CN104211787A - Protein for diagnosis and prevention of tuberculosis - Google Patents
Protein for diagnosis and prevention of tuberculosis Download PDFInfo
- Publication number
- CN104211787A CN104211787A CN201310209991.XA CN201310209991A CN104211787A CN 104211787 A CN104211787 A CN 104211787A CN 201310209991 A CN201310209991 A CN 201310209991A CN 104211787 A CN104211787 A CN 104211787A
- Authority
- CN
- China
- Prior art keywords
- tuberculosis
- albumen
- antibody
- protein
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/04—Mycobacterium, e.g. Mycobacterium tuberculosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1267—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria
- C07K16/1289—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria from Mycobacteriaceae (F)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/5695—Mycobacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/35—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Mycobacteriaceae (F)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/26—Infectious diseases, e.g. generalised sepsis
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Pulmonology (AREA)
- Veterinary Medicine (AREA)
- Mycology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Communicable Diseases (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a protein for diagnosis and prevention of tuberculosis, a kit containing the protein and an application of the protein in preparation of the kit or preparation of a medicine for preventing and curing tuberculosis. Specifically, 21 proteins with good immunogenicity are screened from whole genome of mycobacterium tuberculosis. The proteins can be used for detecting mycobacterium tuberculosis infection or diagnosing tuberculosis and have good sensitivity and specificity. Or the proteins are used for preparing a vaccine so as to prevent or curing tuberculosis.
Description
Technical field
The invention belongs to medical science, biology, field of immunology, relate to for the albumen of diagnosis of tuberculosis and prevention, the antibody that is combined with described protein-specific, and composition containing described albumen or antibody or test kit, described albumen or antibody are for the preparation of the purposes in reagent box for tuberculate diagnosis and for the preparation of the purposes in prevention or treatment tuberculosis.
Background technology
Mycobacterium tuberculosis threatens one of maximum pathogenic agent to human health, tuberculosis is the Infectious Diseases in the world today in grownup, the international public health of Yi Dui forms severe challenge ([1] Khasnobis S., Escuyer V.E., Chatterjee D.Emerging therapeutic targets in tuberculosis:post-genomic era.Exper Opin.Ther.Targets, 2002,6:21 ~ 40).According to WHO report: oneself person about 2,000,000,000 people that is subject to tubercle bacillus affection of the whole world, existing pulmonary tuberculosis patient about 2,000 ten thousand, annual new cases 800 ~ 1,000 ten thousand, die from tuberculosis about 3,000,000 every year, and being equivalent to just has a people to die from tuberculosis ([2] http://www.webtb.org/) every 10 seconds.Tubercule bacillus is after infection human body, many places are in latent state or persistent infection state, it can escape the defense reaction of host and amount reproduction in host cells infected and and host reach a kind of delicate balance, the infected's whenever all likely falling ill in life.Generally, the infected of 10% will develop into active tuberculosis.A untreated active tuberculosis patient, can infect 10 ~ 15 people in 1 year.
Look back nearly ISUZU company and carry out global tuberculosis struggle course, control theory lungy and technology, clinical conditions level all have significant progress with research.Because the generally application of effective chemotherapeutics (vazadrine, Rifampin, pyrazine acyl ammonium, Streptomycin sulphate, Tibutol etc.) and bacille Calmette-Guerin vaccine are in worldwide popularization, sickness rate lungy was once once reduced, to such an extent as to people think optimistically, tuberculosis will be utterly destroyed by the mankind with smallpox is the same.But in the eighties mid-term, make an appraisal of the situation due to starry-eyed, reduce investment, trim inefficient units and get rid of unnecessary ones, loosen treatment lungy and management, tuberculosis revives in many countries again, and sickness rate again gos up in worldwide.WHO in 1993 announces that tuberculosis is in " global emergency state ", and appeals " swing into action and tuberculosis crisis are waged a struggle ", and this delivers such statement and still belongs to the first time in WHO history.
It should be noted that the tuberculosis patient in the whole world 90% is in developing country.Global HIV/AIDS Epidemic not only increases the morbidity chance of tuberculosis Endogenous relapse, too increases the danger of Exogenous reinfection, accelerates the deterioration of tuberculosis epidemic situation.Report according to WHO epidemiology: tuberculosis is HIV(+) first killer (32%) of person.Resistance and multi-drug resistance tuberculosis have also become the significant threat in current Tuberculosis control work.China is one of 22 countries that tuberculosis epidemic situation burden is the heaviest in the world, tuberculosis number is only second to India and occupies the second in the world, belong to high Prevalent district, epidemic situation is in " three high and one low ", i.e. morbidity high (5,23/,100,000), mortality ratio high (20.9/10 ten thousand), resistant rate high (primary drug resistance rate 28.1%, obtain resistant rate 41.1%), year degradation rate low (pulmonary tuberculosis morbidity rate year degradation rate 2.8%).2000 the 4th time national tuberculosis epidemiological random sampling survey result shows, China has 5.5 hundred million people to infect tubercule bacillus, existing pulmonary tuberculosis patient 4,500,000, wherein infectivity pulmonary tuberculosis patient 2,000,000.Within 2005, estimate at tuberculosis patient 5,000,000 people, wherein the patient of 80% is in rural area.It is more than 2 times that die from other all kinds of transmissible disease number summation that China dies from number lungy every year, is one of China's ten large fatal disease.Therefore, the generation lungy of effective prevention and corntrol, and just seem especially urgent, very urgent for existing treatment lungy.
Bacille Calmette-Guerin vaccine (BCG) has been listed in and has been expanded Immunization programme category by prevention lungy: WHO.But the report difference for phthisical immanoprotection action is very large, from 0 ~ 80% not etc.In addition, popular along with HIV, causes whole body disseminated infections after existing report patient AIDS inoculates BCG.
Treatment lungy: up to the present methods for the treatment of lungy is antibiotic bacterium treatment, based on bacteriology.Chemotherapy is not only treatment and is controlled the powerful measure of disease, and is the important component part of tuberculosis prevention and treatment planning.Successful chemotherapy and management, will bring the improvement of epidemic situation, comprises the decline of infection rate, morbidity and mortality ratio.But although these antitubercular agents can play certain result for the treatment of, the side effect brought also can not be ignored, and resistance, multidrug resistant surpass Resistant strain and constantly occur thereupon, the speed of new drug development is well below the speed of the generation of resistance.Thorough eradication of tuberculosis bacillus is world-famous puzzle.
