CN104163871A - Anti-tumor specific splicing factor and preparation method thereof - Google Patents
Anti-tumor specific splicing factor and preparation method thereof Download PDFInfo
- Publication number
- CN104163871A CN104163871A CN201410393625.9A CN201410393625A CN104163871A CN 104163871 A CN104163871 A CN 104163871A CN 201410393625 A CN201410393625 A CN 201410393625A CN 104163871 A CN104163871 A CN 104163871A
- Authority
- CN
- China
- Prior art keywords
- seq
- specificity
- splicing factor
- pcr product
- taking
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an anti-tumor specific splicing factor. A preparation method of the anti-tumor specific slicing factor is characterized by comprising the following steps that a PCR product A is obtained by taking human cell cDNA as a template and taking sequences as shown in SEQ. ID. No 3 and SEQ. ID. No. 4 as primers; a PCR product B is obtained by taking the human cell cDNA as the template and taking sequences as shown in SEQ. ID. No 5 and SEQ. ID. No. 6 as primers; a PCR product C is obtained by taking the human cell cDNA as the template and taking sequences as shown in SEQ. ID. No 7 and SEQ. ID. No. 8 as primers; a PCR product D is obtained by taking the human cell cDNA as the template and taking sequences as shown in SEQ. ID. No 9 and SEQ. ID. No. 10 as primers; the PCR product A is fused with the PCR product B to obtain a specific splicing factor I as shown in SEQ. ID. No. 1; the PCR product C is fused with the PCR product D to obtain the specific splicing factor II as shown in SEQ. ID. No. 2.
Description
Technical field
The present invention relates to a kind of antitumor drug and preparation method, especially an abnormal alternative splicing for tumour VEGF be can be used for controlling, the antineoplastic specificity splicing factor and the preparation method that suppress tumor-blood-vessel growth and further suppress tumour progression reached.
Background technology
It is found that at present, tumour cell is except genome sequence sudden change, also there is a significant biological property, be a large amount of gene by the montage one-tenth hypotype contrary with normal function (abnormal alternative splicing), this is also that tumour epigenetics changes the key link that causes cell phenotype to change.Existingly be used for the abnormal alternative splicing event of gene in malignant tumour and mainly realize by antisense nucleic acid technique, be delivered in human body by antisense nucleotide, suppress but not the alternative splicing of promotion goal gene mRNA precursor, thereby control the aberrant splicing event occurring in some gene mRNA precursor, but its application has certain limitation.
An important foundation of metastases is the generation that distal vessels in the tumour of nutrient is provided for metastases, by tumor cell secretion multiple protein factor activator a series of correlative protein expression around, promote new vessel to generate, and vascular endothelial growth factor (VEGF-A) is a kind of important stimulus angiogenesis factor of tumor cell secretion.Research recently shows that the different spliceosomes of VEGF-A gene have reverse functions in angiogenesis, a kind of spliceosome (VEGF-A
xxx) promote vasculogenesis, and the spliceosome (VEGF-A of another kind of new qualification
xxxb) but can suppress blood vessel occur.In normal human subject tissue, except placenta, VEGF-A is mainly with VEGF-A
xxxbhypotype exists, and VEGF-A suppresses vasculogenesis in adult's tissue like this.But in tumour cell, VEGF-A is mainly with VEGF-A
xxxhypotype exists, and induction of vascular generates, and increases vascular permeability, promotes tumor development, and forms the neoplasm metastasis of far-end, so by suppressing VEGF-A
xxxthe generation of hypotype can provide a kind of oncotherapy means that check vasculogenesis.
But, if adopt the inhibition means such as existing antisense nucleic acid technique, will all suppress two kinds of spliceosomes that promote vasculogenesis and inhibition vasculogenesis without distinction, and as after the function of VEGF-A all suppressed, in body, other signal transduction pathway can be brought into play compensation and promote tumour progression.
