CN104195200A - Method for preparing monosialotetra-hexosylganglioside (GM1) by applying recombinant sialidase converted gangliosides (GLS) - Google Patents
Method for preparing monosialotetra-hexosylganglioside (GM1) by applying recombinant sialidase converted gangliosides (GLS) Download PDFInfo
- Publication number
- CN104195200A CN104195200A CN201410441305.6A CN201410441305A CN104195200A CN 104195200 A CN104195200 A CN 104195200A CN 201410441305 A CN201410441305 A CN 201410441305A CN 104195200 A CN104195200 A CN 104195200A
- Authority
- CN
- China
- Prior art keywords
- sialidase
- restructuring
- gls
- sialo
- sphingolipids
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention provides a method for preparing monosialotetra-hexosylganglioside (GM1) by applying recombinant sialidase converted gangliosides (GLS). The method comprises the following steps: 1) providing a free recombinant sialidase which is a protein encoded by a base sequence shown in SEQ ID NO: 1; and 2) mixing the recombinant sialidase obtained in the step 1) with GLS so as to convert the GLS into the GM1. By virtue of total synthesis of a full-length gene of the sialidase, soluble expression of the sialidase is successfully realized in escherichia coli. The recombinant sialidase is high in specific activity and low in preparation cost. Moreover, the method can be further used for removing the inhibiting effect of sialic acid by adopting dialysis to in-situ separate a product sialic acid to promote reaction, so that the high concentration GLS is fully converted into the GM1.
Description
Technical field
The invention belongs to enzymatic conversion method and prepare single saliva tetrahexose Sphingolipids,sialo field, relate more specifically to a kind of restructuring sialidase that uses and transform the method that many ganglioside sialic acids are prepared single saliva tetrahexose Sphingolipids,sialo.
Background technology
Sphingolipids,sialo are containing sialic sphingoglycolipid.First nineteen forty-two Klenk finds this compounds, therefore named Sphingolipids,sialo in ganglion cell.Sphingolipids,sialo are made up of ceramide, oligosaccharides and sialic acid.The contained oligosaccharides of Sphingolipids,sialo is a species specific tetrose connecting with β-glycosidic link.Tetrose is linked in sequence by semi-lactosi (Gal), N-acetylgalactosamine (N-GalNAC), semi-lactosi and glucose (Glu), is finally connected with ceramide (Cer) by glucosyl residue.The sialic acid residues of Sphingolipids,sialo is all connected on the galactosyl of oligosaccharides, its number from without (asialoganglioside) to four or more not etc.From cerebral tissue, isolated at present more than 30 kind of Sphingolipids,sialo, its name adopts Svennerholm method conventionally, and main contents comprise: (1): represent Sphingolipids,sialo with capitalizing " G "; (2) represent respectively containing 0-7 sialic acid with A, M, D, T, Q, P, H, S; (3) represent containing identical sialic acid but the Sphingolipids,sialo of different sugar radix by the difference of (5-glycosyl number); (4) represent sialic connecting portion with a, b, c.
Figure below illustrates each several part implication in a Sphingolipids,sialo abbreviation title.
Sphingolipids,sialo are almost present in all mammal tissues, and the quality and quantity of different germlines, tissue and iuntercellular Sphingolipids,sialo is widely different.Rich content in neural system, especially in ectocinerea, content is the highest, arrives 2.5 μ mol n acetylneuraminic acid n/gram weight in wet bases (2% or total lipid of dry weight 5%).The same with other glycosphingolipid, Sphingolipids,sialo are mainly present in the outside of cell serous coat, and lipophilic acyl sphingosine is embedded in the lipid bilayer of film, and hydrophilic radical (carbohydrate) part protrudes from extracellular fluid.As the acceptor of membrane antigen and virus, bacterium and toxin, many ganglioside sialic acids (GLS) are in cell recognition, and cell adhesion, regulates cellular immunization, determine that the aspects such as blood group play very important effect.The ceramide (ceramide) that Sphingolipids,sialo hydrolysis produces, is a kind of inhibition second messenger, participates in various kinds of cell function, has the Growth of Cells of adjusting, variation, apoptosis, regulates protein excretion, participates in the functions such as immunologic process and inflammatory reaction.Wherein contain a sialic GLS and be called single saliva tetrahexose Sphingolipids,sialo (GM1), it can pass through blood cerebrospinal fluid barrier, assemble impaired brain district and embed cytolemma, imitating endogenous GM1 plays a role, can promote the neural remodeling of neurocyte existence, axon growth and cynapse growth, recover the function of the central nervous system injury causing due to a variety of causes, and also have active effect to damaging rear Secondary cases nerve degeneration and cerebral edema.China in 1996 has introduced from Argentinian TRB Pharma company the GM1 injection liquid that utilizes pig brain to produce, and commodity are called Sygen (GM-1), are used for the treatment of the encephalopathy such as craniocerebral injury, nerve degeneration, parkinson's syndrome.
