methyl propionate phenoxy group)] phosphonitrile is synthetic
Mix using oxolane as molten by polydichlorophosphazenes synthetic first two steps with to methyl propionate benzenpropanoic acid sodiumAgent, synthetic poly-[two (to methyl propionate phenoxy group)] phosphonitrile;
4, poly-[two (to propionic acid toloxyl)] phosphonitrile is synthetic
In synthetic poly-[two (to methyl propionate phenoxy group)] phosphonitrile, be added dropwise to potassium hydroxide solution, synthetic poly-[two (to propionic acid toloxyl)] phosphonitrile;
5, poly-[two (to propionic acid phenoxy group)] phosphonitrile is synthetic
Precipitate with deionized water is dissolved, and then from deionized water, precipitate with absolute ethyl alcohol, again will sinkShallow lake deionized water dissolving, adds hydrochloric acid solution titration to regulate final solution pH=6.3, finally uses saturated brinePrecipitation, obtains poly-[two (to propionic acid phenoxy group)] phosphonitrile;
6, poly-[two (to sodium propionate phenoxy group)] phosphonitrile is synthetic
Poly-[two (to propionic acid the phenoxy group)] phosphonitrile obtaining is dissolved in deionized water, molten with NaOH adjustingLiquid pH=7.4, by absolute ethyl alcohol precipitation, obtains poly-[two (to sodium propionate phenoxy group)] phosphonitrile;
7, the molecular weight of poly [two (to sodium propionate phenoxy group)] phosphonitrile is screened, acquisition molecular weight isPoly [two (to sodium propionate phenoxy group)] phosphonitrile between 70-100 ten thousand units.
In another preferred embodiment of the present invention, the recombinant plasmid in this Water Soluble Compound immunologic adjuvant isThe puc18 recombinant plasmid that comprises the CpG motif shown in SEQIDNO:1.
The present invention provides a kind of method of preparing Water Soluble Compound immunologic adjuvant on the other hand, comprises following stepRapid:
1, prepare many phosphonitriles high molecular polymer, the side chain of described many phosphonitriles high molecular polymer is to sodium propionatePhenoxy group, molecular weight is between 70-100 ten thousand units,
2, the recombinant plasmid that preparation comprises the CpG motif shown in SEQIDNO:1,
3, by many phosphonitriles high molecular polymer and the restructuring that comprises the CpG motif shown in SEQIDNO:1The ratio that plasmid is 5:2 according to weight ratio is mixed, and is dissolved in the water-soluble solution that pH is 6-8, fully mixedEven formulated.
In the preferred embodiment of the invention, prepare many phosphonitriles high molecular polymer and comprise the steps:
1, polydichlorophosphazenes is synthetic
Ammonium chloride and phosphorus chloride are mixed using sulfamic acid, calcium sulphate dihydrate and trichloro-benzenes as solvent,Synthetic polydichlorophosphazenes;
2, synthesizing methyl propionate benzenpropanoic acid sodium
Para hydroxybenzene methyl propionate is mixed using oxolane as solvent with sodium hydride, synthetic to methyl propionateBenzenpropanoic acid sodium;
3, poly-[two (to methyl propionate phenoxy group)] phosphonitrile is synthetic
Mix using oxolane as molten by polydichlorophosphazenes synthetic first two steps with to methyl propionate benzenpropanoic acid sodiumAgent, synthetic poly-[two (to methyl propionate phenoxy group)] phosphonitrile;
4, poly-[two (to propionic acid toloxyl)] phosphonitrile is synthetic
In synthetic poly-[two (to methyl propionate phenoxy group)] phosphonitrile, be added dropwise to potassium hydroxide solution, synthetic poly-[two (to propionic acid toloxyl)] phosphonitrile;
5, poly-[two (to propionic acid phenoxy group)] phosphonitrile is synthetic
Precipitate with deionized water is dissolved, and then from deionized water, precipitate with absolute ethyl alcohol, again will sinkShallow lake deionized water dissolving, adds hydrochloric acid solution titration to regulate final solution pH=6.3, finally uses saturated brinePrecipitation, obtains poly-[two (to propionic acid phenoxy group)] phosphonitrile;
6, poly-[two (to sodium propionate phenoxy group)] phosphonitrile is synthetic
Poly-[two (to propionic acid the phenoxy group)] phosphonitrile obtaining is dissolved in deionized water, molten with NaOH adjustingLiquid pH=7.4, by absolute ethyl alcohol precipitation, obtains poly-[two (to sodium propionate phenoxy group)] phosphonitrile;
7, the molecular weight of poly [two (to sodium propionate phenoxy group)] phosphonitrile is screened, acquisition molecular weight isPoly [two (to sodium propionate phenoxy group)] phosphonitrile between 70-100 ten thousand units.