Up to now, there is not yet and utilize specificity splicing factor to regulate and control two kinds of spliceosomes of VEGF by targeting, to realize the report that suppresses tumor-blood-vessel growth and further check malignant tumour progress.
Summary of the invention
The present invention is in order to solve the existing above-mentioned technical problem of prior art, a kind of abnormal alternative splicing that can be used for controlling tumour VEGF is provided, reaches the antineoplastic specificity splicing factor and the preparation method that suppress tumor-blood-vessel growth and further suppress tumour progression.
Technical solution of the present invention is: a kind of antineoplastic specificity splicing factor, is characterized in that: be made up of specificity splicing factor I and specificity montage factor II, the sequence of described specificity splicing factor I is as shown in SEQ.ID.No.1; The sequence of described specificity montage factor II is as shown in SEQ.ID.No.2.
A preparation method for above-mentioned antineoplastic specificity splicing factor, is characterized in that carrying out as follows:
A. taking human cell cDNA as template, taking sequence shown in SEQ.ID.No.3 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.4 as downstream primer, obtain PCR product A; Taking human cell cDNA as template, taking sequence shown in SEQ.ID.No.5 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.6 as downstream primer, obtain PCR product B.
B. taking human cell cDNA as template, taking sequence shown in SEQ.ID.No.7 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.8 as downstream primer, obtain PCR product C; Taking human cell cDNA as template, taking sequence shown in SEQ.ID.No.9 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.10 as downstream primer, obtain PCR product D.
C. obtained PCR product A and PCR product B are merged mutually, obtain specificity splicing factor I; Obtained PCR product C and PCR product D are merged mutually, obtain specificity montage factor II.
Specificity splicing factor provided by the invention, comprising can be in conjunction with the specific recognition sequence of RNA, can suppress abnormal Alternative spliceo some VEGF-A
xxxfunctional sequence and promote Alternative spliceo some VEGF-A
xxxbfunctional domain sequence, can control the abnormal alternative splicing of tumour VEGF, promote Alternative spliceo some VEGF-A
xxxbsynthetic, thereby reach the effect that suppresses tumor-blood-vessel growth and further suppress tumour progression.
Brief description of the drawings
Fig. 1 is that specificity splicing factor I promotes VEGF-A
xxxbthe design sketch that spliceosome is synthetic.
Fig. 2 is the design sketch that specificity splicing factor I suppresses cultured tumor cells in vitro growth.
Fig. 3 is that specificity splicing factor I suppresses the design sketch that cultured tumor cells in vitro clone forms.
Fig. 4 is that specificity splicing factor I suppresses cultured tumor cells in vitro anchorless dependency colony formation ability design sketch.
Fig. 5 is specificity splicing factor I inhibition tumor cell migration effect figure.
Fig. 6 is that specificity splicing factor I suppresses extracorporeal blood vessel endotheliocyte microtubule formation design sketch.
Fig. 7 is that specificity splicing factor I is to tumor killing effect figure in tumor bearing nude mice body.
Embodiment
Embodiment 1:
A. utilize polymerase chain amplified reaction (PCR), taking the cDNA that obtains after the RNA reverse transcription extracting from human cell as template, taking sequence shown in SEQ.ID.No.3 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.4 as downstream primer, obtain PCR product A, VEGF-A is inhibited
xxxthe functional domain sequence that spliceosome is synthetic; Again taking obtain human cell cDNA as template, taking sequence shown in SEQ.ID.No.5 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.6 as downstream primer, obtain PCR product B, obtain specific RNA recognition structure territory sequence;
B. taking the human cell cDNA that obtained as template, taking sequence shown in SEQ.ID.No.7 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.8 as downstream primer, obtain PCR product C, be promoted VEGF-A
xxxbthe functional domain sequence that spliceosome is synthetic; Again taking obtain human cell cDNA as template, taking sequence shown in SEQ.ID.No.9 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.10 as downstream primer, obtain PCR product, obtain specific RNA recognition structure territory sequence;
C. obtained PCR product A and PCR product B are merged mutually, obtain specificity splicing factor I, sequence is as shown in SEQ.ID.No.1; Obtained PCR product C and PCR product D are merged mutually, obtain specificity montage factor II, sequence is as shown in SEQ.ID.No.2.