The production technique of current single saliva tetrahexose Sphingolipids,sialo (GM1) adopts separating extraction program separation and purification from cerebral tissue such as solvent extraction, acid system hydrolysis and column chromatography to obtain GM1 monomer mostly.Single saliva tetrahexose Sphingolipids,sialo (GM1) are generally present in natural ganglioside mixture with about 10% content, and it is uneconomic therefore therefrom separating GM1.The method is prepared GM1 need to consume a large amount of organic solvents, and cost is high, and remains a large amount of many ganglioside sialic acids and cannot apply, and is a kind of very large waste.
Transforming many ganglioside sialic acids mixture generation GM1 with microbial enzyme method and chemical method is the most feasible current commercial run.Transform with respect to acid system, utilize microorganism and sialidase conversion method production GM1 to there is specificity high, the advantages such as reaction conditions gentleness, many ganglioside sialic acids can be converted into GM1 in specific manner, extract and separate the conversion that rear unconverted many ganglioside sialic acids still can be used for next batch, in sample after transforming, contain hardly three sialic GT1a and GT1b, only containing a small amount of two sialic GD1a and GD1bGD component, changing effect is obviously better than sour conversion method, and has reduced solvent consumption.And the cost of microorganism culturing and conversion process is low, can significantly improve production efficiency, reduce the production cost of GM1.
The pseudomonas that utilizes a strain to produce sialidase in US Patent No. 5756314A can transform efficiently many ganglioside sialic acids and produce GM1, and inoperative to GM1.This pseudomonas separates and obtains from ocean, and it had relatively low pathogenic to the mankind at that time.But be used in the process of scale production GM1 and still have very large risk.
In European patent EP 0540790A1, utilize the immobilized sialidase of agarose to transform many ganglioside sialic acids and produce GM1, this sialidase is separated from clostridium perfringens.The immobilized sialidase of agarose is compared with free, and the pH stability of immobilized enzyme is better.Main advantage is to reuse, very large this resolvase of saving expensive.But cost comes still very high relatively.Be not suitable for applying in scale operation GM1.
In sum, in prior art, the preparation of GM1 is had to following defect: 1) directly from ganglioside mixture, separate and obtain GM1, make many ganglioside sialic acid wastes, cost is high; 2) acid system conversion requirement high temperature and converted product complexity, and substrate conversion amount is less than 2% (w/v), and transformation efficiency only has 50%-70%; 3) produce the original bacterium of sialidase and transform many ganglioside sialic acids product GM1, in reaction system, material is very assorted, may have human body pathogenic; 4) the sialidase expression amount of original bacterium is low, and unit enzyme is lived low, the sialidase process complexity of the original bacterium of purifying, and the cost that uses free original bacterium sialidase to transform many ganglioside sialic acids is higher; 5) sialidase transforms in GLS reaction and has serious sialic acid restraining effect, causes low conversion rate.
Summary of the invention
The object of this invention is to provide a kind of restructuring sialidase that uses and transform the method that many ganglioside sialic acids are prepared single saliva tetrahexose Sphingolipids,sialo, thereby solve above-mentioned defect of the prior art.
In order to solve the problems of the technologies described above, the present invention by the following technical solutions:
Provide a kind of restructuring sialidase that uses to transform the method that many ganglioside sialic acids (GLS) are prepared single saliva tetrahexose Sphingolipids,sialo (GM1), comprise the following steps: 1) a kind of free restructuring sialidase is provided, and described restructuring sialidase is the albumen by the brevibacterium casei sialidase base sequence coding shown in SEQ ID NO:1; And 2) by step 1) in restructuring sialidase mix with many ganglioside sialic acids, described many ganglioside sialic acids are converted into single saliva tetrahexose Sphingolipids,sialo.