In another preferred embodiment of the present invention, preparation comprises the CpG motif shown in SEQIDNO:1Recombinant plasmid comprise the steps:
1, the CpG motif shown in synthetic SEQIDNO:1;
2, design respectively the part base of adding EcoRI and SalI restriction enzyme site at the end of described motif, andBecome double-stranded DNA;
3, the method by genetic recombination is incorporated into described double-stranded DNA the plasmid of cutting through EcoRI and SalI enzymeIn, obtain the recombinant plasmid that comprises the CpG motif shown in SEQIDNO:1.
In another preferred embodiment of the present invention, by many phosphonitriles high molecular polymer with comprise SEQIDThe recombinant plasmid of the CpG motif shown in NO:1 is dissolved in pH and, in 7.2 PBS solution, stirs and fill for 30 minutesDivide and mix.
The present invention provides a kind of vaccine combination on the other hand, the water of the present invention that it contains effective doseDissolubility compound immunological adjuvant and immunogene.
In the preferred embodiment of the invention, immunogene is aftosa inactivation antigen, is more preferably AsiaI type inactivated foot-and-mouth disease vaccine antigen or O type inactivated foot-and-mouth disease vaccine antigen.
The present invention provides the method for preparing vaccine combination of the present invention on the other hand, comprises and mixes thisWater Soluble Compound immunologic adjuvant and immunogenic step that invention is described.
Further aspect of the present invention also provides Water Soluble Compound immunologic adjuvant of the present invention in preparation vaccine groupApplication in compound.
In the preferred embodiment of the invention, immunogene is aftosa inactivation antigen, is more preferably AsiaI type inactivated foot-and-mouth disease vaccine antigen or O type inactivated foot-and-mouth disease vaccine antigen.
Compared with prior art, the present invention has following characteristics and advantages:
First, CpG recombinant plasmid is as immunologic adjuvant, and it is a kind of being proved aspect cellullar immunologic responseWell Th1 type immunopotentiator, but its immune continuation is shorter. Many phosphonitriles high molecular polymer is as exempting fromEpidemic disease adjuvant, has stronger effect compared with CpG recombinant plasmid aspect stimulation humoral immunity of organism, and is continuingTime is long, but it is obviously not enough aspect inducing cell immune response. The present invention utilizes many phosphonitriles macromoleculeThese two kinds of immunologic adjuvants of polymer and CpG recombinant plasmid advantage aspect stimulation body generation immune response is mutualThe feature of mending, appropriate design has also been prepared NEW TYPE OF COMPOSITE immunologic adjuvant, has reached and can promote that humoral immunity shouldAnswer the effect that also can promote cellullar immunologic response, and for different epidemic disease vaccines all have compatibility and forProperty.
Secondly,, aspect animal vaccine production, the NEW TYPE OF COMPOSITE immunologic adjuvant of preparing due to the present invention also hasWater miscible feature, has therefore simplified the processing step of vaccine compatibility greatly, thereby has reduced the production of vaccineCost.
Finally, the vaccine that adopts NEW TYPE OF COMPOSITE immunologic adjuvant of the present invention to prepare holds than oily adjuvant in the time of immunityEasily inoculation, easily absorbs, and in inoculation position noresidue, has reached safe, efficient and lasting object, hasThe advantage that substitutes traditional adjuvants such as oily adjuvant, has more wide market prospects.