Tuberculosis viral diagnosis: mainly contain following several method:
(1) Sputum inspection: 1 phlegm is coated with bacterium and checks, sputum examination for tubercle bacillus is simple and easy to do, and accuracy is higher, finds tubercule bacillus in phlegm, just can make a definite diagnosis and suffer from tuberculosis.Generally medical to look into three sputum specimens for the first time, namely night phlegm, early morning phlegm and instant phlegm.Although it is Diagnosis of pulmonary tuberculosis " golden index " but diagnosis is low, culture cycle is long.2 sputum tuberculomyces culture, credible result degree is high, and can do tubercule bacillus drug sensitive test, but takes 6-8 week, and application is restricted.
(2) Ⅹ X-ray test Xs: chest Ⅹ ray examination can early discovery tuberculosis, and can determine the position of focus, character, scope, understand incidence and be used for the treatment of the judgement of effect, and carry out conveniently, patient takes like a shot.Chest CT can find pathology that is less or concealment part, can make up the deficiency of general Ⅹ ray examination.But easy and other pulmonary disorders are obscured, and need medical practitioner to confirm.
(3) pulmonary tuberculosis immunology diagnosis: the 1. conventional purified protein derivative of tuberculin (PPD) that has is tested, and this test positive is one of evidence infecting tubercule bacillus.False positive rate is high, easy mistaken diagnosis.2. in blood, in phlegm, the antibody detection positive also contributes to diagnosis, as 38kDa and the much fusion rotein antigen comprising 38kDa antigen thereof, for the diagnosis of humoral immunization aspect, but also inevitably occurs false positive rate.3.BACTEC method surveys the metabolite of mycobacterium tuberculosis, general two weeks separable go out mycobacterium, but how many bacterium amounts can affect the number of days of positive findings appearance.5. polymerase chain reaction (PCR), specificity is poor, and advantage is that susceptibility can reach 98% ~ 100%.
(4) other check, can only as auxiliary diagnosis, can not as diagnosis basis.1. fiberoptic bronchoscopy: directly can observe or indirectly judge segmental bronchus, Pulmonary lesion, and have the functions such as examination of living tissue, lavation, video recording, shooting tracheal strips photo, particularly useful for diagnosis and differential diagnosis.2. thoracoscope and mediastinoscopy: all can be used for observing thoracic cavity, enlarged lymph node in mediastinum, and desirable go out examination of living tissue in order to diagnosis and differential diagnosis.3. ultrasound investigation: the diagnosis and differential diagnosis being mainly used in hydrothorax.
There is the problems such as positive rate is low, cycle length, complicated operation, false positive rate height, therefore in the urgent need to needing a kind of quick, easy, responsive, special diagnostic method, with diagnosis of tuberculosis quickly and accurately in conventional diagnosis of pulmonary tuberculosis technology.。
Summary of the invention
The present inventor with the genome of mycobacterium tuberculosis (MTB) for template, utilize the Gateway technology that Invitrogen company provides, express the protein that whole ORF encodes, clinical blood is detected through wester blot method, acquisition has compared with hypersensitivity, specific antigen, for clinical diagnosis, disease treatment, prevention and control provide solid basic substance.Particularly, the present invention includes following several respects:
First aspect present invention relates to the albumen of separation, and it is selected from following albumen: Rv0388c, Rv0415, Rv0493c, Rv0582, Rv0695, Rv0813c, Rv0819, Rv0891c, Rv1095, Rv1131, Rv1455, Rv1675c, Rv1853, Rv1864c, Rv2234, Rv2961, Rv3052c, Rv3102c, Rv3707c, Rv3767, Rv1773c and albumen identical with above-mentioned 21 kinds of protein functions in different mycobacterium tuberculosis.
In embodiments of the invention, above-mentioned 21 kinds of albumen are from Mycobacterium tuberculosis H37Rv.
In embodiments of the invention, No. Genbank of above-mentioned 21 kinds of albumen is respectively: 57116729,15607556,15607634,15607722,15607835,15607953,15607959,15608031,15608235,15608271,15608593,15608813,15608990,15609001,15609371,15610098,15610189,15610239,15610843,15610903,15608511.
In embodiments of the invention, the albumen of described separation is selected from the albumen of aminoacid sequence respectively as shown in SEQ ID NO:1 ~ SEQ ID NO:20, SEQ ID NO:105.
In embodiments of the invention, described different mycobacterium tuberculosis refers to other mycobacterium tuberculosis of different shaped, such as, be sensitive strain or the Resistant strain of clinical separation.
Second aspect present invention relates to the nucleic acid of separation, the albumen of its coding described in first aspect present invention.
In embodiments of the invention, described nucleic acid encoding protein Rv0388c, Rv0415, Rv0493c, Rv0582, Rv0695, Rv0813c, Rv0819, Rv0891c, Rv1095, Rv1131, Rv1455, Rv1675c, Rv1853, Rv1864c, Rv2234, Rv2961, Rv3052c, Rv3102c, Rv3707c, Rv3767, Rv1773c.
In embodiments of the invention, the nucleotide sequence of described nucleic acid is respectively as shown in SEQ ID NO:21 ~ SEQ ID NO:40, SEQ ID NO:106.
Third aspect present invention relates to recombinant vectors, and it contains the nucleic acid described in second aspect present invention.
In the present invention, described carrier is engineering carrier well known in the art, such as, be cloning vector or expression vector.Described expression vector is such as prokaryotic expression carrier, carrier for expression of eukaryon or virus vector.
Fourth aspect present invention relates to reconstitution cell, and it contains the recombinant vectors described in third aspect present invention.
In the present invention, described cell is host cell well known in the art, such as, be prokaryotic cell prokaryocyte or eukaryotic cell.
In embodiments of the invention, described cell is Bacillus coli cells.
Fifth aspect present invention relates to antibody, and it can specifically in conjunction with the albumen described in first aspect present invention.
Antibody according to a fifth aspect of the present invention, it is monoclonal antibody or polyclonal antibody.
Sixth aspect present invention relates to composition, and it contains the antibody of the albumen of first aspect present invention, the nucleic acid of second aspect, the recombinant vectors of the third aspect, the reconstitution cell of fourth aspect or the 5th aspect.