Described many ganglioside sialic acids are to provide with ganglioside mixture form.
Described restructuring sialidase is by by the brevibacterium casei sialidase base sequence connection carrier shown in SEQ ID NO:1 the albumen that carries out solubility expression acquisition in intestinal bacteria.
Described step 2) further comprise and adopt the method for film dialysis to remove reaction product sialic acid.
The molecular weight cut-off of described film dialysis is 10000-50000kDa.
Described dialyzate is the sodium-acetate buffer of the pH5.5 of 50mM.
The temperature of described conversion reaction is controlled at 30～40 DEG C, is preferably 37 DEG C.
The full-length gene of the complete synthesis brevibacterium casei sialidase of first passage of the present invention, then restructuring sialidase plasmid transformation escherichia coli structure being obtained has successfully been realized the solubility expression of sialidase, provides a kind of restructuring sialidase that uses to transform the method that many ganglioside sialic acids are prepared single saliva tetrahexose Sphingolipids,sialo.
The method is compared with microbial transformation GLS, and reaction system is simple, and restructuring sialidase intestinal bacteria genetic background is clear, is conducive to the separation and purification of downstream GM1, is applicable to being applied to production pharmaceutical intermediate GM1; Compared with transforming GLS with free original bacterium sialidase, free restructuring sialidase specific activity prepared by the present invention is high, and preparation cost is low, and restructuring sialidase expression amount is high, and with His label, available affinitive layer purification obtains pure enzyme, and preparation method is simple.
Secondly, many ganglioside sialic acids (GLS) that the present invention utilizes restructuring sialidase to transform in ganglioside mixture generate single single saliva tetrahexose Sphingolipids,sialo (GM1), only need gentle conversion condition, can utilize to greatest extent again many ganglioside sialic acids mixture, and can further remove sialic restraining effect by the employing original position separated product sialic acid of dialysing, promote reaction to carry out to product direction, thereby the GLS of high density is converted into GM1 completely.
Brief description of the drawings
Fig. 1 is the pcr amplification electrophorogram of brevibacterium casei sialidase full-length gene;
Fig. 2 is the SDS-PAGE electrophorogram of broken wall supernatant before and after restructuring sialidase process escherichia coli expression, and wherein, swimming lane 1 is for before inducing, and swimming lane 2 is for inducing after 12h, and M is Marker.
Embodiment
Below in conjunction with specific embodiment, the present invention will be further described.Should be understood that following examples are only for the present invention is described but not for limiting the scope of the invention.
1. materials and methods
1.1 instruments and analysis condition
Seed culture, yeast culture carry out on conventional rotational oscillation formula shaking table.
TLC analyzes: the sample taking out at regular intervals, and sample chloroform: methyl alcohol: the ratio processing sample of sample (4:8:3, V/V/V), get 10 μ L point samples in tlc silica gel plate HSGF254.Developing agent is trichloromethane: anhydrous methanol: 0.2%CaCl2 (55:45:9, v/v/v), exhibition layer finishes rear with Resorcinol-HCl-Cu
2+be sprayed onto equably on silica-gel plate, cover sheet glass, then put 100 DEG C of colour developing 20-30min colour developing, the conversion situation of the many ganglioside sialic acids of qualitative observation.
The mensuration that sialidase enzyme is lived: using 4-MU-NeuAc (4-methylumbelliferyl-N-acetylneuraminic) as measuring enzyme false bottom thing.Accurately draw 10 μ L 1mM 4-MU-NeuAc, 10 μ L sialidase solution to be measured, the sodium acetate buffer of 80 μ L 200mmol/L pH 5.5, adds 200 μ L 1mol/L pH 10.4 glycine-sodium hydrate buffer solution termination reactions after 37 DEG C of reaction 10min.Under wavelength 355nm/460nm, detect the fluorescent value of 4-methylumbelliferone (4-MU) with fluorescence microplate reader.Sialidase enzyme is lived and is detected fluorescent value and is directly proportional.With the enzyme liquid that boils in contrast.Per minute is hydrolyzed 1 μ mol substrate and is defined as a Ge Meihuo unit (U/mL).