Experiment:
The montage regulation and control experiment of the specificity splicing factor I of experimental example 1 embodiment of the present invention to vascular endothelial growth factor VEGF-A
Action principle is as shown in Figure 1A: specificity splicing factor I can be used near-end 3 ' splice site to promote VEGF-A by inhibition
xxxbsynthesizing of spliceosome; Specificity montage factor II is making for increasing VEGF-A by promotion far-end 3 ' splice site
xxxbthe generation of spliceosome.
Utilize human lung adenocarcinoma cell line A549 to set up the clone of specificity splicing factor transient expression, and the further alternative splicing regulation and control of detection specificity splicing factor I to tumour cell VEGF.
Lung carcinoma cell is pressed to 1.2x10
5/ well is inoculated in 24 orifice plates, cultivates after 12hr, by the specificity splicing factor I of different concns (1ug, 2ug, the 5ug) embodiment of the present invention, mixes mutually and transient transfection cell with lipofectamine 2000; Then continue to cultivate 48hr, collecting cell, and be divided into two parts.A copy of it utilizes TRizol reagent to extract total RNA, and utilizes reverse transcription test kit (RTIII, Invitrogen) to obtain cDNA, the afterwards antipodal spliceosome (VEGF-A of two kinds of functions using 2ul cDNA as template amplification VEGF-A
xxxand VEGF-A
xxxb), finally carry out scanning analysis by Typhoon machine and the content of two kinds of spliceosomes is carried out quantitatively.Result as shown in Figure 1B, VEGF-A
xxxbthe content of spliceosome is obviously greater than negative control group, when especially concentration is 5ug, and VEGF-A
xxxbthe content of spliceosome can reach 10 times of negative control group.A part of cell utilizes protein cleavage liquid to extract total protein in addition, utilizes afterwards Western Blot to detect vascular endothelial growth factor and suppresses vasculogenesis spliceosome VEGF-A
xxxbcontent, result as shown in Figure 1 C: containing VEGF-A in the experimental group of specificity splicing factor I of the present invention
165bcontent be obviously greater than negative control group.
Negative control group is the same with experimental group, is the clone of setting up specificity splicing factor transient expression with human lung adenocarcinoma cell line A549.Specificity splicing factor used is also made up of two portions, wherein a part is for to have the not homotactic RNA binding domains of identification with the specificity splicing factor I of experimental group, and another one structural domain is the sequence consistent with the functional domain of specificity splicing factor I.This negative control group specificity splicing factor used sequence is as shown in SEQ.ID.No.11.
Result shows: although this negative control also has the functional domain of regulation and control montage, its RNA recognition structure territory but can not be in conjunction with VEGF gene, thereby does not have function.
Specificity splicing factor I is brought into play function by specific binding, has good targeting, can promote VEGF-A in significance ground
xxxbthe symphysis of spliceosome becomes.
Experimental example 2: specificity splicing factor I suppresses the experiment of cultured tumor cells in vitro growth
By the breast cancer cell (10 of difference stably express specificity splicing factor 1 and negative control
5) plant respectively in 10cm Tissue Culture Dish, every two days collecting cells are also counted, and to the 9th day, change and draw growth curve afterwards, as shown in Figure 2 according to the cell count multiple with respect to the inoculating cell same day (the 0th day).Result shows that specificity splicing factor I can suppress breast cancer tumour Growth of Cells in significance ground.