Brief description of the drawings
Fig. 1 is many phosphonitriles adjuvant composition synthesis process flow diagram.
Fig. 2 is the Efficacy evaluation figure of many phosphonitriles of different molecular weight vaccine.
Fig. 3 is the specific antibody level comparison diagram of different vaccine group inductions.
Fig. 4 is different vaccine group IL-12 content right in serum when immunity 7 days, 14 days and 21 days respectivelyThan figure.
Detailed description of the invention
Below in conjunction with accompanying drawing, the present invention is described in further detail, but not as a limitation of the invention.
Embodiment 1: the synthesis technique of many phosphonitriles adjuvant composition
1, polydichlorophosphazenes is synthetic
Ammonium chloride and phosphorus chloride are mixed using sulfamic acid, calcium sulphate dihydrate and trichloro-benzenes as solvent,Under 190-195 DEG C of condition, react 4h. Synthetic polydichlorophosphazenes.
2, synthesizing methyl propionate benzenpropanoic acid sodium
Para hydroxybenzene methyl propionate is mixed with sodium hydride using oxolane as solvent room temperature reaction 4h, syntheticTo methyl propionate benzenpropanoic acid sodium.
3, poly-[two (to methyl propionate phenoxy group)] phosphonitrile is synthetic
Mix using oxolane as molten by polydichlorophosphazenes synthetic first two steps with to methyl propionate benzenpropanoic acid sodium65 DEG C of reaction 58h of agent, generate poly-[two (to methyl propionate phenoxy group)] phosphonitrile.
4, poly-[two (to propionic acid toloxyl)] phosphonitrile is synthetic
In poly-[two (to methyl propionate the phenoxy group)] phosphonitrile generating, be added dropwise to potassium hydroxide solution, at 60 DEG CReaction 2h, generates poly-[two (to propionic acid toloxyl)] phosphonitrile.
5, poly-[two (to propionic acid phenoxy group)] phosphonitrile is synthetic
Pour out liquid, precipitate with deionized water is dissolved, and then heavy from deionized water with absolute ethyl alcoholForm sediment, again precipitate with deionized water is dissolved, add hydrochloric acid solution titration to regulate final solution pH=6.3,By saturated brine precipitation, gathered [two (to propionic acid phenoxy group)] phosphonitrile afterwards.
6, many phosphonitriles molecule: gather the synthetic of [two (to sodium propionate phenoxy group)] phosphonitrile
Poly-[two (to propionic acid the phenoxy group)] phosphonitrile obtaining is dissolved in deionized water, molten with NaOH adjustingLiquid pH=7.4, by absolute ethyl alcohol precipitation, finally obtains many phosphonitriles molecule: poly-[two (to sodium propionate phenoxy group)]Phosphonitrile.
Embodiment 2: according to molecular size range to the segmentation of many phosphonitriles
Poly-[two (to sodium propionate the phenoxy group)] phosphonitrile of many phosphonitriles molecule is carried out to molecular weight segmentation, adopt differentThe bag filter of molecular cut off, dialyses to poly-[two (to sodium propionate the phenoxy group)] phosphonitrile of polyphosphazene molecule,Accurately to control the molecular weight of polyphosphazene.
Use respectively 300,000 and 700,000 bag filter to poly-[two (to sodium propionate the phenoxy group)] phosphorus of polyphosphazene moleculeNitrile is dialysed, and obtains molecular weight and is respectively the poly-phosphorus below 300,000, more than 300,000-700,000 and 700,000Nitrile molecule.
Embodiment 3: many phosphonitriles molecule of different molecular weight and Asia I type foot-and-mouth disease antigen compatibility immune mouseImmunologic adjuvant Effect Evaluation experiment
By many phosphonitriles molecule of the different molecular weight preparing (dosage is 100ug/) and Asia I type mouth hoofEpidemic disease inactivation antigen according to the rules dose compatibility (Asia I type aftosa inactivation antigen is produced by middle peasant Witter company,Dosage is standard dose) prepare experimental vaccine.