2. implementation method
2.1 substratum
LB substratum: Yeast extract 5g/L; Tryptone 10g/L; NaCl 10g/L, 7.0,121 DEG C of sterilizing 20min of pH.
Fermention medium: Yeast extract 5g/L; Tryptone 10g/L; NaCl 10g/L, glycerol6g/L, 2.4g/L KH
2pO
4, 12.5g/L K
2hPO
43H
2o, 7.0,121 DEG C of sterilizing 20min of pH.
The structure of 2.2 restructuring sialidase plasmids
2.2.1 the complete synthesis and PCR of brevibacterium casei sialidase gene
Be the gene order (2925bp of the disclosed brevibacterium casei sialidase of HQ650539 according to the upper accession number of Genebank, 973 amino acid of encoding), as shown in SEQ ID NO:1, by Shanghai Jierui Biology Engineering Co., Ltd, this fragment gene sequence is carried out complete synthesisly, obtained the full length sequence of this brevibacterium casei sialidase.
Introduce respectively the primer of restriction enzyme Nde I and Hind III restriction enzyme site according to the full-length gene order design two ends that obtain, this primer sequence respectively following (being synthesized by Shanghai Jierui Biology Engineering Co., Ltd):
Sia-NdeI：GGAATTCCATATGGTGGTGGGAAGGAGTGCAGGAA
Sia-HindⅢ：CCCAAGCTTCTACCCTTGGGGCGTTAC
PCR reaction system (50 μ l): (5U/ μ is 0.5 μ l l), dNTP Mixture (2.5mM each) 8 μ l, 10 × LA PCR Buffer, 5 μ l, the each 1 μ l of primer sia-F and sia-R, ddH for TaKaRa LA Taq
2o up to 50 μ l.PCR condition: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s; 55 DEG C of annealing 1min; 72 DEG C are extended 4min; 30 circulations; 72 DEG C of 10min.Whether agarose gel electrophoresis glue checking has the fragment of object size, and as shown in Figure 1, and glue reclaims and connects pMD19-T carrier and send further checking of order-checking result.
2.2.2 the recombinate structure of sialidase plasmid
According to the full length sequence obtaining, amplify full length sequence and be built into recombinant plasmid pET-28a-sia with pET-28a, two ends are with his label.Then recombinant plasmid is imported in E.coli Rosetta (DE3).
First, glue reclaims object fragment, extract empty pET-28a (+) plasmid, detect their nucleic acid concentration, with restriction enzyme Nde I and Hind III respectively enzyme cut object fragment and pET-28a (+) plasmid, object fragment endonuclease reaction system is (30 μ l): 10 × K Buffer, 3 μ l; Target DNA fragment < 200ng; The each 1 μ l of Nde I and Hind III enzyme; Add ddH
2o is to 30 μ l.PET-28a (+) plasmid enzyme restriction reaction system (20 μ l): 10 × K Buffer, 2 μ l; PET-28a (+) plasmid 1000ng; The each 1 μ l of Nde I and Hind III enzyme; Add ddH
2o is to 20 μ l, and carrier enzyme does two single endonuclease digestion contrasts while cutting, and reaction conditions is all 37 DEG C, 2h.
Then, enzyme is cut product Normal Agarose Gel, and enzyme is cut and successfully carried out glue recovery, and measures respectively enzyme and cut the object fragment of rear glue recovery and the concentration of plasmid.Carry out ligation, ligation system (10 μ l): T4 ligase enzyme 1 μ l; T4Buffer 1 μ l; Mol ratio (5 ﹕ 1) the 8 μ l of object fragment and plasmid, 16 DEG C of water-bath reaction overnight.
Finally, get ligation liquid 5 μ l and carry out whether successful connection of agarose gel electrophoresis checking, what be proved to be successful is added to residual reaction liquid 5 μ l in the E.coli DH5 α competent cell of 100 μ l, be placed in 30 minutes on ice, 42 DEG C of heat shock 90s, be placed on rapidly cooled on ice 2min, then add the LB liquid nutrient medium of 800 aseptic μ l.37 DEG C, 160rpm cultivates 1 hour.Then the centrifugal 2min of nutrient solution 3000rpm, sops up the supernatant of 700 μ l, blows and beats gently resuspended thalline with liquid-transfering gun.Then be applied on the LB solid plate that contains 50 μ g/ml, cultivate 12-16 hour.