In the present invention, described composition is such as pharmaceutical composition or vaccine composition.Described pharmaceutical composition can also contain pharmaceutically acceptable auxiliary material; Described vaccine composition can also containing the immunological adjuvant prepared needed for vaccine, such as, be aluminium adjuvant.
Seventh aspect present invention relates to test kit or detection reagent, it contains the albumen of first aspect present invention or the antibody of the 5th aspect, and described test kit or detection reagent are for detecting mycobacterium tuberculosis or the diagnosis for the disease caused by m tuberculosis infection.
Eighth aspect present invention relates to the albumen of first aspect present invention or the purposes of the antibody of the 5th aspect in such as, medicine for the preparation of the disease (such as tuberculosis, the outer tuberculosis of pulmonary tuberculosis or lung) caused by prevention or treatment m tuberculosis infection.
In the present invention, described medicine is such as vaccine, and described vaccine is preventative vaccine or therapeutic vaccine.
Ninth aspect present invention relates to the albumen of first aspect present invention or the antibody of the 5th aspect for the preparation of detecting mycobacterium tuberculosis or such as, for the purposes in the test kit of the disease (such as tuberculosis, the outer tuberculosis of pulmonary tuberculosis or lung) caused by diagnosis of tuberculosis mycobacterial infections or detection reagent.
The invention still further relates to method that is in vivo a kind of or vitro detection mycobacterium tuberculosis, comprise the step using the albumen of a first aspect of the present invention or the antibody of the 5th aspect; Particularly, described method is antigen or antibody detection method, such as western blot or ELISA method.In embodiments of the invention, described detection method is ELISPOT method.
The invention still further relates to a kind of method of diagnosis of tuberculosis, comprise the step using the albumen of a first aspect of the present invention or the antibody of the 5th aspect; Particularly, described method is antigen or antibody detection method, such as western blot or ELISA method.In embodiments of the invention, described detection method is ELISPOT method.
Below the present invention is described further.
In the present invention, mycobacterium tuberculosis (Mycobacterium tuberculosis) is also referred to as tubercule bacillus, is cause pathogenic bacteria lungy.
Mycobacterium tuberculosis H37Rv be within 1905, separate and be widely used in the bacterial strain of biomedical research by the whole world, have the pulmonary tuberculosis animal model of complete toxicity.
These 21 kinds of dietary protein origins of Rv0388c, Rv0415, Rv0493c, Rv0582, Rv0695, Rv0813c, Rv0819, Rv0891c, Rv1095, Rv1131, Rv1455, Rv1675c, Rv1853, Rv1864c, Rv2234, Rv2961, Rv3052c, Rv3102c, Rv3707c, Rv3767, Rv1773c of the present invention are in mycobacterium tuberculosis (M.tuberculosis) H37Rv.。
Because the genome of different M. tuberculosis strains is different, the albumen of expression may be different, therefore the invention still further relates to albumen identical with above-mentioned 21 kinds of protein functions in different M. tuberculosis strains.
In embodiments of the invention, described mycobacterium tuberculosis is H37Rv.
In embodiments of the invention, the disease caused by described m tuberculosis infection refers to tuberculosis; Described tuberculosis comprises pulmonary tuberculosis and the outer tuberculosis of lung, and the outer tuberculosis of described lung is such as tuberculosis of bone and joint, tuberculous meningitis, renal tuberculosis, tuberculosis of intestine, tuberculosis of urinary system etc.
In the present invention, described albumen has good immunogenicity, and method well known in the art can be utilized to prepare monoclonal antibody or polyclonal antibody.Such as albumen can be mixed with the immunological adjuvant of significant quantity, be injected in animal such as horse, sheep, Mice Body, to prepare antibody.
Meanwhile, because albumen of the present invention can effective stimulus vivo immuning system, produce specific immune response, generate specific antibody, albumen of the present invention can be prepared into vaccine, for the disease of preventing or treating tubercule bacillus to cause.
In the present invention, described " specific binding " has immunologic general sense, such as, be the combination between antigen, antibody.
In the present invention, the described sample for detecting mycobacterium tuberculosis or diagnosis of tuberculosis can be such as the blood, sputum, tissue, lymphocyte etc. of detected person.
The beneficial effect of the invention
The present invention screens 21 kinds and has good immunogenic mycobacterium tuberculosis protein, and its susceptibility be combined with m tuberculosis infection patients serum, specificity are good, are better than 38kDa albumen.Described albumen can be used for the diagnosis of m tuberculosis infection patient, or as the vaccine of antigen for the preparation of preventing/treating m tuberculosis infection.
Accompanying drawing explanation
Fig. 1 primary dcreening operation albumen Western blot response intensity distribution schematic diagram, wherein Rv0934 is 38kDa albumen.
Western blot after Figure 21 2 kinds of protein purifications schemes; Wherein swimming lane 1 is Protein Marker: pre-dyed Protein Marker (Fermentas, #SM0671), and swimming lane 2-13 is expressing protein, and swimming lane 14 is bovine serum albumin (BSA), and swimming lane 15 is 38kDa albumen, and albumen applied sample amount is 100ng.
Embodiment
Below in conjunction with embodiment, embodiment of the present invention are described in detail, but it will be understood to those of skill in the art that the following example only for illustration of the present invention, and should not be considered as limiting scope of the present invention.Unreceipted actual conditions person in embodiment, the condition of conveniently conditioned disjunction manufacturers suggestion is carried out.Agents useful for same or the unreceipted production firm person of instrument, being can by the conventional products of commercial acquisition.
The Gateway technology of Invitrogen company be the restructuring of albumen and expression provide this may, it creates Gateway from PCR primer
tMentry clones.This method is by merging attB site on upstream and downstream primer, then jointly hatching pcr amplification product and pDONR
tM(comprising attP site) and Gateway
tMbP Clonase
tMenzyme mixture.Then be transformed in intestinal bacteria, will obtain the entry clones comprising goal gene, goal gene both sides have attL recombination site simultaneously.This entry clones can with Gateway
tMobject carrier pDEST17 carries out recombinant expressed, rapidly and efficiently obtain target protein ([3] Walhout AJ, Temple GF, Brasch MA.et al.GATEWAY recombinational cloning:application to the cloning of large numbers of open reading frames or ORFeomes.Methods Enzymol, .2000, 328:575-592. [4] Rachael M.Goldstone, Nicole J.Moreland, Ghader Bashiri, et al.A new Gateway_vector and expression protocol for fast and efficient recombinant protein expression in Mycobacterium smegmatis.Protein Expression and Purification57 (2008) 81-87. [5] A high throughput screen to identify secreted and transmembrane proteins involved in Drosophila embryogenesis.PNAS1998, 95, 9973-9978)
Embodiment 1: the amplification of M. tuberculosis genes and the expression of albumen
1. experimental technique
The acquisition of 1.1 goal gene
1.1.1 according to open reading frame (ORFs) gene order of mycobacterium tuberculosis (MTB) H37Rv, primer sequence is designed with Primer designer, according to the design of primers scheme of Gateway system, for primer sequence adds attB arm, completed the synthesis of primer by Beijing Xin Qingke company.