Experimental example 3: specificity splicing factor I suppresses the experiment that cultured tumor cells in vitro clone forms
The lung carcinoma cell (5000) of difference stably express specificity splicing factor I and negative control is planted respectively in 10cm Tissue Culture Dish, hatch after 2 weeks at 37 DEG C, utilize formaldehyde to fix the cell clone of formation, and utilize violet staining.Result is as shown in Figure 3: compare with negative control, specificity splicing factor I can suppress the clonality of lung carcinoma cell significantly.
Experimental example 4: specificity splicing factor I suppresses the experiment of cultured tumor cells in vitro anchorless dependency colony formation ability
After mixing, isopyknic 1.2% agar and 2x DMEM be laid in the bottom-layer agar that forms 0.6% in 6 orifice plates.By breast cancer cell and the agar of stably express specificity splicing factor I and negative control mix the cell agar mixed solution that formation final concentration is 0.3% respectively, plant afterwards on bottom-layer agar, this 6 orifice plate is placed in to the moist incubator of 37 DEG C, cultivate and within 3 weeks, utilize formaldehyde fixed cell afterwards, and with counting after violet staining, as shown in Figure 4: result demonstration, the anchorless dependency colony that specificity splicing factor I can suppress to significance breast cancer cell forms ability.
Experimental example 5: the experiment of specificity splicing factor I inhibition tumor cell migration
Respectively by the breast cancer cell kind of stably express specificity splicing factor I and negative control in 6 orifice plates, in the time that cell density reaches 90%, utilize aseptic rifle head to draw a line in the bottom of Tissue Culture Dish, and take pictures to analyze the transfer ability of tumour cell respectively at the 0h after line and 16h, as shown in Figure 5.Result shows that specificity splicing factor I can suppress the distant place transfer ability of breast cancer cell.
Experimental example 6: specificity splicing factor I suppresses the experiment that extracorporeal blood vessel endotheliocyte microtubule forms
The substratum respectively lung carcinoma cell of stably express specificity splicing factor I and negative control being produced is collected, after being filtered, this substratum joins in human umbilical endothelial cell (HUVEC), testing conditions substratum forms the ability of microtubule in vitro to vascular endothelial cell, as shown in Figure 6.Result shows compared with negative control, and the microtubule that the conditioned medium that the lung carcinoma cell of stably express specificity splicing factor I produces can significance suppresses vascular endothelial cell forms ability.
Above result shows, the application of specificity splicing factor I can promote to suppress the synthetic of vasculogenesis spliceosome by the alternative splicing of modulating vascular endothelial cell growth factor (ECGF) veritably, and then checks the progress of tumour.
Embodiment 7: specificity splicing factor I is to tumor suppression experiment in tumor bearing nude mice body
Get 6 female Nu/Nu (Charles River Laboratories:NU-Foxn1nu) nude mice, conformity certification number: SCXK (capital) 2007-0001), 4 week age, body weight is 13～15g, and every nude mice left side lower limb skin hemostasis volume is that people's lung cancer A549 cell suspension of processing through specificity splicing factor I as experimental example 1 of 200 μ l (contains 1 × 10
7individual cell), and the people's lung cancer A549 cell suspension processed through negative control as experimental example 1 that is 200 μ l at every nude mice right side lower limb skin hemostasis volume (contains 1 × 10
7individual cell), after injection, observe a nude mice become knurl situation every day; There were 2 obviously to become knurl by the 5th day, had 6 to become knurl by the 8th day; When to 21 days, put to death nude mice, take out their knurl piece, detect the size of the tumour that forms in nude mouse, result as shown in Figure 7, shows that specificity splicing factor I can suppress to significance the formation of nude mice in-vivo tumour.
In body, tumor suppression experimental result shows, in whole experimentation, between each nude mice body weight, there is no difference, and P>0.05 can think that specificity splicing factor I does not have a significant effect to nude mice growth, also illustrates that it does not have obvious toxic-side effects; Specificity splicing factor I can obviously delay the tumor growth of tumor bearing nude mice, and with control group comparison, the average knurl volume of nude mice all has significance, P<0.05 from the 8th day difference; Within the 21st day, execution nude mice survey knurl weighs and also obtains the result same with knurl volume, and this is consistent with experiment in vitro result above.