Picking list bacterium colony is squeezed into 10 μ l ddH
2o, carries out bacterium colony PCR checking, filters out positive colony list bacterium colony.Bacterium colony PCR reaction system (25 μ l): single bacterium colony suspension 1 μ l; (5U/ μ is 0.5 μ l l) for r-Taq polysaccharase; DNTP Mixture (2.5mM each) 2 μ l; 10 × PCR Buffer, 2.5 μ l; Primer T7 (20 μ M) and the each 0.5 μ l of T7ter (20 μ M); ddH
2o 18 μ l.PCR condition: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s; 55 DEG C of annealing 1min; 72 DEG C are extended 4min; 30 circulations; 72 DEG C of 10min.Single colony inoculation of agarose gel electrophoresis checking positive colony, in the LB liquid nutrient medium of 5ml, is cultivated 12h, gets 1ml and send order-checking to keep sample to be kept in the EP pipe of 25% glycerine simultaneously.
2.2.3 the recombinate expression of sialidase
The restructuring sialidase intestinal bacteria of above-mentioned acquisition are inoculated in LB substratum, are then transferred in fermention medium with 3% inoculum size, 37 DEG C, 200rpm cultivates bacterium liquid OD600 and reaches 0.4-0.6.Then add the IPTG of 0.2mM, temperature is adjusted to 16 DEG C of low temperature induction 12h.Get before induction with induction after thalline broken wall supernatant SDS-PAGE whether analyze solubility expression.Result as shown in Figure 2.
2.2.4 recombinate sialidase activity detect
With fluorescent substance 2 '-(4-Methylumbelliferyl)-α-D-N-acetylneuraminic acid sodium salt hydrate (Sigma-Aldrich, USA) for substrate detects sialic activity, first preheating microplate reader temperature reaches 37 DEG C, in 96 orifice plates, add 80 μ l sodium-acetate buffer (200mM, pH 5.5), 10 μ l sample solutions and 10 μ l 1mM substrates, while, sample was boiled to 3min or pure water does blank, after 37 DEG C of reaction 10min, add glycine-sodium hydrate buffer solution (1M of 200 μ l, pH10.4) termination reaction.Generate 4-Methylumbelliferyl with fluorescence owing to being hydrolyzed sialic acid, finally at excitation wavelength 355nm, under emission wavelength 460nm condition, detect fluorescent value, fluorescent value Ji Meihuo unit, the 4-Methylumbelliferyl that per minute hydrolysis generates 1nmol is defined as a Ge Meihuo unit (U).
2.2.5 the recombinate purifying of sialidase
Collect the thalline after induction, broken wall is got supernatant, with the Histrap-FF-crude column purification of 5ml, and containing pure restructuring sialidase under the buffer solution elution of 200mM imidazoles.Purifying damping fluid is: 20mM phosphoric acid salt (10mM Na
2hPO
42H
2o, 10mM NaH
2pO
4h
2o), 500mM NaCl.
The preparation of 2.3GM1
2.3.1 the sialidase of recombinating dialysis transforms GLS
A certain amount of restructuring sialidase and Sphingolipids,sialo mixture are put into pretreated dialysis tubing (10000-50000kDa), then dialysis tubing is put into the beaker that dialyzate is housed, be placed on magnetic stirring apparatus, 200rpm, 37 DEG C of reactions (30～40 DEG C), timing sampling TLC detects conversion results.Dialyzate and reaction solution damping fluid are the sodium-acetate buffer of 50mM pH5.5.In conversion process, need to add the kantlex of 100 μ g/mL, prevent the impact of microorganism in conversion process.
2.3.2GM1 HPLC detect
Instrument model: Agilent 1100series
Chromatographic column model: DIKMA Insertil 5um 4.5 × 250mm
Moving phase: A acetonitrile: 5mM phosphate buffered saline buffer (pH 5.6) 83:17, V/V
B acetonitrile: 20mM phosphate buffered saline buffer (pH 5.6) 1:1, V/V
Testing conditions: 205nm, 40 DEG C, 1ml/min
Embodiment
Embodiment 1:
Dialysis tubing 10mL reaction system, adds the Sphingolipids,sialo mixture of 100g/L, the restructuring sialidase of 10000U/mL, and dialysis system is 200mL, transforms 12h, the GLS in Sphingolipids,sialo mixture can change into GM1 completely.In mixture, the content of GM1 brings up to 38.17% from 8%.