Wherein forward attB primer arm is:
GGGGACAAGTTTGTACAAAAAAGCAGGCTTC（SEQ ID NO：41）；
Reverse attB primer arm is:
GGGGACCACTTTGTACAAGAAAGCTGGGTCCTA（SEQ ID NO：42），
Complete design of primers, illustrate as shown in table 1.
1.1.2 the acquisition of gene order
Extract H37Rv(ATCC27294, derive from Beijing tuberculosis prophylaxis and control institute) genomic dna, with H37Rv genome for template, to increase different ORFs with the forward and reverse primer that with the addition of attB arm, table 1 is the example of part primer.
Table 1 partial synthesis primer table
PCR system is:
50 μ LPCR systems
(enzyme, damping fluid etc. purchased from Takara company, Dalian)
PCR reaction conditions is: 98 DEG C of warm starts (preliminary examination temperature is 94 DEG C), 97 DEG C of sex change 1min, and 60 DEG C of annealing 1min, 72 DEG C extend 3min, 30 circulations.Last 72 DEG C of incubations, 30min.
1.1.3DNA agarose gel electrophoresis
Get 5 μ L pcr amplification products and carry out electrophoresis at 0.8% sepharose, with DNA Marker DL2,000 makes standard molecular weight, observes electrophoresis result, and take pictures under ultraviolet lamp.
1.1.4PCR the recovery of product, is undertaken by QIAquick spin test kit operation instructions.
Obtain 3536 goal gene altogether.
The BP reaction of 1.2Gateway system
1.2.1 restructuring creates Gateway from PCR primer
tMthe another kind of method of entry clones.This method is by merging attB site on upstream and downstream primer, then jointly hatching pcr amplification product and pDONR
tMcarrier (comprising attP site) and Gateway
tMbP Clonase
tMenzyme mixture.Then be transformed in intestinal bacteria, obtain the entry clones comprising goal gene, goal gene both sides have attL recombination site simultaneously.This entry clones can with any Gateway
tMobject carrier is recombinated.
Reaction system establishes positive control simultaneously, pEXP7-tet50ng/ μ L, and get 1 μ L, all the other are mended with water.Be below reaction system:
AttB-PCR product (>=10ng/ μ L; Final quantity 15 ~ 150ng) 7 μ L
pDONR
TM211 1μL
TE damping fluid, pH8.0 8 μ L
BP Clonase is taken out from cryogenic refrigerator
tMiI enzyme mix melts on ice, and whirlpool concussion secondary, each 2s, adds 2 μ LBP Clonase in every hole sample of above-mentioned reaction system
tMiI enzyme mix, concussion secondary, gentle centrifugation; Sample after centrifugal is put back to cryogenic refrigerator rapidly; Sample takes out rear 25 ° of C overnight incubation; Every hole 2 μ g/ μ L protein kinase K adds 1 μ L, 37 ° of C, 1h, termination reaction.By the reaction product connected, transformation of E. coli competent cell, cultivates.
1.2.2 the qualification of recombinant plasmid is according to reference to civilian molecular cloning ([9] J. Pehanorm Brooker, D.W. Russell chief editor. Molecular Cloning: A Laboratory guide [M] third edition: 1217-1265.) perform, Escherichia coli clones colony inoculation after picking transforms, be dispersed in 50 μ L sterilizing ultrapure waters, 99 DEG C of sex change, be bacterium colony PCR, whether checking is positive colony, separates 25 μ L simultaneously and is seeded in containing (LB substratum) in kalamycin resistance 96 orifice plate; 37 DEG C of overnight incubation, prepare to extract plasmid.The selection of bacterium colony PCR primer: according to pDONR221 plasmid, the amplification of this bacterium colony is from M13 phage, select M13 forward primer: GTAAAACGACGGCCAGT(SEQ ID NO:101), reverse primer: CAGGAAACAGCTATGAC(SEQ ID NO:102), positive control: H37Rv genomic dna 0.5 μ L, under other composition is same, 25 μ L systems, use water polishing; Negative control: do not add bacterium.
25 μ L PCR system
PCR reaction conditions is: 98 DEG C of warm starts, 97 DEG C of sex change 1min, and 60 DEG C of annealing 1min, 72 DEG C extend 3min, 30 circulations.Last 72 DEG C of incubation 30min.
0.8% agarose gel electrophoresis, qualification positive colony bacterium colony (size correct be the positive) is to treat that next step upgrading grain sets up entry clones;
1.2.3 get the correct positive colony of above-mentioned qualification to cultivate, upgrading grain, the plasmid DNA (purification kit is purchased from Millpore, article No.: LSKP09604) obtain purifying in 96 hole V-type base plates after.
Obtain 3372 entry clones altogether.
1.3LR reacts: BP reaction produces entry clones, and LR reaction contains the recombining reaction between the entry clones in attL site and the object carrier comprising attR site.LR reaction produces cloning by expression.Cloning by expression comprises goal gene and the special promotor of object carrier or some elements.
1.3.1 reaction system, establishes positive control pENTR simultaneously
tM-gus(kalamycin resistance)
Entry clones (50 ~ 150ng) 7 μ L
Object carrier (150ng/ μ L, pDEST17) 1 μ L
TE pH of buffer 8.0 8 μ L
1.3.2 LR Clonase is taken out from cryogenic refrigerator
tMiI enzyme mix melts on ice, and whirlpool concussion secondary, each 2s, every hole sample of above-mentioned reaction system adds 2 μ L LR Clonase
tMiI enzymemix, concussion secondary, gentle centrifugation; By LR Clonase
tMiI enzyme mix puts back to cryogenic refrigerator rapidly; 25 ° of C overnight incubation; Every hole adds 2 μ g/ μ L protein kinase K 1 μ L, termination reaction.By the reaction product connected, transformed competence colibacillus cell
1.3.3 plasmid extraction is the same, verifies positive findings with expression plasmid PCR, 25 μ L systems, the selection of primer: attB recovers in site,
Forward primer attB1:GGGG-ACA AGT TTG TAC AAA AAA GCA GGC TTC(SEQ ID NO:103)
Reverse primer attB2:
GGGG-AC-CAC-TTT-GTC-CAA-GAA-AGC-TGG-GTC-CTA（SEQ ID NO：104）。
Positive control: H37Rv genomic dna 0.5 μ L, under other composition is same, with water polishing 25 μ L.Negative control: do not add DNA.