By many phosphonitriles vaccine of the different molecular weight of compatibility of the present invention, antigen alone vaccine (antigen control,Asia I type aftosa inactivation antigen), respectively immunization trial mouse of PBS (blank), use liquid phaseBlocking-up ELISA kit (being produced by Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences) detects each group of antibody and dripsDegree, the immunoadjuvant function of the many phosphonitriles of evaluation different molecular weight.
Antibody titer result shows, many phosphonitriles vaccine that relative molecular weight is greater than 700,000, and its antibody titer is obviousHigher than many phosphonitriles vaccine of other molecular size ranges, specific experiment result is referring to Fig. 2. Consider reality simultaneouslyIn application, corresponding the diminishing of its solubility of many phosphonitriles composition that molecular weight is excessive, therefore finally selected point of the present inventionSon amount is for poly-[two (to sodium propionate the phenoxy group)] phosphonitrile of the many phosphonitriles molecule between 70-100 ten thousand units is as exempting fromEpidemic disease adjuvant.
The preparation of embodiment 4:CpGDNA plasmid, a large amount of amplification, extraction and purifying
1, the synthetic and screening of CpG motif sequence
According to three-dimensional effect and animal reservoir's specificity of CpG motif, design, synthetic multiple CpG motif,Carried out full chain thio-modification for preventing from degrading very soon, on mouse, rabbit and pig body, carried out important epidemic diseaseThe Experiment of Compatibility of vaccine (aftosa, swine fever and pork measles), therefrom filters out best adjuvant core for pigSequence, as described in SEQIDNO:1.
2, the recombinant clone of CpG motif sequence
Artificial synthetic non-sulfo-, non-methylated above-mentioned SEQIDNO:1 the best containing CpG motif againAdjuvant core sequence, the while is designed respectively the part base of EcoRI and SalI restriction enzyme site at its end, rawBecome AATTCTCGTCGTTTGTCGTTTTGTCGTTG and complementary series thereof, adopt temperature control to becomeProperty, renaturation technology becomes double-stranded DNA, by genetic engineering recombinant technique, directed being cloned intoPuc18 carrier, transforms Escherichia coli, uses amicillin resistance screening positive clone, extracts plasmid order-checkingQualification, confirms the SEQIDNO:1 that contains CpG motif sequence to be cloned in plasmid vector. Will be justReally insert the puc18 recombinant plasmid called after recombinant C pG-DNA plasmid of SEQIDNO:1.
3, a large amount of amplifications, extraction and the purifying of recombinant C pG-DNA plasmid
Select the positive strain of high copy, be inoculated into 1000ml containing in the LB culture medium of ammonia benzyl, at 220rpmIn shaking table, cultivate after 12～14 hours for 37 DEG C, extract in a large number recombinant C pG-DNA matter with SDS alkaline lysisGrain. The thick plasmid extracting after the ice-cold LiCl of 5M separates, its supernatant equal-volume isopropanol precipitating,Use again 70% ethanol washing precipitation, the centrifugal supernatant of removing; Precipitation is dissolved with the TE buffer solution containing RNase,After room temperature treatment 30 minutes, then use phenol: chloroform extracting 2 times, 2 times of absolute ethyl alcohol precipitations are centrifugal; Use 1mlAfter aqua sterilisa dissolution precipitation, add 0.5mlPEG-MgCl2Solution (30mMMgCl2In add 40%PEG8000), fully mix rear placement 15 minutes, centrifugal 20 minutes of 13000rpm, precipitates the ethanol with 70%Wash 2 times, then use TE buffer solution or sterilized water dissolution precipitation, measure its content with nucleic acid-protein detectorAnd purity, 4 DEG C save backup.
Embodiment 5: the preparation of vaccine and the preparation of strain
By the CpGDNA plasmid that extracts purifying according to the dosage of 200 μ g/ head parts and many phosphonitriles adjuvant according toThe dose compatibility of 500ug/ head part, is dissolved in pH and is in 7.2 PBS solution, magnetic agitation 30min, fullyMix and make NEW TYPE OF COMPOSITE adjuvant, for subsequent use.