Described in experimental group 2 ~ 7 of the present invention, the mode of setting up of negative control is all identical with experimental example 1.
Sequence table
<110> Dalian Medical Univ
The antineoplastic specificity splicing factor of <120> and preparation method
<160> 11
<210> 1
<211> 532
<212> RNA
<213> specificity splicing factor
<400> MDYKDDDDK gsqrgrgggs gnfmgrggnf gggggnfgrg gnfggrggyg gggggsrgsy gggdggyngf ggdggnyggg pgyssrggyg gggpgygnqg ggygggggyd gyneggnfgg gnyggggnyn dfgnysgqqq snygpmkggs fggrssgspy gggygsgggs ggygsrrf PGILPPKKKRKVSR GRSRLLEDFR NNRYPNLQLR EIAGHIMEFS QDQHGSRFIE LKLERATPAE RQLVFNEILQ AAYQLMVDVF GCRVIQKFFE FGSLEQKLAL AERIRGHVLS LALQMYGCRV IQKALEFIPS DQQNEMVREL DGHVLKCVKD QNGNHVVQKC IECVQPQSLQ FIIDAFKGQV FALSTHPYGC RVIQRILEHC LPDQTLPILE ELHQHTEQLV QDQYGSYVIE HVLEHGRPED KSKIVAEIRG NVLVLSQHKF ANNVVQKCVT HASRTERAVL IDEVCTMNDG PHSALYTMMK DQYASYVVEK MIDVAEPGQR KIVMHKIRPH IATLRKYTYG KHILAKLEKY Y 532
<210> 2
<211> 480
<212> RNA
<213> specificity splicing factor
<400> MDYKDDDDK srrrrsrs rsrshsrsrg rrysrsrsrs rgrrsrsasp rrsrsislrr srsaslrrsr sgsikgsryf qspsrsrsrs rsisrprssr sksrspspkr srspsgsprr saspermd PGILPPKKKRKVSR GRSRLLEDFR NNRYPNLQLR EIAGHIMEFS QDQHGCRFIQ LKLERATPAE RQLVFNEILQ AAYQLMVDVF GSYVIEKFFE FGSLEQKLAL AERIRGHVLS LALQMYGNRV IQKALEFIPS DQQNEMVREL DGHVLKCVKD QNGNHVVQKC IECVQPQSLQ FIIDAFKGQV FALSTHPYGC RVIQRILEHC LPDQTLPILE ELHQHTEQLV QDQYGSYVIE HVLEHGRPED KSKIVAEIRG NVLVLSQHKF ACNVVQKCVT HASRTERAVL IDECVTMNDG PHSALYTMMK DQYACYVVQK MIDVAEPGQR KIVMHKIRPH IATLRKYTYG KHILAKLEKY Y 480
<210> 3
<211> 31
<212> DNA
<213> synthetic
<220>
<230>PCR primer
<400> CACCTCGAGGGATCACAGAGAGGTCGTGGAG 31
<210> 4
<211> 34
<212> DNA
<213> synthetic
<220>
<230>PCR primer
<400> CACGGATCC
CGAACCTTCTGCTACCATATCCACC 34
<210> 5
<211> 45
<212> DNA
<213> synthetic
<220>
<230>PCR primer
<400> CAAGACCAGCATGGGtctTACttcattGagCTGAAACTGGAGCGT 45
<210> 6
<211> 45
<212> DNA
<213> synthetic
<220>
<230>PCR primer
<400> AAGGACCAGTATGCCTCctatgtggtcGagAAGATGATTGACGTG 45
<210> 7
<211> 29
<212> DNA
<213> synthetic
<220>
<230>PCR primer
<400> CACCTCGAGAGCCGGCGAAGAAGAAGCAG 29
<210> 8
<211> 30
<212> DNA
<213> synthetic
<220>
<230>PCR primer
<400> CACGGATCC
CGTCCATTCTTTCAGGACTTG 30
<210> 9
<211> 45
<212> DNA
<213> synthetic
<220>
<230>PCR primer
<400> CAAGACCAGCATGGGtGtagattcattcagCTGAAACTGGAGCGT 45
<210> 10
<211> 45
<212> DNA
<213> synthetic
<220>
<230>PCR primer
<400> AAGGACCAGTATGCCTGcCGtgtggtccagAAGATGATTGACGTG 45
<210> 11
<211> 532
<212> DNA
<213> specificity splicing factor
<400> MDYKDDDDK gsqrgrgggs gnfmgrggnf gggggnfgrg gnfggrggyg gggggsrgsy gggdggyngf ggdggnyggg pgyssrggyg gggpgygnqg ggygggggyd gyneggnfgg gnyggggnyn dfgnysgqqq snygpmkggs fggrssgspy gggygsgggs ggygsrrf PGILPPKKKRKVSR GRSRLLEDFR NNRYPNLQLR EIAGHIMEFS QDQHGSRFIQ LKLERATPAE RQLVFNEILQ AAYQLMVDVF GNYVIQKFFE FGSLEQKLAL AERIRGHVLS LALQMYGSRV IEKALEFIPS DQQNEMVREL DGHVLKCVKD QNGNHVVQKC IECVQPQSLQ FIIDAFKGQV FALSTHPYGC RVIQRILEHC LPDQTLPILE ELHQHTEQLV QDQYGNYVIQ HVLEHGRPED KSKIVAEIRG NVLVLSQHKF ASNVVEKCVT HASRTERAVL IDEVCTMNDG PHSALYTMMK DQYANYVVQK MIDVAEPGQR KIVMHKIRPH IATLRKYTYG KHILAKLEKY Y 532