25 μ LPCR systems
PCR reaction conditions is same 1.1.2.
0.8% agarose gel electrophoresis, qualification positive colony bacterium colony (size correct be the positive) namely obtains cloning by expression.
Obtain 3245 cloning by expressions altogether.
Cloning by expression is transformed into expression strain by 1.4
The expression plasmid of the above-mentioned qualification positive, with amicillin resistance, is transformed into expression strain BL21(DE3 by the expression plasmid 1.4.1 carrying goal gene) and carry chlorampenicol resistant BL21-
in competent cell, picking mono-clonal bacterium colony, be inoculated in the LB liquid containing different resistance, 37 DEG C, 200r/min, spends the night;
1.4.2IPTG abduction delivering
The bacterium liquid 50 μ L1:20 got in 96 orifice plates of overnight growth in 1.4.1 is diluted to 1mL LB(Amp resistance) 96 orifice plates (2 plate) in, 37 DEG C of culturing bacterium, 300r/min, about 3 ~ 4h, to OD600=0.6 ~ 0.8
Isopropyl-beta D-thio galactopyranoside (IPTG) induction step:
Getting 100mM adds in 96 orifice plates, to final concentration IPTG1mM (200x dilution), such as, adds 5 μ L in l mL substratum.It is Amp resistance culture base in 96 orifice plates
One plate 37 DEG C, 250r/min, overnight induction, a plate 28 DEG C, 250r/min, overnight induction, if the negative control and the gus positive control that do not add IPTG.Then 4 DEG C, the centrifugal 5min of 3950r/min, abandons supernatant, after carry out the process of loading sample.
Note: totally four abduction delivering conditions, 2 bacterial strain BL21(DE3), BL21-
2 temperature 28 DEG C, 37 DEG C.
1.4.3SDS polyacrylamide gel electrophoresis
Upper strata: concentrated glue (staking or concertration gel) 5% pH of buffer 6.8,
Lower floor: separation gel (separation or resolving gel) 12% pH of buffer 8.8
Get the loading sample that 1.4.2 obtains, carry out SDS-PAGE gel electrophoresis.
Coexpression protein 19 16.
2 results
By above each step, obtain 3536 goal gene altogether, 3372 entry clones, 3245 cloning by expressions, expressing protein 1916, table 2 is the function distribution of expressing protein.
The function distribution of table 2 expressing protein
As seen from the above table, expressing protein has good fraction of coverage to full-length genome.
The purifying of embodiment 2 expressing protein
Protein purification is the prerequisite of carrying out downstream experiment, can comprise thousands of different proteins after procaryotic cell expression, and some content are very abundant, and some are only containing several copy.In order to study some protein, first this protein must be purified from other protein and non-proteinaceous molecule the false positive that the foreign protein that can remove external source causes, the protein requirement of high-efficiency high-purity by high-throughout protein purification.Expressing protein of the present invention is the prokaryotic expression containing 6His label, therefore adopts the avidity of His.Tag sequence adjacent sets propylhomoserin and immobilization metal nickel ion to carry out purifying.Purification kit is 96-well plates His MultiTrap FF (GE healthcare, USA).
2.1 bacterial classifications bring back to life and amplification
Prepare bacterial classification recovery and the required LB substratum of amplification, after its cooling, adding corresponding microbiotic, (penbritin stores concentration 50mg/mL, working concentration 50 μ g/mL; Paraxin stores concentration 50mg/mL, working concentration 34 μ g/mL), protein expression strain kind embodiment 1 identified is taken out from cryogenic refrigerator, and after thawing, often 10 μ L bacterial classifications inoculated by pipe.37 DEG C, 200r/min, spends the night.
Bacterial classification amplification, expression and fungi preservation: in amplification LB, add respective concentration microbiotic equally, 1:50 increases (optionally 1:20), about 2 hours stay the LB of 1mL not added with antibiotic to do negative control to OD600 value 0.6(, connect arbitrarily a bacterium for measuring OD value).During bacterial classification OD600 value to 0.6, first respectively get 1mL bacterium liquid and do and do not induce contrast, all the other add IPTG final concentration is 1 mmole, according to former inductive condition 37 DEG C or 28 DEG C, and 200r/min, induction 12 ~ 16 hours of spending the night.Residue bacterium liquid is for preserving bacterial classification, and each two manage.(final glycerol concentration 15%)
2.2 first get 2mL, 4 DEG C, 6000r/min, 15min collecting precipitation from the rear bacterium liquid of induction, be dissolved in 100 μ L pure water, contrast after doing induction. all the other bacterium liquid 4 DEG C, 6000r/min, 15min collect bacterial sediment, stay 200 μ L supernatants, concentrated, detect whether belong to secreted protein.
2.3 precipitations are weighed, and dissolve with 5 ~ 10mL lysate/g.
2.4 add 0.1mg/mL N,O-Diacetylmuramidase, 1mM phenylmethylsulfonyl fluoride (PMSF) (final concentration), the nuclease of 10 units, and 4 DEG C are stirred 30min.
2.5 ultrasonic degradation.10sec is ultrasonic, 10sec interval, totally 10 ~ 15 minutes.Note operating on ice always.
Often a ultrasonic sample, thoroughly cleans probe.
2.64 DEG C, 12000r/min, 20min collect supernatant liquor and precipitation respectively.
On first getting before carrying out purifying, cleer and peaceful precipitation does solubility qualification, determines purification process according to albumen distribution.
2.7 cracking supernatant liquors can be directly used in purifying, note: stay 30 μ L supernatant liquors to contrast.Precipitation is dissolved again with washings, and washing once.
2.84 DEG C, 12000r/min, 20min collecting precipitation, weighs, and again dissolves with binding buffer liquid (containing 8M urea), 10 ~ 20mg/mL, room temperature effect 1 hour.