Embodiment 2:
Dialysis tubing 100mL reaction system, adds the Sphingolipids,sialo mixture of 120g/L, the restructuring sialidase of 10000U/mL, and dialysis system is 2L, transforms 12h, the GLS in Sphingolipids,sialo mixture can change into GM1 completely.In mixture, the content of GM1 brings up to 36.22% from 8%.
Above-described, be only preferred embodiment of the present invention, not in order to limit scope of the present invention, the above embodiment of the present invention can also make a variety of changes.Be that simple, the equivalence that every claims according to the present patent application and description are done changes and modify, all fall into the claim protection domain of patent of the present invention.The present invention not detailed description be routine techniques content.
Claims (7)
1. use restructuring sialidase to transform the method that many ganglioside sialic acids are prepared single saliva tetrahexose Sphingolipids,sialo, it is characterized in that, comprise the following steps:
1) provide a kind of free restructuring sialidase, described restructuring sialidase is the albumen by the brevibacterium casei sialidase base sequence coding shown in SEQ ID NO:1; And
2) by step 1) in restructuring sialidase mix with many ganglioside sialic acids, described many ganglioside sialic acids are converted into single saliva tetrahexose Sphingolipids,sialo.
2. method according to claim 1, is characterized in that, described many ganglioside sialic acids are to provide with ganglioside mixture form.
3. method according to claim 1, is characterized in that, described restructuring sialidase is by by the brevibacterium casei sialidase base sequence connection carrier shown in SEQ ID NO:1 the albumen that carries out solubility expression acquisition in intestinal bacteria.
4. method according to claim 1, is characterized in that, described step 2) further comprise and adopt the method for film dialysis to remove reaction product sialic acid.
5. method according to claim 4, is characterized in that, the molecular weight cut-off of described film dialysis is 10000-50000kDa.
6. method according to claim 4, is characterized in that, described dialyzate is the sodium-acetate buffer of the pH5.5 of 50mM.
7. method according to claim 1, is characterized in that, the temperature of described conversion reaction is controlled at 30～40 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410441305.6A CN104195200A (en) | 2014-09-01 | 2014-09-01 | Method for preparing monosialotetra-hexosylganglioside (GM1) by applying recombinant sialidase converted gangliosides (GLS) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410441305.6A CN104195200A (en) | 2014-09-01 | 2014-09-01 | Method for preparing monosialotetra-hexosylganglioside (GM1) by applying recombinant sialidase converted gangliosides (GLS) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104195200A true CN104195200A (en) | 2014-12-10 |
Family
ID=52080565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410441305.6A Pending CN104195200A (en) | 2014-09-01 | 2014-09-01 | Method for preparing monosialotetra-hexosylganglioside (GM1) by applying recombinant sialidase converted gangliosides (GLS) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104195200A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591116A (en) * | 2016-11-22 | 2017-04-26 | 大连大学 | Reaction device capable of eliminating inhibiting effect of enzymolysis product on enzymatic activity |
| CN110592164A (en) * | 2019-09-23 | 2019-12-20 | 东北师范大学 | Preparation method of monosialotetrahexosyl ganglioside |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1570080A (en) * | 2004-05-12 | 2005-01-26 | 华东理工大学 | Single sialic acid tetrahexose ganglioside preparation method |
| EP2011799A1 (en) * | 2007-06-18 | 2009-01-07 | Laboratoire Medidom S.A. | Process for obtaining pure monosialoganglioside GM1 for medical use |
| CN102154416A (en) * | 2011-01-18 | 2011-08-17 | 山东新时代药业有限公司 | Immobilized microbial cell method for converting ganglioside |
-
2014
- 2014-09-01 CN CN201410441305.6A patent/CN104195200A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1570080A (en) * | 2004-05-12 | 2005-01-26 | 华东理工大学 | Single sialic acid tetrahexose ganglioside preparation method |