By NEW TYPE OF COMPOSITE adjuvant of the present invention and O type aftosa inactivation antigen dose compatibility (O type according to the rulesAftosa inactivation antigen is produced by middle peasant Witter company, and dosage is standard dose) preparation experiment vaccine. By cityStandard 206 adjuvants of selling and O type aftosa inactivation antigen compatibility preparation standard control vaccine. By single many phosphorusNitrile composition 500ug/ head part is prepared control vaccine as adjuvant and O type aftosa inactivation antigen compatibility. Meanwhile,Using the independent immune group of O type foot-and-mouth disease antigen as antigen control group, using PBS immune group as blank group.
Strain O/MYA98/BY/2010 provides for middle peasant Witter company.
Embodiment 6: immunity inoculation experiment and experimental result
Adopt respectively the various vaccines of preparation in embodiment 5 to carry out musculi colli injecting immune to experiment pig, notePenetrating consumption is the routine dose in actual production. With LPB-ELISA kit (by Scientia Agricultura SinicaInstitute's Lanzhou veterinary institute is produced) detect each group of antibody titer, the cell factor kit detection cell factor is dividedThe level of secreting, and immunity test pig was attacked to poison in 90 days, calculate protective rate.
Can find out the spy of the new generation vaccine induction of composite adjuvant compatibility prepared by the present invention from the result of Fig. 3Heterogenetic antibody level, in the whole immunologic surveillance phase, the vaccine of internal ratio tradition 206 adjuvant compatibilities is all high, sustainableMore than 90 days, the new generation vaccine of composite adjuvant compatibility and the vaccine phase of single many phosphonitriles molecule as adjuvant compatibilityRatio, antibody horizontal has obtained greatly improving, and illustrates that the compound of two kinds of molecules is very necessary.
In addition, many IL-12 of studies have shown that play key effect in the innate immunity and acquired immunity, outstandingIt is a kind of important adjusting factor in cellullar immunologic response. IL-12 separately or with IL-2 synergy canThe T cell proliferation of thorn activation, enhanced CT L activity, strengthens NK by the generation of induction IFN-γ thinBorn of the same parents' propagation and cytotoxic effect.
The results show of the present invention aspect cellular immunity, composite adjuvant compatibility prepared by the present inventionThe vaccine of the more traditional 206 adjuvant compatibilities of new generation vaccine has certain advantage. Immunity 7 days, 14 days, 21It time in experiment pig serum, detect and represent the immunoreactive IL-12 content of Th1 type, find in 14 of immunityMy god, IL-12 content in the new generation vaccine experimental group pig serum of the composite adjuvant compatibility prepared of the present invention in 21 daysBe significantly higher than the vaccine group of traditional 206 adjuvant compatibilities. With the vaccine of single many phosphonitriles molecule as adjuvant compatibilityCompare, the IL-12 content that new generation vaccine induction of the present invention produces is also higher, and concrete outcome is referring to Fig. 4.
In the time of immune 90 days, experiment pig is attacked according to standard dose (dosage is 1000TcID50/ head)Poison, observed and calculates the new generation vaccine group that adopts the composite adjuvant compatibility prepared of the present invention by continuous 10 daysIn, in 5 experiment pig, there are 4 not morbidities, protection efficiency is 80%, with the epidemic disease of standard 206 adjuvant compatibilitiesSeedling group effect is suitable, and blank group and antigen control group be all morbidities, and protective rate is 0, specifically knotFruit is in table 1.