2.94 DEG C, 12000r/min, 20min collect sex change supernatant liquor, are directly used in purifying, stay 30 μ L to contrast.
2.10 filler mixtures are anticipated, ethanol sedimentation, with pure water rinsing once, damping fluid balance.
2.11 cracking supernatant liquors and sex change supernatant liquor through 0.45um membrane filtration, with appropriate filler in conjunction with 1 hour.(cracking supernatant liquor should be placed on ice always)
2.12 collection effluent liquid.
2.13, with binding buffer liquid washing 1 ~ 2 time, collect washings respectively.
2.14, with 1mL different concns elution target protein, collect elutriant respectively.
2.15SDS-PAGE analyze.
2.16BCA test kit protein quantification (Thermo Scientific Pierce BCA Protein Assay Kit).
By test kit procedure operation.
2 results
Purifying obtains 1600 albumen altogether, and remaining 316 albumen does not obtain in purge process, and reason may be as follows:
1. purge process presses inclusion body purification, if soluble proteins may be lost; 2. large scale purification does not carry out purifying again to these albumen again; 3. may be that expression amount is very low, small volume purifying can not get.
Embodiment 3west blot analyzes
Western Blot technology is the fixing of a kind of protein and analytical technology, to move on on nitrocellulose with the protein transduction of polyacrylamide gel or other gel or electrophoretic separation, the protein component be fixed on filter membrane still retains antigenic activity and the ability with other macromole specific binding, so can be combined with specific antibody or nucleic acid, first antibody is after specific antigen is combined on film, detect with two anti-(isotropic substance or non isotopic enzymes) of mark, this method can detect 1ng antigen protein again.
Patient samples, from Shenzhen the 3rd the People's Hospital, be the people that cures the disease at the beginning of diagnosis of tuberculosis, ELISpot test (ELIAPOT) is positive, get 200 parts of tuberculosis patient serum sample mixing, the western blot primary antibodie in reacting for primary dcreening operation after intestinal bacteria antibody.
(GenBank accession number is 38kDa: NC_000962.2, gi:15608080) the most conventional, the commercial diagnostic kit antigen developed the earliest. very effective to the diagnosis of active tuberculosis, its shortcoming is larger to the sensitivity fluctuation of different crowd, especially to smear negative tubercular and poor ([6] the Franco J. of tubercular's effect merging HIV, Camarena J.J., Nogueira J.M., et al.Serological response (Western blot) to fractions of Mycobacterium tuberculosis sonicate antigen in tuberculosis patients and contacts.INT J TUBERC LUNG DIS5 (10): 958 – 962. [7] Renuka R., Sujiai Suneetha., Karuna Sagili.et al.Diagnostic role of the antibody response to the38kDa, 16kDa proteins and lipoarabinomannan of mycobacterium tubculosis.Indian Journal of Clinical Biochenistry.2005,20 (1) 123-128.).Therefore this experiment is with 38kDa as positive control, detects the antigen immune effect of antigen expressed.
1 purifying protein western blot
The albumen that 1.1 Example 2 purifying obtain carries out SDS-PAGE electrophoresis, and Positive control wells 38kDa antigen protein (Immuno Diagnostics Inc.USA) and negative control hole BSA are also established in applied sample amount 100ng/ hole.
1.2 transferring films: SDS-PAGE electrophoresis, the gel after electrophoresis, not dyed, be directly transferred on NC film, with 0.65mA/cm with Bio-RAD company Mini Trans-Blot Electrophoretic Cell transfer device by charged for albumen
2electricity transfer printing 50min.
1.3 close: the rinsing in TBS of NC film once, then is put it into and can be added in the hybridizing box of heat sealing, with filter membrane area 0.1-0.15mL/cm
2amount add confining liquid (TBST containing 2%BSA), 4 DEG C are spent the night.
1.4 primary antibodies (sample blood plasma) process: get 200 parts of tuberculosis patient serum sample mixing, for western blot primary antibodie after removing intestinal bacteria antibody.
1.5 and an anti-binding: abandon confining liquid, film is taken out, nitrocellulose filter is transferred in new hybridizing box, by 0.1-0.15mL/cm
2amount add with TBST dilution primary antibodie (1: 500), lie against incubation at room temperature 1h on shaking table.TBST washes 3 times, each 5min.
1.6 and two anti-bindings: filter membrane is transferred in new hybridization bag, by 0.1-0.15mL/cm
2amount add with TBST with the fluorescently-labeled goat-anti people two anti-(Alexa Fluor647, oddyssey) of 1: 10000 dilution, incubation at room temperature 1h.TBST washes 3 times, and each 5.2 times are washed again, each 5min with TBS.
1.7 sweep film: carry out sweeping film with Odyessey scanner, single passage wavelength 700nm, resolving power 169.
1.8 by the quantity one software analysis of bio-rad scanning gray scale, and analytic sample is antigen reactive power compared with 38kDa antigen protein, and using the ratio (ratio) of expressing protein and 38kDa as the power judging to react.
1.9 12 albumen getting primary dcreening operation reaction stronger repeat western blot, carry out multiple sieve.Tuberculosis patient serum is pressed into group personnel situation and is divided into two groups: active tuberculosis 5 people, outer tuberculosis 10 people of lung, each patient's blood plasma removes intestinal bacteria antibody respectively, is then respectively used to detect.It is same that by analysis scan gray scale, analytic sample is antigen reactive power compared with 38kDa antigen protein, and using the ratio (ratio) of expressing protein and 38kDa as the power judging to react.
2 results
In the Western blot result of primary dcreening operation, what have clear band has 516 albumen, wherein 118 and 38kDa(Rv0934) gray scale is than more than 40%, 29 are better than 38kDa(and see Fig. 1, table 3), the relevant information of these 29 albumen is in table 4, and the Western blot sieving 12 albumen again the results are shown in Figure 2.The ratio of the Western blot gray scale that 12 albumen sieves again and 38kDa albumen is in table 5.
The Western blot gray scale of table 329 albumen and the ratio of 38kDa albumen
29 albumen lists after table 4 primary dcreening operation
Through verification, repeatedly verify in albumen outside Rv0487, Rv0612, Rv2147c, Rv3242c, Rv3261, Rv3359, Rv3406c, Rv3637 for 29, other all have no report for diagnosis lungy.