| EP2011799A1 (en) * | 2007-06-18 | 2009-01-07 | Laboratoire Medidom S.A. | Process for obtaining pure monosialoganglioside GM1 for medical use |
| CN102154416A (en) * | 2011-01-18 | 2011-08-17 | 山东新时代药业有限公司 | Immobilized microbial cell method for converting ganglioside |
Non-Patent Citations (2)
| Title |
|---|
| SHEN，D.等: "GenBank:HQ650539", 《NCBI GENEBANK》 * |
| 沈丹红: "重组唾液酸酶在转化多唾液酸神经节苷脂中的应用", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591116A (en) * | 2016-11-22 | 2017-04-26 | 大连大学 | Reaction device capable of eliminating inhibiting effect of enzymolysis product on enzymatic activity |
| CN110592164A (en) * | 2019-09-23 | 2019-12-20 | 东北师范大学 | Preparation method of monosialotetrahexosyl ganglioside |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111172220B (en) | Fermentation production of oligosaccharides | |
| Belcarz et al. | The novel non-glycosylated invertase from Candida utilis (the properties and the conditions of production and purification) | |
| Tao et al. | Biotechnological production and applications of N-acetyl-D-neuraminic acid: current state and perspectives | |
| CN103509729B (en) | A kind of produce the construction method of coenzyme Q10 engineering bacteria, engineering bacteria and application thereof | |
| Curiel et al. | Hydrolysis of tannic acid catalyzed by immobilized− stabilized derivatives of tannase from Lactobacillus plantarum | |
| Caputi et al. | Biomolecular characterization of the levansucrase of Erwinia amylovora, a promising biocatalyst for the synthesis of fructooligosaccharides | |
| Huang et al. | Highly efficient synthesis of fructooligosaccharides by extracellular fructooligosaccharide-producing enzymes and immobilized cells of Aspergillus aculeatus M105 and purification and biochemical characterization of a fructosyltransferase from the fungus | |
| CN103228781B (en) | Biotechnological production of chondroitin | |
| CN104195200A (en) | Method for preparing monosialotetra-hexosylganglioside (GM1) by applying recombinant sialidase converted gangliosides (GLS) | |
| Tang et al. | Characterization of SepE and SepF for the N 6-glycosylated adenine structure formation in septacidin biosynthesis | |
| Shah et al. | Strategy for purification of aggregation prone β-glucosidases from the cell wall of yeast: a preparative scale approach | |
| Eneva et al. | High production of neuraminidase by a Vibrio cholerae non-O1 strain—The first possible alternative to toxigenic producers | |
| Park et al. | Enzymatic synthesis of piceid glucosides using maltosyltransferase from Caldicellulosiruptor bescii DSM 6725 | |
| Das et al. | Purification and reconstitution into proteoliposomes of the F1F0 ATP synthase from the obligately anaerobic gram-positive bacterium Clostridium thermoautotrophicum | |
| CN113462669B (en) | Ketone pantoic acid hydroxymethyl transferase mutant, coding gene and application thereof | |
| JP5314955B2 (en) | Novel microorganism, inulinase, inulin degrading agent, method for producing inulooligosaccharide, and method for producing inulinase | |
| BR0005798A (en) | Process for fermentative preparation of amino acids using corineform bacteria | |
| Rodrigues et al. | A unique β-1, 2-mannosyltransferase of Thermotoga maritima that uses di-myo-inositol phosphate as the mannosyl acceptor | |
| Guo et al. | Identification and functional characterization of intracellular sialidase NeuA3 from Streptomyces avermitilis | |
| JPH01281082A (en) | Neuraminidase isozyme s and production of gangliosides | |
| Song et al. | Enhancement of bioconversion gangliosides to monosialotetrahexosylganglioside by in situ sialic acid removal and recovery | |
| JP6997079B2 (en) | Composition for medium | |
| JP3035602B2 (en) | Process for producing lysosphingolipids and novel Rhodococcus microorganisms used in the process | |
| CN104293843A (en) | Method for preparing haemolytic sphingolipid by efficiently hydrolyzing sphingolipid | |
| JP2688854B2 (en) | Method for producing α-galactosidase with strong transglycosylation activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20141210 |
|
| WD01 | Invention patent application deemed withdrawn after publication |