The each experimental group protective rate of table 1 measurement result
| Experimental group | Protective rate |
| 206 adjuvant control groups | 5/5 |
| Many phosphonitrile+CpG composite adjuvant groups | 4/5 |
| Many phosphonitriles adjuvant group | 2/5 |
| Antigen control group | 0/5 |
| Blank group | 0/5 |
Claims (12)
1. a Water Soluble Compound immunologic adjuvant, it is by many phosphonitriles high molecular polymer and comprisingThe ratio that the recombinant plasmid of the CpG motif shown in SEQIDNO:1 is 5:2 according to weight ratioFormulated, the side chain of wherein said many phosphonitriles high molecular polymer is to sodium propionate phenoxy group,Molecular weight is between 70-100 ten thousand units, described many phosphonitriles high molecular polymer be by belowStep preparation and come:
(1) polydichlorophosphazenes is synthetic
Ammonium chloride and phosphorus chloride are mixed with sulfamic acid, calcium sulphate dihydrate and trichloro-benzenes workFor solvent, synthetic polydichlorophosphazenes;
(2) synthesizing methyl propionate benzenpropanoic acid sodium
Para hydroxybenzene methyl propionate is mixed using oxolane as solvent with sodium hydride, synthetic rightMethyl propionate benzenpropanoic acid sodium;
(3) poly-[two (to methyl propionate phenoxy group)] phosphonitrile is synthetic
Mix with tetrahydrochysene by polydichlorophosphazenes synthetic first two steps with to methyl propionate benzenpropanoic acid sodiumFurans, as solvent, synthesizes poly-[two (to methyl propionate phenoxy group)] phosphonitrile;
(4) poly-[two (to propionic acid toloxyl)] phosphonitrile is synthetic
In synthetic poly-[two (to methyl propionate phenoxy group)] phosphonitrile, be added dropwise to potassium hydroxide solution,Synthetic poly-[two (to propionic acid toloxyl)] phosphonitrile;
(5) poly-[two (to propionic acid phenoxy group)] phosphonitrile is synthetic
Precipitate with deionized water is dissolved, and then from deionized water, precipitates with absolute ethyl alcohol,Again precipitate with deionized water is dissolved, adds hydrochloric acid solution titration to regulate final solution pH=6.3,Finally, by saturated brine precipitation, obtain poly-[two (to propionic acid phenoxy group)] phosphonitrile;
(6) poly-[two (to sodium propionate phenoxy group)] phosphonitrile is synthetic
Poly-[two (to propionic acid the phenoxy group)] phosphonitrile obtaining is dissolved in deionized water, uses hydroxideSodium regulator solution pH=7.4, by absolute ethyl alcohol precipitation, obtains poly-[two (to sodium propionate phenoxy group)]Phosphonitrile;
(7) molecular weight that gathers [two (to sodium propionate phenoxy group)] phosphonitrile is screened, obtainMolecular weight is poly [two (to sodium propionate the phenoxy group)] phosphonitrile between 70-100 ten thousand units.
2. Water Soluble Compound immunologic adjuvant according to claim 1, wherein recombinant plasmidFor comprising the puc18 recombinant plasmid of the CpG motif shown in SEQIDNO:1.
3. a method of preparing Water Soluble Compound immunologic adjuvant, comprises the steps:
(1) prepare many phosphonitriles high molecular polymer, the side of described many phosphonitriles high molecular polymerChain is to sodium propionate phenoxy group, and molecular weight is between 70-100 ten thousand units,
(2) recombinant plasmid that preparation comprises the CpG motif shown in SEQIDNO:1,
(3) by many phosphonitriles high molecular polymer with comprise the CpG shown in SEQIDNO:1The ratio that the recombinant plasmid of motif is 5:2 according to weight ratio is mixed, and being dissolved in pH is 6-8'sIn water-soluble solution, fully mix formulatedly, wherein prepare many phosphonitriles high molecular polymer bagDraw together following steps:
(1) polydichlorophosphazenes is synthetic
Ammonium chloride and phosphorus chloride are mixed with sulfamic acid, calcium sulphate dihydrate and trichloro-benzenes workFor solvent, synthetic polydichlorophosphazenes;
(2) synthesizing methyl propionate benzenpropanoic acid sodium
Para hydroxybenzene methyl propionate is mixed using oxolane as solvent with sodium hydride, synthetic rightMethyl propionate benzenpropanoic acid sodium;
(3) poly-[two (to methyl propionate phenoxy group)] phosphonitrile is synthetic
Mix with tetrahydrochysene by polydichlorophosphazenes synthetic first two steps with to methyl propionate benzenpropanoic acid sodiumFurans, as solvent, synthesizes poly-[two (to methyl propionate phenoxy group)] phosphonitrile;
(4) poly-[two (to propionic acid toloxyl)] phosphonitrile is synthetic
In synthetic poly-[two (to methyl propionate phenoxy group)] phosphonitrile, be added dropwise to potassium hydroxide solution,Synthetic poly-[two (to propionic acid toloxyl)] phosphonitrile;
(5) poly-[two (to propionic acid phenoxy group)] phosphonitrile is synthetic
Precipitate with deionized water is dissolved, and then from deionized water, precipitates with absolute ethyl alcohol,Again precipitate with deionized water is dissolved, adds hydrochloric acid solution titration to regulate final solution pH=6.3,Finally, by saturated brine precipitation, obtain poly-[two (to propionic acid phenoxy group)] phosphonitrile;
(6) poly-[two (to sodium propionate phenoxy group)] phosphonitrile is synthetic
Poly-[two (to propionic acid the phenoxy group)] phosphonitrile obtaining is dissolved in deionized water, uses hydroxideSodium regulator solution pH=7.4, by absolute ethyl alcohol precipitation, obtains poly-[two (to sodium propionate phenoxy group)]Phosphonitrile;
(7) molecular weight that gathers [two (to sodium propionate phenoxy group)] phosphonitrile is screened, obtainMolecular weight is poly [two (to sodium propionate the phenoxy group)] phosphonitrile between 70-100 ten thousand units.
4. method according to claim 3, wherein preparation comprises SEQIDNO:1 instituteThe recombinant plasmid of the CpG motif showing comprises the steps:
(1) the CpG motif shown in synthetic SEQIDNO:1;
(2) design respectively at the end of described motif the portion that adds EcoRI and SalI restriction enzyme siteDivide base, and become double-stranded DNA;
(3) by the method for genetic recombination, described double-stranded DNA is incorporated into through EcoRI and SalIIn the plasmid that enzyme is cut, obtain the recombinant plasmid that comprises the CpG motif shown in SEQIDNO:1.
5. method according to claim 3, wherein by many phosphonitriles high molecular polymer and bagBeing dissolved in pH containing the recombinant plasmid of the CpG motif shown in SEQIDNO:1 is that 7.2 PBS is moltenIn liquid, stir and fully mix for 30 minutes.
6. a vaccine combination, the water described in its claim 1 or 2 that contains effective doseDissolubility compound immunological adjuvant and immunogene.
7. vaccine combination according to claim 6, wherein immunogene is that aftosa is gone outActive antigen.
8. vaccine combination according to claim 7, wherein aftosa inactivation antigen isAsia I type inactivated foot-and-mouth disease vaccine antigen or O type inactivated foot-and-mouth disease vaccine antigen.
9. prepare a method for the vaccine combination described in any one in claim 6-8,Comprise the Water Soluble Compound immunologic adjuvant described in hybrid right requirement 1 or 2 and immunogenic stepSuddenly.
10. the Water Soluble Compound immunologic adjuvant described in claim 1 or 2 is in preparation vaccine groupApplication in compound.
11. application according to claim 10, wherein immunogene is that aftosa deactivation is anti-Former.