The multiple sieve different group candidate of table 5 and 38kDa response intensity ratio
Can find out, sieve result again and conform to primary dcreening operation result, these albumen can as the molecular marker of diagnosis of tuberculosis.
Although the specific embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.According to disclosed all instructions, can carry out various amendment and replacement to those details, these change all within protection scope of the present invention.Four corner of the present invention is provided by claims and any equivalent thereof.
Claims (10)
1. the albumen be separated, it is selected from following albumen: Rv0388c, Rv0415, Rv0493c, Rv0582, Rv0695, Rv0813c, Rv0819, Rv0891c, Rv1095, Rv1131, Rv1455, Rv1675c, Rv1853, Rv1864c, Rv2234, Rv2961, Rv3052c, Rv3102c, Rv3707c, Rv3767, Rv1773c and albumen identical with above-mentioned 21 kinds of protein functions in different mycobacterium tuberculosis.
2. the albumen of claim 1, it is selected from the albumen of aminoacid sequence respectively as shown in SEQ ID NO:1 ~ SEQ ID NO:20, SEQ ID NO:105.
3. the nucleic acid be separated, the albumen of its coding described in claim 1 or 2; Such as, the nucleotide sequence of described nucleic acid is respectively as shown in SEQ ID NO:21 ~ SEQ ID NO:40, SEQ ID NO:106.
4. recombinant vectors, it contains nucleic acid according to claim 3.
5. reconstitution cell, it contains carrier according to claim 4.
6. antibody, it can specifically in conjunction with the albumen described in claim 1 or 2; Such as, described antibody is monoclonal antibody or polyclonal antibody.
7. composition (such as pharmaceutical composition or vaccine composition), it contains the antibody of the albumen of claim 1 or 2, the nucleic acid of claim 3, the recombinant vectors of claim 4, the reconstitution cell of claim 5 or claim 6.
8. test kit or detection reagent, it contains the albumen of claim 1 or 2 or the antibody of claim 6, described test kit or detection reagent are for detecting mycobacterium tuberculosis (such as H37Rv) or such as, diagnosis for the disease (such as tuberculosis, the outer tuberculosis of pulmonary tuberculosis or lung) caused by m tuberculosis infection.
9. the albumen of claim 1 or 2 or the purposes of the antibody of claim 6 in such as, medicine (such as vaccine) for the preparation of the disease (such as tuberculosis, the outer tuberculosis of pulmonary tuberculosis or lung) caused by prevention or treatment m tuberculosis infection.
10. the albumen of claim 1 or 2 or the antibody of claim 6 are for the preparation of detecting mycobacterium tuberculosis or such as, for the purposes in the test kit of the disease (such as tuberculosis, the outer tuberculosis of pulmonary tuberculosis or lung) caused by diagnosis of tuberculosis mycobacterial infections or detection reagent.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710902126.1A CN107478849B (en) | 2013-05-31 | 2013-05-31 | Albumen for diagnosis of tuberculosis and prevention |
| CN201310209991.XA CN104211787A (en) | 2013-05-31 | 2013-05-31 | Protein for diagnosis and prevention of tuberculosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310209991.XA CN104211787A (en) | 2013-05-31 | 2013-05-31 | Protein for diagnosis and prevention of tuberculosis |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710902126.1A Division CN107478849B (en) | 2013-05-31 | 2013-05-31 | Albumen for diagnosis of tuberculosis and prevention |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104211787A true CN104211787A (en) | 2014-12-17 |
Family
ID=52093723
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310209991.XA Pending CN104211787A (en) | 2013-05-31 | 2013-05-31 | Protein for diagnosis and prevention of tuberculosis |
| CN201710902126.1A Active CN107478849B (en) | 2013-05-31 | 2013-05-31 | Albumen for diagnosis of tuberculosis and prevention |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710902126.1A Active CN107478849B (en) | 2013-05-31 | 2013-05-31 | Albumen for diagnosis of tuberculosis and prevention |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN104211787A (en) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104530201A (en) * | 2015-01-30 | 2015-04-22 | 孙丽华 | Specific antigen protein for diagnosing tuberculosis and application thereof in preparing diagnosis kit |
| CN105388300A (en) * | 2015-12-01 | 2016-03-09 | 中国医学科学院病原生物学研究所 | Tuberculosis immunodiagnosis molecular marker and vaccine use thereof |
| CN106606774A (en) * | 2016-11-24 | 2017-05-03 | 中国医学科学院病原生物学研究所 | Tuberculosis immunodiagnosis molecular marker and application thereof in preparation of vaccines |
| CN107281465A (en) * | 2017-06-02 | 2017-10-24 | 中国医学科学院病原生物学研究所 | A kind of tuberculosis vaccine component of candidate and the vaccine containing the component |
| CN108396069A (en) * | 2018-02-12 | 2018-08-14 | 武汉大学 | Applications of the Rv1773c in the drug for preparing Killing Mycobacterium Tuberculosis infection |
| CN108918891A (en) * | 2018-07-23 | 2018-11-30 | 首都医科大学附属北京胸科医院 | Tuberculoprotein and its application with human protein NRF1 interaction |
| CN108948175A (en) * | 2018-07-23 | 2018-12-07 | 首都医科大学附属北京胸科医院 | Tuberculoprotein and its application with human protein SMAD2 interaction |
| CN112143798A (en) * | 2020-09-30 | 2020-12-29 | 中国医学科学院病原生物学研究所 | Application of NT5C3A as tuberculosis diagnosis molecular marker |
| CN115920003A (en) * | 2022-08-31 | 2023-04-07 | 中国医学科学院病原生物学研究所 | Lipoprotein lprG and application of lipoprotein lprG gene as mycobacterium tuberculosis drug target |
| US11795199B2 (en) | 2017-07-31 | 2023-10-24 | Seoul National University R&Db Foundation | Peptide targeting Mycobacterium tuberculosis toxin-antitoxin system and use thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1599751A (en) * | 2001-02-22 | 2005-03-23 | 巴斯德研究院 | Comparative mycobacterial geneomics as a tool for identifying targets for the diagnosis, prophylaxis or treatment of mycobacterioses |
| CN1888069A (en) * | 2006-07-13 | 2007-01-03 | 复旦大学 | Recombinant protein Rv3425 and its application of in preparing tuberculosis kit |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006029248A2 (en) * | 2004-09-04 | 2006-03-16 | Haper Laboratories Llc | Hollow fiber technique for in vivo study of cell populations |
| HUE039159T2 (en) * | 2008-07-25 | 2018-12-28 | Glaxosmithkline Biologicals Sa | The tuberculosis rv2386c protein, compositions and uses thereof |
| CN101661044B (en) * | 2008-08-27 | 2013-10-16 | 复旦大学附属华山医院 | Diagnostic reagent of tuberculosis and kit |
| CN103063843A (en) * | 2011-10-20 | 2013-04-24 | 上海交通大学医学院 | Specific marker of mycobacterium tuberculosis and application thereof |
-
2013
- 2013-05-31 CN CN201310209991.XA patent/CN104211787A/en active Pending
- 2013-05-31 CN CN201710902126.1A patent/CN107478849B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1599751A (en) * | 2001-02-22 | 2005-03-23 | 巴斯德研究院 | Comparative mycobacterial geneomics as a tool for identifying targets for the diagnosis, prophylaxis or treatment of mycobacterioses |
| CN1888069A (en) * | 2006-07-13 | 2007-01-03 | 复旦大学 | Recombinant protein Rv3425 and its application of in preparing tuberculosis kit |
Non-Patent Citations (2)
| Title |
|---|
| COLE S. T.等: "Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence", 《NATURE》 * |
| GENPEPT: "probable PPE protein - Mycobacterium tuberculosis (strain H37RV)", 《GENPEPT》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104530201A (en) * | 2015-01-30 | 2015-04-22 | 孙丽华 | Specific antigen protein for diagnosing tuberculosis and application thereof in preparing diagnosis kit |
| CN105388300A (en) * | 2015-12-01 | 2016-03-09 | 中国医学科学院病原生物学研究所 | Tuberculosis immunodiagnosis molecular marker and vaccine use thereof |
| CN106606774A (en) * | 2016-11-24 | 2017-05-03 | 中国医学科学院病原生物学研究所 | Tuberculosis immunodiagnosis molecular marker and application thereof in preparation of vaccines |
| CN107281465A (en) * | 2017-06-02 | 2017-10-24 | 中国医学科学院病原生物学研究所 | A kind of tuberculosis vaccine component of candidate and the vaccine containing the component |
| US11795199B2 (en) | 2017-07-31 | 2023-10-24 | Seoul National University R&Db Foundation | Peptide targeting Mycobacterium tuberculosis toxin-antitoxin system and use thereof |
| CN108396069A (en) * | 2018-02-12 | 2018-08-14 | 武汉大学 | Applications of the Rv1773c in the drug for preparing Killing Mycobacterium Tuberculosis infection |
| CN108918891A (en) * | 2018-07-23 | 2018-11-30 | 首都医科大学附属北京胸科医院 | Tuberculoprotein and its application with human protein NRF1 interaction |
| CN108948175A (en) * | 2018-07-23 | 2018-12-07 | 首都医科大学附属北京胸科医院 | Tuberculoprotein and its application with human protein SMAD2 interaction |
| CN112143798A (en) * | 2020-09-30 | 2020-12-29 | 中国医学科学院病原生物学研究所 | Application of NT5C3A as tuberculosis diagnosis molecular marker |
| CN115920003A (en) * | 2022-08-31 | 2023-04-07 | 中国医学科学院病原生物学研究所 | Lipoprotein lprG and application of lipoprotein lprG gene as mycobacterium tuberculosis drug target |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107478849A (en) | 2017-12-15 |
| CN107478849B (en) | 2019-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104211787A (en) | Protein for diagnosis and prevention of tuberculosis | |
| Brinkman et al. | A novel Treponema pallidum antigen, TP0136, is an outer membrane protein that binds human fibronectin | |
| Oliveira et al. | Suspected needle stick transmission of Bartonella vinsonii subspecies berkhoffii to a veterinarian. | |
| CN101923091B (en) | Kit for detecting high-sensitivity mycobacterium tuberculosis | |
| Fang et al. | Nosocomial transmission of avian influenza A (H7N9) virus in China: epidemiological investigation | |
| Shepherd, AJ,* Swanepoel, R.,* Shepherd, SP,* Leman, PA,* Blackburn, NK* & Hallett | A nosocomial outbreak of Crimean-Congo haemorrhagic fever at Tygerberg Hospital-Part V. Virological and serological observations | |
| CN109182167B (en) | Production process of high titer tuberculin skin test diagnostic reagent (PPD) | |
| CN113045677A (en) | Recombinant fusion protein and application thereof in tuberculosis diagnosis | |
| Lasrado et al. | Identification of immunogenic epitopes that permit the detection of antigen-specific T cell responses in multiple serotypes of group B coxsackievirus infections | |
| Meny et al. | Characterization of Leptospira isolates from humans and the environment in Uruguay | |
| CN107091932B (en) | Tuberculosis immunodiagnosis molecular marker and its medical usage | |
| Hama et al. | An ancient coronavirus from individuals in France, circa 16th century | |
| Exley et al. | Identification of meningococcal genes necessary for colonization of human upper airway tissue | |
| Pearce et al. | Development of a novel canine parvovirus vaccine capable of stimulating protective immunity in four-week-old puppies in the face of high levels of maternal antibodies | |
| Wilson et al. | A new multivalent (DHPPi/L4R) canine combination vaccine prevents infection, shedding and clinical signs following experimental challenge with four Leptospira serovars | |
| CN104151411B (en) | Albumen and pharmaceutical composition for diagnosis of tuberculosis | |
| CN105037561B (en) | A kind of fusion protein CMFO and its application | |
| CN103864907B (en) | Albumen and test kit for diagnosis of tuberculosis | |
| Mazboudi et al. | A recombinant virus-like particle vaccine against adenovirus-7 induces a potent humoral response | |
| Ellis et al. | In vivo expression technology identifies a novel virulence factor critical for Borrelia burgdorferi persistence in mice | |
| Xiao et al. | Genetic sequencing of a 1944 Rocky Mountain spotted fever vaccine | |
| RU2640192C1 (en) | Elisa test system for segological diagnostics of cattle nodulous dermatitis - dermatitis nodularis bovum | |
| CN106405113A (en) | Specific marker for detecting potential tuberculosis and application of specific marker | |
| CN113087778B (en) | Preparation method and application of Chlamydia psittaci polytype outer membrane protein PmpG protein | |
| CN108276494B (en) | Mycobacterium tuberculosis allergen composition and the preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20141217 |