Claims (2)
1. an antineoplastic specificity splicing factor, is characterized in that: be made up of specificity splicing factor I and specificity montage factor II, the sequence of described specificity splicing factor I is as shown in SEQ.ID.No.1; The sequence of described specificity montage factor II is as shown in SEQ.ID.No.2.
2. a preparation method for antineoplastic specificity splicing factor as claimed in claim 1, is characterized in that carrying out as follows:
A. taking human cell cDNA as template, taking sequence shown in SEQ.ID.No.3 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.4 as downstream primer, obtain PCR product A; Taking human cell cDNA as template, taking sequence shown in SEQ.ID.No.5 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.6 as downstream primer, obtain PCR product B;
B. taking human cell cDNA as template, taking sequence shown in SEQ.ID.No.7 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.8 as downstream primer, obtain PCR product C; Taking human cell cDNA as template, taking sequence shown in SEQ.ID.No.9 as upstream primer, carry out PCR reaction taking sequence shown in SEQ.ID.No.10 as downstream primer, obtain PCR product D;
C. obtained PCR product A and PCR product B are merged mutually, obtain specificity splicing factor I; Obtained PCR product C and PCR product D are merged mutually, obtain specificity montage factor II.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410393625.9A CN104163871A (en) | 2014-08-12 | 2014-08-12 | Anti-tumor specific splicing factor and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410393625.9A CN104163871A (en) | 2014-08-12 | 2014-08-12 | Anti-tumor specific splicing factor and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104163871A true CN104163871A (en) | 2014-11-26 |
Family
ID=51907866
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410393625.9A Pending CN104163871A (en) | 2014-08-12 | 2014-08-12 | Anti-tumor specific splicing factor and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104163871A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010075303A1 (en) * | 2008-12-23 | 2010-07-01 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Splicing factors with a puf protein rna-binding domain and a splicing effector domain and uses of same |
| CN102665731A (en) * | 2009-06-17 | 2012-09-12 | Isis制药公司 | Compositions and methods for modulation of SMN2 splicing in a subject |
-
2014
- 2014-08-12 CN CN201410393625.9A patent/CN104163871A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010075303A1 (en) * | 2008-12-23 | 2010-07-01 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Splicing factors with a puf protein rna-binding domain and a splicing effector domain and uses of same |
| CN102665731A (en) * | 2009-06-17 | 2012-09-12 | Isis制药公司 | Compositions and methods for modulation of SMN2 splicing in a subject |
Non-Patent Citations (2)
| Title |
|---|
| YANG WANG ET AL.: "A complex network of factors with overlapping affinities represses splicing through intronic elements.", 《NATURE STRUCTURAL AND MOLECULAR BIOLOGY》 * |
| 马猛 等: "一个RNA剪接调控元件分类方法的研究", 《中国生物医学工程学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106220736A (en) | A kind of Chimeric antigen receptor, the cell expressing it and its production and use | |
| CN103789309A (en) | Long-chain non-coding RNA IncRNA-BcrAR and application thereof in cell canceration resistance | |
| CN105802909A (en) | T cell prepared product having HER2 specific TCR (human epidermal growth factor receptor-2 specific TCR T cell receptor) and application of T cell prepared product | |
| CN104774929B (en) | The application of diagnosis, treatment and prognosis of the 3p of miR 455 in esophageal squamous cell carcinoma | |
| CN102181399B (en) | Mouse liver tumor cell line for highly expressing CD133 and preparation method thereof | |
| CN101804208A (en) | Application of miR-451 in preparing medicine for treating non-small cell lung cancer | |
| CN104140968A (en) | Radiotherapy-targeted sensitizer and application thereof | |
| CN105412944A (en) | Effect of miR-451a cells in non-small cell lung cancer | |
| CN107326027A (en) | A kind of prna chimera body and application thereof | |
| CN106244679A (en) | MiR 100 inhibitor purposes in reducing cancer metastasis | |
| Furuhashi et al. | Ephrin receptor A4 expression enhances migration, invasion and neurotropism in pancreatic ductal adenocarcinoma cells | |
| CN101338321B (en) | Method for constructing and screening miRNAs expression vector of stomach cancer target FUT3 gene and uses thereof | |
| CN107488735B (en) | MiR-339-5p is inhibiting the application in prostate cancer with osseous metastasis and TGF-β signal path | |
| CN104163871A (en) | Anti-tumor specific splicing factor and preparation method thereof | |
| CN110106144A (en) | The method and kit of a kind of inducing hematopoietic stem cell T system cell differentiation forward | |
| CN101096670B (en) | SiRNA interfering human a-fetoprotein gene and recombinant adenovirus | |
| CN100386435C (en) | Small interfering RNA for suppressing multiple effect growth factor expression and its uses | |
| Zhu et al. | A modified method by differential adhesion for enrichment of bladder cancer stem cells | |
| CN103952406B (en) | The siRNA of targeting STAT3 gene of suppression people's malignant glioma propagation and expression vector thereof and application | |
| CN103800918B (en) | The application in preparing anti-tumor drug of a kind of Microrna | |
| CN105288660B (en) | Applications of the MiRNA-22 in preparing MMP14 and Snail expression inhibiting agent | |
| CN103710311A (en) | Cell strain capable of stably secreting and expressing IL-24 recombinant protein, and construction and application thereof | |
| CN102618577A (en) | Enhanced tumor-specific therapy vector | |
| CN110747197B (en) | Application of human endogenous 27nt-miRNA molecule in preparation of antitumor drugs | |
| CN107582525A (en) | TRIM31 inhibitor magnetic target drug bearing microspheres are preparing the application in suppressing PDAC multiplication capacity medicines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20141126 |