12. application according to claim 11, wherein aftosa inactivation antigen is AsiaI type inactivated foot-and-mouth disease vaccine antigen or O type inactivated foot-and-mouth disease vaccine antigen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410508574.XA CN104225593B (en) | 2014-09-28 | 2014-09-28 | A kind of Water Soluble Compound immunologic adjuvant and the vaccine combination that contains this adjuvant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410508574.XA CN104225593B (en) | 2014-09-28 | 2014-09-28 | A kind of Water Soluble Compound immunologic adjuvant and the vaccine combination that contains this adjuvant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104225593A CN104225593A (en) | 2014-12-24 |
| CN104225593B true CN104225593B (en) | 2016-06-15 |
Family
ID=52215067
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410508574.XA Active CN104225593B (en) | 2014-09-28 | 2014-09-28 | A kind of Water Soluble Compound immunologic adjuvant and the vaccine combination that contains this adjuvant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104225593B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1814757B (en) * | 2005-02-03 | 2012-09-05 | 中国农业科学院兰州兽医研究所 | Novel CpGDNA adjuvant, its preparing method and vaccine containing same |
-
2014
- 2014-09-28 CN CN201410508574.XA patent/CN104225593B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1814757B (en) * | 2005-02-03 | 2012-09-05 | 中国农业科学院兰州兽医研究所 | Novel CpGDNA adjuvant, its preparing method and vaccine containing same |
Non-Patent Citations (3)
| Title |
|---|
| Innate immunity and new adjuvants;MUTWIRI G et al;《OIE Rev Sci Tech》;20071231;第26卷(第1期);147-156 * |
| Poly[di(sodium carboxylatoethylphenoxy) phosphazene] (PCEP) is a potent enhancer of mixed Th1/Th2 immune responses in mice immunized with influenza virus antigens;MUTWIRI G et al;《Vaccine》;20070126;第25卷(第7期);1204-1213 * |
| 聚磷腈免疫佐剂的研究应用概况;侯保才等;《中国现代应用药学》;20120930;第29卷(第9期);793-798 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104225593A (en) | 2014-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105693827B (en) | Porcine pseudorabies virus subunit vaccine and preparation method and application thereof | |
| CN102166350B (en) | Flounders quintuplet inactivated vaccine and preparation method thereof | |
| CN109666609A (en) | A kind of Rhodococcus ruber fermentation process and its application as adjuvant in animal vaccine | |
| Byadgi et al. | The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum) | |
| CN102416177A (en) | Newcastle disease-H9 subtype avian influenza bivalent dual adjuvant inactivated vaccine and preparation method thereof | |
| CN103083659B (en) | Preparation method and application of novel oil-free adjuvant | |
| KR102165358B1 (en) | Vaccine composition for foot and mouth disease virus a serotype | |
| CN104628865A (en) | Pseudorabies virus epitope polypeptide gene engineering vaccine | |
| CN104225593B (en) | A kind of Water Soluble Compound immunologic adjuvant and the vaccine combination that contains this adjuvant | |
| CN104069489B (en) | Newcastle disease and infectious bursa of Fabricius bivalent inactivated vaccine and preparation method thereof | |
| CN108588034B (en) | Variant rabbit viral hemorrhagic disease virus and application thereof in preparation of inactivated vaccine | |
| CN101954080B (en) | Compound-molecule adjuvant for swine foot-and-mouth vaccine and preparation method thereof | |
| CN105316252A (en) | Five-gene-deleted streptococcus suis serotype 2 strain and application | |
| CN102100911B (en) | Preparation method of Cynoglossus semilaevis vibrio anguillarum vaccine | |
| CN112279925B (en) | Fusion protein, canine toxoplasma subunit vaccine and vaccine composition thereof | |
| CN106798920A (en) | A kind of compound immunological adjuvant and its preparation method and application | |
| CN103495159B (en) | The preparation method of flavobacterium columnare genetic vaccine | |
| CN102631675B (en) | High-efficiency CpG preparation, preparation method thereof and application | |
| CN101838325B (en) | Antigen-presenting protein for swines and encoding gene and application thereof | |
| CN105646725A (en) | Application of enteromorpha's polysaccharide for preparing livestock and poultry immunopotentiator | |
| CN104099286A (en) | Inactivation method and inactivated vaccine for Edwardsiella sp. | |
| CN102772797B (en) | Genetic engineering polypeptide vaccine for 4 subtypes of O-type foot and mouth disease virus and its application | |
| CN105169387A (en) | Immune vaccine for preventing toxoplasma gondii infection | |
| CN110218729B (en) | Chicken specific immune activator CpG-ODN and application thereof | |
| CN114522226B (en) | Chiral tumor nano vaccine and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |