CN104163868B - Anti-S. aureus L-forms medicament sifting motion system - Google Patents
Anti-S. aureus L-forms medicament sifting motion system Download PDFInfo
- Publication number
- CN104163868B CN104163868B CN201310185248.5A CN201310185248A CN104163868B CN 104163868 B CN104163868 B CN 104163868B CN 201310185248 A CN201310185248 A CN 201310185248A CN 104163868 B CN104163868 B CN 104163868B
- Authority
- CN
- China
- Prior art keywords
- mgra
- fusion protein
- staphylococcus aureus
- protein
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the screening system of a kind of anti-Staphylococcus aureus infection medicine with staphylococcus aureus regulation albumen (MgrA) as target spot.It is by MgrA albumen n end, MgrA PROTEIN C end are connected into fusion protein with fluorescin.Present invention also offers based on this fusion protein, the high throughput screening system of anti-Staphylococcus aureus infection medicine.The present invention provides simple and direct for finding anti-Staphylococcus aureus infection medicine precursor, method fast and accurately.
Description
Technical field
The invention belongs to biological technical field, relate to cellular targets screening of medicaments system, more particularly it relates to set up the system and method for staphylococcus aureus regulation albumen (MgrA) cell target rapid screening anti-Staphylococcus aureus infection medicine.
Background technology
Staphylococcus aureus is a kind of important pathogen causing human infectious disease, and it can cause the multiple diseases such as skin infection, endocarditis, pneumonia and septicemia.Antibiotic therapy is its essential therapeutic arsenals, but staphylococcus aureus creates drug resistance to nearly all known antibiotic.Increasingly serious drug resistance problems forces industry to be badly in need of finding new drug target and developing the new method to anti-Staphylococcus aureus.
Recently new model toxic protein (regulation albumen) targeted therapy that a kind of bacterial-infection resisting is treated is occurred in that, i.e. with the expression of the toxic protein of drug targeting containment object bacteria, transmit and stick, and then the Virulence Expression of targeting regulation object bacteria, effectively prevention and treatment multi-infection disease.Reduce it by patient being used the medicine for pathogen toxic protein pathogenic be allowed to harmless rather than killed, thus can be substantially reduced the probability (CheungA.L.etal.InfectImmun that Resistant strain occurs, 2005,73:1423～1431, ClatworthyA.E., etal.Nat.Chem.Biol, 2007,3,541-548).
Staphylococcus aureus regulation albumen (MgrA) is found in 2003 first, it is MarR(multipleantibioticresistanceregulator)/SarA(StaphylococcalaccessoryregulatorA) one of the member of protein family, regulate and control more than 350 gene, and show multiple biological activity, particularly in terms of regulation virulence factor expression, play particularly important effect.MgrA gene is positioned in S. aureus chromosomal, comprises the base pair of 444bp, encodes 147 amino acid whose MgrA albumen.Structural analysis of protein shows, MgrA contains spiral-folding-spiral (helix-turn-helix, HTH) structure, the domain being made up of 2 α spirals turning at a certain angle, one of them can insert and identify that the α spiral of DNA major groove specific base sequence is referred to as recognition helix (recognitionhelix)；Another α spiral does not has base specific, contacts with DNA phosphopentose chain backbone.Its tertiary structure, when with DNA specific bond, plays a role with dimeric forms.Want most in this dimer is the cysteine of 12, and the tyrosine of its threonine with 113 and 38 forms hydrogen bond and stablizes dimeric structure (ChenP.R., etal, NatChemBiol, 2006,2,591 595).
In theory, two kinds of approach are had can to reduce the pathogenic of antibacterial by the combination of suppression DNA with MgrA.A kind of be find suitably, can the alkylating agent of optionally alkylated cysteine residue.Another kind is to utilize high flux screening to find to produce the micromolecular compound of non-covalent bond effect with MgrA albumen.
High flux screening is an important instrument of modern pharmaceutical, uses suitable screening technique can efficiently find possible drug molecular structure precursor, and a large amount of medicines that simplify optimize the workload of process.There is no the report about the high throughput screening system setting up the medicine that anti-Staphylococcus aureus on the basis of molecular conformation infects at present.
Summary of the invention
It is an object of the invention to provide a kind of fast and easy, simple to operate and there is the system of screening anti-Staphylococcus aureus infection medicine and the construction method thereof of good specificity and sensitivity.
In a first aspect of the present invention, it is provided that a kind of fusion protein, described fusion protein is made up of following part:
(a) MgrA albumen n end；
(b) fluorescin；
(c) MgrA PROTEIN C end；
D () is positioned at connecting element A between (a) and (b) and connecting element B being positioned between (b) and (c)；
Described MgrA albumen n end is the aminoacid sequence of the 1st to the 110th of MgrA albumen, and described MgrA PROTEIN C end is the aminoacid sequence of the 110th to the 146th of MgrA albumen.
In another preference, the aminoacid sequence of described MgrA albumen n end is as shown in SEQIDNO1, and the aminoacid sequence of described MgrA PROTEIN C end is as shown in SEQIDNO2.
In another preference, described fluorescin is selected from (but not limited to) yellow fluorescence protein: such as, cpVenus or cpYFP.
In another preference, described connecting element (including connecting element A and connecting element B) is the polypeptide of a length of 3～8 amino acid residues.
In a second aspect of the present invention, it is provided that a kind of nucleic acid molecules, the described fusion protein described in nucleic acid molecule encoding；Or with described nucleic acid molecule complementation.
In another preference, the sequence of described nucleic acid molecules is as shown in SEQIDNO3.
In a third aspect of the present invention, it is provided that a kind of carrier, it contains described nucleic acid molecules.
In a fourth aspect of the present invention, it is provided that a kind of genetically engineered cell, described cell contains described carrier；Or integration has described nucleic acid molecules in described cellular genome.
In a fifth aspect of the present invention, it is provided that the application of described fusion protein, for screening the material that anti-Staphylococcus aureus infects.
In another preference, the material that described anti-Staphylococcus aureus infects can change the conformation of MgrA albumen.
In a sixth aspect of the present invention, it is provided that the method for the potential material that a kind of screening anti-Staphylococcus aureus with MgrA albumen as target spot infects, said method comprising the steps of:
(1) candidate substances is contacted with described fusion protein；
(2) candidate substances impact on the fluorescence signal intensity of fusion protein is observed；
Wherein, if the fluorescence signal intensity that described candidate substances can make described fusion protein strengthens, then show that this candidate substances is the potential material that anti-Staphylococcus aureus infects.
In another preference, step (1) includes candidate substances and described genetically engineered cells contacting.
In another preference, step (1) including: in test group, adds candidate substances in the culture of described cell；And/or
Step (2) including: the fluorescence signal intensity of the cell of detection test group, and compares with matched group, and wherein, described matched group is without the cell described in described candidate substances.
In another preference, if the fluorescence signal intensity that described candidate substances can make described fusion protein or genetically engineered cell strengthens more than 1.5 times, then show that this candidate substances is the potential material that anti-Staphylococcus aureus infects.
In another preference, the potential material that described method further comprises the steps of: obtaining carries out further cell experiment and/or zoopery, to filter out the anti-Staphylococcus aureus effective material of infection.
The other side of the present invention, due to this disclosure, is apparent to those skilled in the art.
Accompanying drawing explanation
Fig. 1: fluorescin probe Constructed wetlands figure.
Fig. 2: fluorescent screening process based on MgrA conformation change.
Fig. 3: the MgrA-cpYFP selectivity fluorescence response to MDSA,
Wherein, vertical coordinate is relative intensity of fluorescence,
A) BL21(DE3)/the pET28-MgrA-cpYFP selectivity fluorescence response to MDSA,
B) fusion protein selectivity fluorescence response to MDSA.
The structure of Fig. 4: MgrA fluorescent fusion protein and its selective response to micromolecular inhibitor.
Fig. 5: fluorescence rises in value the Chinese herbal medicine extract more than 1.5 times again.
Fig. 6: screen system based on target protein conformational change.
The impact that MgrA-DNA is combined by the Chinese herbal medicine extract that Fig. 7: EMAS checking high flux screening goes out.
The normal growth of staphylococcus aureus is affected by Fig. 8: the Chinese herbal medicine extract filtered out.
Fig. 9: EMSA second takes turns the impact on arranging gene promoter DNA outside the Drug resistance of staphylococcus aureus and the active that regulated and controled MgrA of the part Chinese herbal medicine extract that filters out.
Figure 10: two take turns the dosage effect that MgrA-DNA is combined by No. 332 Chinese herbal medicine extracts filtered out.
The result of Figure 11: mouse nuclei experiment.
Figure 12: PCR primer agarose gel electrophoresis is analyzed
A.VectorPCR, 1:SN-MgrA；2:AS-MgrA；3:SP-MgrA；4:DK-MgrA.
B.InsertPCR(cpYFP and cpVenus).
Figure 13: pET28b-MgrA-cpYFP double digestion is identified.
Wherein, VT, SD, SN, AS, SP, DK.
Figure 14: high flux screening principle based on fluorescence anisotropy.
Detailed description of the invention
The present inventor, by regulating working mechanism and the function of albumen MgrA in research staphylococcus aureus, can cause the tertiary structure of this protein itself to change when the detection of infrared circular dichroism spectra confirms little molecule and MgrA protein binding.On this basis, inventors have contemplated that the high flux screening building a kind of fluorescence protein probe based on the response of target proteins MgrA conformation own for medicine, the least molecule once interacts with MgrA, will change the fluorescence intensity of the fluorophor blended with MgrA.To this end, the present inventor devises a series of yellow fluorescence protein probe for detecting the combination of target proteins MgrA Yu DNA, have passed through a series of test and parameter optimization, the most successfully construct the high throughput screening system of anti-Staphylococcus aureus infection medicine.
Fusion protein
The present invention is using MgrA target point protein as sensing molecule, and connects the fluorophor merging factor sensitivity to external world.The conformation of MgrA effect protein can be caused after little molecule is combined with MgrA to change, and conformation change signal can be accepted by fluorescent reporter group simultaneously, is finally reached and carries out, by the change of fluorescence intensity, the purpose (Fig. 1) that detects.
On the basis of pre-stage test, cpVenus/cpYFP is inserted between S110 and N111 of MgrA and forms MgrA-cpYFP fusion protein by the present inventor, with the present invention by the specific aim compound MDSA that is 5 obtained based on fluorescence anisotropy high flux screening, 5'-methylenedisalicylic acid (sees Li, Z., etal, ChemBiol.2011August26;18 (8): 1,032 1041.) effect, finds that MDSA makes the fluorescence intensity of fusion protein strengthen to about 1.9 times (Fig. 3), and shows finite concentration effect and select specificity；Corresponding result is have also been obtained it was confirmed the high throughput screening system of anti-Staphylococcus aureus infection medicine of the present invention is feasible in live bacteria subsequently is tested.Research shows, cpVenus/cpYFP is inserted in this section of region, when forming fusion protein, once micromolecular compound and MgrA have an effect and α 5 spiral in this region i.e. can be caused to fragment into two sections, thus pull the chromophore of cpVenus/cpYFP closer to, make the fluorescence signal of cpVenus/cpYFP double (Fig. 2).On this basis, by screening further and the sudden change of critical sites of insertion point, the sensitivity of this detection method, specificity can be improved.
The present inventor shows with MDSA for the result of study of medelling compound, and some merges fluorescent probe, and such as SP-MgrA-cpYFP and VT-MgrA-cpYFP etc. to MDSA without response or weak effect, SN-MgrA-cpYFP or SN-MgrA-cpVenus effect is obvious.SN-MgrA-cpYFP(C12S) being then best one probe of activity, the response to MDSA is the most obvious, and shows notable specificity.Through repeatedly exploring, the present inventor obtains fluorescent probe fusion protein probe SN-MgrA-cpYFP finally, and this fusion protein can be with effective expression the specific monitoring probe (Fig. 4) interacted MgrA-DNA as little molecule in escherichia coli.
And then, the invention provides a kind of fusion protein, it includes MgrA albumen n end, fluorescin and MgrA PROTEIN C end and is positioned at the connecting element between MgrA albumen n end (C end) and fluorescin.Their assembling is the form by gene code, and the gene order entirety of fluorescin is inserted in the gene order of MgrA.So MgrA albumen is divided into two part i.e. N end proteins and C end protein.
Wherein, MgrA i.e. staphylococcus aureus regulation albumen, its protein sequence accession number is YP_001441273.The base sequence accession number of MgrA encoding gene is RefSeq:NC_009782.1.
As used in the present invention, " MgrA albumen n end " refers to compared with the aminoacid sequence of SEQIDNO1, has at most 10, the most at most 8, the most at most 5, and the most at most 3 aminoacid is replaced by the aminoacid that character is similar or close and the polypeptide that formed.These conservative variation's polypeptide can carry out aminoacid replacement according to table 1 and produce.
As used in the present invention, " MgrA PROTEIN C end " refers to compared with the aminoacid sequence of SEQIDNO2, has at most 10, the most at most 8, the most at most 5, and the most at most 3 aminoacid is replaced by the aminoacid that character is similar or close and the polypeptide that formed.These conservative variation's polypeptide can carry out aminoacid replacement according to table 1 and produce.
The aminoacid replacement that table 1 character is close
| Initial residue | Representational replacement | Preferably replace |
| Ala(A) | Val;Leu;Ile | Val |
| Arg(R) | Lys;Gln;Asn | Lys |
| Asn(N) | Gln;His;Lys;Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro;Ala | Ala |
| His(H) | Asn;Gln;Lys;Arg | Arg |
| Ile(I) | Leu;Val;Met;Ala;Phe | Leu 4 --> |
| Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
| Lys(K) | Arg;Gln;Asn | Arg |
| Met(M) | Leu;Phe;Ile | Leu |
| Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr;Phe | Tyr |
| Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
| Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
In a kind of optimal way of the present invention, MgrA albumen n end has the aminoacid sequence shown in SEQIDNO1, MgrA PROTEIN C end have the aminoacid sequence shown in SEQIDNO2 or with its homology more than 70%(preferably homology more than 80%；More preferably homology is more than 90%；Further preferably homology is more than 95%) aminoacid sequence.
As a kind of preferably mode of the present invention, described fluorescin is yellow fluorescence protein (YellowFluorescentProtein, YFP).As used in the present invention, YFP can regard a kind of mutant of green fluorescent protein as, is originally derived from the many siphonohores of Victoria (Aequoreavictoria).Relative to green fluorescent protein, its fluorescence offsets to red spectrum, and this becomes tyrosine mainly due to 3 threonine of protein 20.Its maximum excitation wavelength is 514nm, and maximum emission wavelength is 527nm.As green fluorescent protein, YFP is a kind of very conventional reporter gene in Celluar and Molecular Biology.At present, there are three kinds of yellow fluorescence proteins improved: Citrine, Venus and Ypet.The protein fluorescence of these three improvement is brighter, more stable, and maturation is faster, is therefore widely used.
CpVenus and cpYFP is the yellow fluorescence protein of cyclisation, and Full Name in English is circularlypermutedyellowfluorescentprotein.The most preferred cpYFP of the present invention is the yellow fluorescence protein of ring-type sudden change, i.e. the N end of original YFP gene and C end in order to GSGGTG(SEQIDNO22) it is bridged, and be new N end with Y145 position, it is new C end with N144 position.The cpVenus nucleic acid coding sequence formed is as shown in underscore part single in SEQIDNO15.This cpYFP has the feature sensitive to conception, can apply in the probe research of gene code.The N end of YFP gene and the bridged peptide of C end, can carry out aminoacid replacement according to table 1 based on SEQIDNO22 and produce.
Described MgrA albumen and fluorescin are that the form by gene code is attached, and reconnect outer 5 albumen coded sequences adding and expressing connecting element, thus form fusion protein.Connecting element makes the integration of fluorescin not affect the assembling of the tertiary structure of MgrA albumen own.Connecting element does not affects or not appreciable impact MgrA albumen and fluorescence protein amino acid sequence form correct folding and space conformation.Connecting element can be the aminoacid sequence coded by multiple clone site.The length of connecting element is not particularly limited, usually 3-8 aminoacid.Main utilization is that molecular weight is relatively small, and the flexible aminoacid strong with hydrophilic, such as, the aminoacid of connecting element is selected from A, G, T and V.
In a kind of optimal way of the present invention, connecting two-part in the fusion protein of the present invention is to use AGSAG(connecting element A, and sequence is as shown in SEQIDNO23) and GTGAV(connecting element B, sequence is as shown in SEQIDNO24) this five amino acid sequence.Connecting element A and connecting element B, can be carried out aminoacid replacement according to table 1 and produce respectively based on SEQIDNO23 and SEQIDNO24.
As a kind of preferably mode of the present invention, cpYFP can be inserted between the 110th, MgrA albumen (S) and the 111st (N), it is thus achieved that SN-MgrA-cpYFP(C12S).The encoding gene of cpYFP is inserted preparation SN-MgrA-cpYFP expression vector between MgrA the 110th and the coding of 111 amino acids and completes cardinal extremity.The MgrA12 position Cys aminoacid that suddenlys change on the basis of this expression vector becomes Ser, makes SN-MgrA-cpYFP-C12S expression vector.Confirm and animal infection modal experimental verification through high flux screening, EMSA, its infective material that can reduce staphylococcus aureus can cause the fluorescence intensity fold increase of the SN-MgrA-cpYFP-C12S that live body bacterium expresses, so it can be used in the medicine that high flux screening anti-Staphylococcus aureus infects.
On the other hand, present invention also offers the nucleic acid molecules of the above-mentioned fusion protein of coding, or the complementary series of this nucleic acid molecules.The suitable DNA structure of any coding MgrA albumen is suitable for the present invention.The suitable DNA structure of any encoding fluorescent protein is also applied for the present invention.
A kind of preferably mode, SN-MgrA-cpYFP(C12S as the present invention) the sequence of nucleic acid molecules as shown in SEQIDNO3.Single underscore part is the sequence of cpVenus, and double underline part is the nucleotide coding sequence of the connecting element between MgrA protein N terminal or C end and fluorescin, and remaining is MgrA albumen coded sequence.
Further, present invention also offers the carrier containing above-mentioned nucleic acid molecules.Described carrier also can comprise the expression regulation sequence that the series of operations with described nucleic acid molecules is connected, in order to the expression of described fusion protein.
Any suitable carrier can be used in preparing described recombinant vector, more such as antibacterial, fungus, yeast and the clone of mammalian cell and the carrier of expression, such as Pouwels etc., cloning vehicle: described in laboratory manual (Elsevier latest edition).In a preferred embodiment of the present invention, described carrier is selected from: plasmid, virus or artificial chromosome.
Expression vector includes connecting the fusion protein DNA sequence having suitable transcription and translation regulation sequence, such as mammal, microorganism, virus or insect genes.Regulation sequence includes transcripting promoter, operon, enhancer, ribosome binding site or controls the proper sequence that transcription and translation is initial and terminates.Fusion protein sequence needs to regulate functional nucleotide sequence when, then connect and suitably regulate sequence.So, promoter sequence is connected encoding fusion protein DNA sequence front end.The ability of the duplication in host cell is generally by replication initiation point control.Screening-gene for transformant identification also can add expression vector.
The reconstitution cell of the nucleotide sequence containing encoding said fusion protein is also included in the present invention.The host cell of the described reconstitution cell described recombinant vector that can be transient transfection, can be the host cell of the described recombinant vector of stable expression, it is also possible to be the transgenic cell of homologous recombination, or the cell of original cuiture, or the cell of immortalization.Described reconstitution cell is utilized to carry out the screening of the anti-Staphylococcus aureus infection medicine with MgrA albumen as target spot.
The fusion protein of the present invention can be according to its sequence synthetic.Gene engineering method can also be utilized, build the carrier of the coded sequence containing this fusion protein, then express in host cell.
Screening system and screening technique
The fusion protein containing MgrA albumen and fluorescin of the present invention can be used for building the system of the material that screening changes MgrA protein conformation, and the material of described change MgrA protein conformation can be further used as the medicine that anti-Staphylococcus aureus infects.
Described screening system is a kind of reconstitution cell system, has been imported into the carrier of the encoding gene carrying described fusion protein in described cell.In this cell system, described fusion protein is expressed.Therefore, can observe whether candidate substances can change the MgrA protein conformation of fusion protein by adding candidate substances in cell culture, thus screen the material of potential changed MgrA protein conformation.Due in fusion protein containing fluorescin, thus for approach that the observation of above-mentioned allosteric effect is provided convenience.
Therefore, the method that present invention also offers the potential material that a kind of screening anti-Staphylococcus aureus with MgrA albumen as target spot infects, the method comprises the following steps:
(1) candidate substances is contacted with described fusion protein；
(2) the detection candidate substances impact on the fluorescence signal of described fusion protein；
The candidate substances of the fluorescence signal intensity that can increase fusion protein is the potential material that anti-Staphylococcus aureus infects.
In step (1), can be that candidate substances is contacted with isolated and purified fusion protein, it is also possible to be by candidate substances and the solution containing fusion protein, or preferably, contact with the Host Strains reconstitution cell expressing described fusion protein.
In step (2), detect fluorescence signal, various conventional instrument and technological means can be used, for example with microplate reader etc..
The method can also include carrying out cellular level or the experiment of animal level further, to filter out the potential material that anti-Staphylococcus aureus infects.
In one embodiment of the invention, determining the SN-MgrA-cpYFP(C12S that thalline is expressed) fusion protein (excitation wavelength 488nmex, the transmitting wavelength measured is set to 52nmem) after, the present inventor and then more than 450 kinds of Chinese herbal medicine extracts have been carried out high flux screening based on live body bacterium expressed fusion protein, strengthen and reach the Chinese herbal medicine extract of 1.5 times by filtering out fluorescence figure place and do further biochemical analysis (Fig. 5, Fig. 6) more subsequently.Specifically, after first round high flux screening, present inventor has performed the second external gel shift experiment (EMSA) taken turns, the Chinese herbal medicine extract that will screen gained the first round acts on MgrA Yu DNA complex, find wherein 7 kinds of combinations that can interfere significantly with between MgrA and DNA (Fig. 7), and do not interfere with the normal growth (Fig. 8) of staphylococcus aureus.The expression of known MgrA negative regulation efflux pump gene, including NorA, NorB, NorC and Tet38, thus affects the staphylococcus aureus drug resistance to antibiotic.In the 7 kinds of Chinese herbal medicine extracts confirmed by EMSA, as a example by two kinds of Chinese herbal medicine extracts of numbered No. 26 and No. 332, the present inventor studies these two kinds of Chinese herbal medicine extracts of discovery and by suppression MgrA thus has influence on the drug resistance of staphylococcus aureus.Wherein, No. 332 Chinese herbal medicine extracts show dose-effect relationship (Fig. 9) at its aspect that affects combining MgrA-DNA.
Additionally, EMSA experiment in vitro the present inventors have additionally discovered that: what EMSA second took turns the promoter DNA of the part Chinese herbal medicine extract that filters out outer row gene relevant to drug resistance and MgrA is combined with strong inhibitory action (Figure 10).
The studies above shows: the Chinese herbal medicine extract obtained through two-wheeled screening can targeting MgrA albumen, thus affect the regulation and control of MgrA.And most of virulence factors of MgrA regulation and control staphylococcus aureus.After known MgrA suppression, the toxicity of staphylococcus aureus significantly reduces, and therefore the present inventor has carried out again the experiment of further animal infection modal.As a example by the Chinese herbal medicine extract of numbered No. 332, after zoogenetic infection staphylococcus aureus, process with No. 332 Chinese herbal medicine extracts, then the quantity of staphylococcus aureus is detected after taking animal liver and kidney tissue grinder, after discovery gives No. 332 Chinese herbal medicine extracts, amount of bacterial plaque significantly reduces (Figure 11), shows that No. 332 Chinese herbal medicine extracts can significantly reduce the infectivity of staphylococcus aureus.
Known to the present inventor, other similar screening system has external high-flux medicaments sifting method based on fluorescence anisotropy, may be used for the role and influence (Figure 14) screening small-molecule drug for the complex of MgrA-DNA.
Concrete grammar is to select the group (AGTTGT containing being combined with MgrA, SEQIDNO25) DNA probe (5'-TAAACAACAAGTTGTCCAAA-3', (SEQIDNO26)), upper a kind of wide variety of fluorophor 6-CF 5(6)-Carboxyfluorescein (6-carboxylfluorescein) is connected at 5 ' ends.Excite at 494nm wavelength, launch at 521nm.
According to Herba Eupatorii equation, FA value is directly proportional to the size of the biomolecule containing fluorophor, and the DNA containing fluorophor produces a less FA value, after it is combined with MgrA, then can produce a bigger FA value.When, after the combination by little molecules in inhibiting DNA and MgrA, its FA value can reduce again.Therefore, go out DNA Yu MgrA is combined with the micromolecular compound of inhibitory action by the change of FA value just energy Preliminary screening, the most further screened.
But there are some problems in said method.First, micromolecular compound may directly react with fluorophor so that FA value reduces, and produces false positive effect.Secondly, micromolecular compound may interact with DNA, closing the action site of DNA Yu MgrA, equally making FA value reduce, so needing to carry out further multi-turns screen.
By contrast, the present invention builds with the screening system integrating fluorescin probe based on conformation change, and it can effectively avoid false positive effect.
In sum, main advantages of the present invention are:
(1) a kind of feature utilizing MgrA conformation change is provided first, reporter gene cpYFP with MgrA is blended, construct brand-new fluorescin probe, fusion protein therein had both remained function and the characteristic of MgrA protein structure, MgrA-DNA can be detected easily again and combine conformation change, express this probe at thalline and the compound acting on MgrA-DNA can be produced specific fluorescence response, thus the material infected for screening anti-Staphylococcus aureus provides good approach.
(2) screening system that the present invention builds has good sensitivity and accuracy.
(3) The inventive process provides the laboratory facilities of the material that a kind of convenient effective detection screening anti-Staphylococcus aureus infects, the method can be applied not only to the theoretical basis research of laboratory antagonism infection of staphylococcus aureus, apply also for the forward position of drug development, for setting up the technology platform of a kind of compound scale screening.
(4) present invention can carry out high-throughout screening compound simultaneously, and clearly, speed is fast, and action effect is directly perceived for medicine screening apparatus reason.Further, the method highly versatile of the present invention, experimental system is stable, reproducible, and false positive rate is low.
Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are merely to illustrate the present invention rather than limit the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally according to normal condition such as Sambrook et al., molecular cloning: lab guide (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or according to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage ratio and number are calculated by weight.
Unless otherwise defined, the same meaning that all specialties used in literary composition and scientific words be skilled with this area, personnel are familiar with.Additionally, any method similar or impartial to described content and material all can be applicable in the present invention.Preferable implementation described in literary composition only presents a demonstration with material and is used.
Embodiment 1MgrA-cpYFP integrating expression vector builds
Reagent and instrument
Restricted enzyme XbaI and XhoI, pfu polymerase and dNTP are purchased from Takara company；SanPrep pillar PCR primer purification kit is purchased from Sangon Biotech (Shanghai) Co., Ltd.;Other biochemical reagents are mainly purchased from Oxoid company, ScientificResearchSpecial company.
LB liquid medium formula: NaCl1%, Tryptone1%, Yeastextract0.5%(pH7.0)；Solid LB media formula: add 1.5% agar powder in LB liquid medium.
Experimental apparatus: the big shaking table of SKY-211C type of Shanghai Su Kun company and the little shaking table of SKY-100C type；BioRad electrophresis apparatus；The NanoDropND-2000 ultramicron nucleic acid-protein analyzer of ThermoScientific company；The MultilabelReader type microplate reader of PerkinElmer company；The PCR instrument of Biometric company.
Expression vector pET28b, bacterial strain E.coliBL21(DE3) star, DH10B be this laboratory preserve.
Utilizing the imperfect primer extension technique of polymerase (polymeraseincompleteprimerextension, PIPE) to realize fluorophor cpYFP orientation to be inserted in MgrA, this method is independent of any enzyme, realizes Insert Fragment orientation by homologous recombination and inserts.The present invention have selected five insertion points altogether: VT, SP site is positioned near the DNA binding domain of MgrA, and SN/DK/AS is positioned at α 5 coil region.These five insertion points VT, SP, SN, DK and AS corresponding Vector-PIPEPCR primer and Insert-PIPEPCR primer.The primer (table 2-1, table 2-2) is synthesized by Shenzhen Huada Genetic Technology Co., Ltd, and double underline part is catenation sequence.
Vector-PIPEPCR reaction condition: 95 DEG C of denaturations 2min；94 DEG C of degeneration 30s, 56 DEG C of annealing 30s, 68 DEG C extend 12min；30 circulations.72 DEG C, 10min, 10 DEG C of preservations.
Insert-PIPEPCR reaction condition: 95 DEG C of denaturations 2min；94 DEG C of degeneration 30s, 62 DEG C of annealing 30s, 72 DEG C extend 45s；30 circulations.72 DEG C, 10min, 10 DEG C of preservations.
PCR carries out 0.8% and 1.2% agarose gel electrophoresis analysis after having expanded respectively, Insert-PIPEPCR product is purified according to the SanPrep pillar PCR primer purification kit description bought, and Vector-PIPEPCR product DpnI to be utilized ferment treatment removes background.
Table 2-1Vector-PIPEPCR primer
Table 2-2Insert-PIPEPCR primer (VT/SP/SN/DK/AS)
Respectively transferase 12 .5 μ LVector-PIPEPCR product and 2.5 μ LInsert-PIPEPCR products are to the 0.2mL centrifuge tube of pre-cooling, and matched group is that 2.5 μ LVector-PIPE add 2.5 μ LddH2O, places 30min on ice.
Connect product and take 4 μ L conversion DH10B competent cells, at the enterprising row filter of LB flat board containing 50 μ g/mL, picking positive bacterium colony shakes bacterium and extracts plasmid, after utilizing NdeI and XhoI double digestion to identify, send Shenzhen Hua Da genome company to check order successful for Preliminary Identification positive colony.
According to experiment flow, conventional PCR flow process is utilized to carry out Insert Fragment PCR(InsertPCR) and carrier PCR(VectorPCR), pcr amplification product size is respectively 756bp and 5.8kb, and electrophoresis result shows the band having amplified with having expected that size is consistent, and sees Figure 12.Utilize the positive colony that PIPE technology obtains after shaking bacterium extracting plasmid, after XbaI/XhoI double digestion, should there is small one and large one two band, large fragment pET28b about 5.4kb, small fragment MgrA-cpYFP about 1.2kb in pET28b-MgrA-cpYFP series recombiant plasmid electrophoresis result.As shown in Figure 13, intended two bands are occurred in that.Confirming through Shenzhen Hua Da gene sequencing, gained recombiant plasmid sequence is completely correct, shows the most successfully to construct recombiant plasmid VT-MgrA-cpYFP, SP-MgrA-cpYFP, SN-MgrA-cpYFP, DK-MgrA-cpYFP, AS-MgrA-cpYFP of five insertion points；VT-MgrA-cpVenus, SP-MgrA-cpVenus, SN-MgrA-cpVenus, DK-MgrA-cpVenus, AS-MgrA-cpVenus can be used for next step experiment.Its particular make-up sees Fig. 4 A.
As a example by fusion protein S N-MgrA-cpYFP, its nucleotide coding sequence is SEQIDNO3, and particular sequence is as follows:
ATGTCTGATCAACATAATTTAAAAGAACAGCTATGCTTTAGTTTGTACAATGCTCAAAGACAAGTTAATCGCTACTACTCTAACAAAGTTTTTAAGAAGTACAATCTAACATACCCACAATTTCTTGTCTTAACAATTTTATGGGATGAATCTCCTGTAAACGTCAAGAAAGTCGTAACTGAATTAGCACTCGATACTGGTACAGTATCACCATTATTAAAACGAATGGAACAAGTAGACTTAATTAAGCGTGAACGTTCCGAAGTCGATCAACGTGAAGTATTTATTCACTTGACTGACAAAAGTGAAACTATTAGACCAGAATTAAGT TACAACAGCGACAACGTCTATATCATGGCCGACA AGCAGAAGAACGGCATCAAGGCCAACTTCAAGATCCGCCACAACGTCGAGGACGGCAGCGTGCAGCTCGCCGACCAC TACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTTCCAGTCCGTCCT GAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCA TGGACGAGCTGTACAACGTGGATGGCGGTAGCGGTGGCACCGGCAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTG CCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCAC CTACGGCAAGCTGACCCTGAAGCTGATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCC TCGGCTACGGCCTGAAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCC GAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGA GGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGGCTTCAAGGAGGACGGCAACATCCTGGGGCACAAGC TGGAGTACAAC AATGCATCTGACAAAGTCGCTTCAGCTTCTTCTTTATCTCAAGATGAAGTTAAAGAACTTAATCGCTTATTAGGTAAAGTCATTCATGCATTTGATGAAACAAAGGAAAAATAA。
Wherein, the accounting coded sequence that concrete DNA sequence is fluorescin of single underscore part, specifically as shown in SEQIDNO15, corresponding aminoacid sequence is as shown in SEQIDNO16.Double underline for catenation sequence.The partial sequence that other base is MgrA on both sides, is divided into two parts nucleotide sequence the 330th.The N end of MgrA and the DNA particular sequence of C end protein part are respectively as shown in SEQIDNO17 and SEQIDNO19, and corresponding aminoacid sequence is respectively as shown in SEQIDNO1 and SEQIDNO2.
Construction method is to pass through subcloning procedures.
Embodiment 2 live body bacterium expresses the abduction delivering of MgrA-cpYFP fusion protein
After obtaining the recombiant plasmid pET28b-SN-MgrA-cpYFP checking order correct, by its transformed competence colibacillus cell E.coliBL21(DE3) star, coats the LB flat board containing 50 μ g/mL and cultivates 12h.Next day, picking monoclonal, was inoculated in 2mL LB liquid medium (containing Kana50 μ g/mL), and 37 DEG C, 200rpm overnight shakes bacterium.Incubated overnight bacterium solution is pressed the scaling LB liquid medium to 200mL containing Kana of 1:100, and 37 DEG C, 2-3h cultivated by 200rpm shaking table, to OD600=0.6-0.8.Now adding IPTG to final concentration of 0.2mM, 16 DEG C, 20h-24h cultivated by 160rpm shaking table.Inducing complete, low-temperature centrifugation collects thalline, and 4 DEG C of preservations are stand-by.
Show after testing with MDSA for medelling compound, in the fusion protein of above-mentioned expression as SP-MgrA-cpYFP and VT-MgrA-cpYFP fusion fluorescent probe to MDSA without response or weak effect, and SN-MgrA-cpYFP(C12S) be activity best one probe.It is the most obvious to the response of MDSA, and shows notable specificity.
SN-MgrA-cpVenus/cpYFP is the poorest to response ratio SN-MgrA-cpYFP (C12S) of MDSA, the most obvious, all can screen, as fusion protein, the infective material (Fig. 4) reducing staphylococcus aureus.
The high flux screening in embodiment 3 Chinese herbal medicine extract storehouse
The probe of live body abduction delivering SN-MgrA-cpYFP fusion protein, centrifugal collect after abandon supernatant, with 20mMHEPES(pH7.4) resuspended once, centrifugal, thalline 20mMHEPES(pH7.4) be diluted to 2 × 107About cells/mL.Chinese herbal medicine extract plants 96 hole fluorescent screens in advance, the Chinese herbal medicine extract that concentration is 10mg/ml taking 10 μ l plants plate by number, then the mycelium dilution liquid of 90 μ l is added with the 12 hole volley of rifle fires, under room temperature, shaking table is hatched 30min jointly and is placed on the MultilabelReader type fluorescence microplate reader mensuration fluorescence of PerkinElmer company.Excitation wavelength 488nmex, the transmitting wavelength of mensuration is set to 52nmem.
The present embodiment, with MDSA as positive control, can reduce the infectivity of staphylococcus aureus on biochemistry and zoopery level.On this basis, carry out the high flux screening that more than 450 kinds of Chinese herbal medicine extracts are carried out expresses fluorescent probe based on live body bacterium, reach filter out the enhancing of fluorescence figure place at the Chinese herbal medicine extract of 1.5 times for further biochemical analysis subsequently.
Result shows, the relative intensity of fluorescence enhancing of MDSA reaches 1.9 times, and what the screening system of this proof present invention can be correct filters out target compound.In more than 450 kind of Chinese herbal medicine extract, relative intensity of fluorescence strengthens the specific experiment data of the Chinese herbal medicine extract reached or more than 1.5 times as shown in Figure 5.
The computing formula of relative intensity of fluorescence: the fluorescence intensity of relative intensity of fluorescence=mensuration sample/matched group fluorescence intensity.
Embodiment 4EMSA second is taken turns screening and is confirmed
After first round high flux screening, the present invention carries out the second external gel shift experiment (EMSA) taken turns.
Gel shift or electrophoretic mobility experiment (EMSA) are a kind of researching DNA associated proteins and the technology of its relevant DNA binding sequence row interaction, can be used for qualitative and quantitative analysis.Also can be used for studying rna binding protein and the interaction of specific RNA sequence.
Generally by the albumen of purification and cell crude extract and32The isotope-labeled DNA of P or rna probe are together incubated, on the polyacrylate hydrogel electrophoresis of non denatured, and isolated complex and uncombined probe.DNA-complex or RNA-complex move slowly than uncombined probe.Isotope-labeled probe is according to the protein-bonded difference of research, but double-strand or strand.When the detection such as DBP of transcription regulatory factor one class, available purifying protein, partial purification albumen, or nucleus extract.When detecting rna binding protein, according to the position of purpose rna binding protein, available purification or partially purified albumen, it is also possible to core or cytoplasmic cell extract.Competitive assay uses DNA or the RNA fragment containing protein binding sequence and oligonucleotide fragment (special), and other uncorrelated fragment (non-specific), determines the specificity of DNA or rna binding protein.In the presence of the special and non-specific fragment of competition, feature and intensity according to complex determine specific bond.
The present embodiment acts on MgrA Yu DNA complex with the Chinese herbal medicine extract of first round screening gained, carries out EMSA and runs glue checking.
Experiment material:
Biochemical reagents are purchased from Sangon Biotech (Shanghai) Co., Ltd., and single stranded DNA 1 and single stranded DNA 2 are by Hua Da gene chemical synthesis.The DNA sequence probe specific binding with MgrA is: single stranded DNA 1,5 '-GGTATAAATGTTGTCGAATAAACAACAAGTTGTCCAAAAG-3 ' (SEQIDNO27) and single stranded DNA 2,
5 '-CTTTTGGACAACTTGTTGTTTATTCGACAACATTTATACC-3 ' (SEQIDNO28).
10 × annealing buffer (10mMTris, pH8.0,50mMNaCl, 1mMEDTA);In conjunction with buffer (10mMTris-HCl, pH8.0,5mM magnesium chloride, 50mM potassium chloride, 10% glycerol, 0.1mMEDTA).10 × sample-loading buffer: 250mMTris-HCl, pH=7.9,0.2% bromophenol blue, 40% glycerol).10XTris-boric acid (TBE): 890mMTris-Base, 890mM boric acid, 20mMEDTA(pH8.0).
Experimental procedure:
1. single stranded DNA annealing synthetic dsdna:
10 μ L1mM strand-DNA1
10 μ L1mM strand-DNA2
5 μ L10 × annealing buffer
25 μ L ultra-pure waters
After mixing, 95 degree of water-baths 10 minutes, are subsequently placed under room temperature and slowly lower the temperature.Verify whether that double-strand forms the glue that can run 2-3%, run the time is slightly longer, it can be seen that double-strand pulls up lame than strand.
2. preparation 4% polyacrylamide gel
4% polyacrylamide gel formula
10 × tbe buffer liquid 1.0ml
37.5:1 acrylamide/methylene diacrylamide (40%, w/v) 1.25ml
40% acrylamide (w/v) 0.75ml
80% glycerol 625 μ l
Ultra-pure water 16.2ml
TEMED10μl
10% Ammonium persulfate. 150 μ l
Note: TEMED, N, N, N', N'-tetramethyl diethylamine
3.MgrA-DNA association reaction condition and sample treatment:
The concentration of DNA double chain I be generally fixed to 50nM, join and combine in buffer.MgrA albumen is eventually adding.Final volume is 20 μ L, after at room temperature hatching 20-30 minute, adds loading after Chinese herbal medicine extract processes 30 minutes.The salinity of protein sample can not be the highest, otherwise can affect the combination of itself and DNA.
4. deposition condition:
Add after sample-loading buffer voltage stabilizing 120 volts, prerunning 20-30 minute in 0.25 × tbe buffer liquid.After loading, voltage of voltage regulation 160 volts, electrophoresis 40 minutes.Dyeing: dyestuff is SYBRgold (invitrogen).Take 1 μ L and join dyeing 5-10 minute in 10mL0.5 × tbe buffer liquid.The position of DNA, and preservation of taking pictures is observed under ultraviolet.
Experimental result:
There are 7 kinds of Chinese herbal medicine extracts can interfere significantly with the combination (Fig. 7) between MgrA and DNA, and do not interfere with the normal growth (Fig. 8) of staphylococcus aureus.
The expression of known MgrA negative regulation efflux pump gene, including NorA, NorB, NorC and Tet38, thus affects the staphylococcus aureus Drug resistance to antibiotic.In these 7 kinds of Chinese herbal medicine extracts confirmed by EMSA, as a example by the Chinese herbal medicine extract of numbered No. 26 and No. 332, research finds that these two kinds of Chinese herbal medicine extracts by suppression MgrA thus have influence on the Drug resistance of staphylococcus aureus.No. 332 Chinese herbal medicine extracts its MgrA-DNA is combined the aspect that affects show dosage effect (Fig. 9).
EMSA experiment in vitro inventors have also discovered that, EMSA second takes turns the part Chinese herbal medicine extract the filtered out outer promoter DNA of arranging gene relevant to drug resistance and is combined with strong inhibitory action (Figure 10) with MgrA.
EMSA experiment from another angle prove the present invention screening system can be correct filter out anti-Staphylococcus aureus infect class material.
Embodiment 5 animal infection modal is tested
The great majority of MgrA protein regulation staphylococcus aureus are outer arranges virulence factor.After known MgrA suppression, the infectivity of staphylococcus aureus significantly reduces, the animal infection modal experiment that therefore the present inventor has carried out.
Experiment material
With the BALB/c nude mice of 10 week old purchased from Beijing Vital River Experimental Animals Technology Co., Ltd. in SPF animal housing.TSB and TSA culture medium is purchased from Oxoid company of Britain.
Experimental procedure:
Select staphylococcus aureus strain Newmam in TSB culture medium, incubated overnight in 37 degree of shaking tables, amplify by 1:100, in 37 degree shaking tables, cultivate 2.5-3 hour to OD600 arrival about 1.Centrifugal collection thalline, is resuspended in phosphate buffer (PBS, PhosphateBuffersolution).Comparison BALB/c nude mice injects the 100 resuspended bacterium of μ l (1 × 10 by orbital vein7Colony forming units cfu).Experimental group is simultaneously introduced corresponding Chinese herbal medicine extract in injection.Infecting the 5th day, suffocated execution laboratory animal by carbon dioxide, taking animal liver and kidney respectively and be organized in the phosphate buffer of 1ml and grind, be then diluted to five gradients by 10 times, the dilution drop plate after 10 μ l grind respectively is on TSA agar culture medium.Statistics bacterium colony number carries out data analysis.
Experimental result:
As a example by the Chinese herbal medicine extract of numbered No. 332, after mouse infection staphylococcus aureus, process with No. 332 Chinese herbal medicine extracts, then the quantity detecting staphylococcus aureus after Mouse Liver nephridial tissue is ground is taken, after discovery gives No. 332 Chinese herbal medicine extracts, amount of bacterial plaque significantly reduces (Figure 11).Result shows, embodiment 3 Chinese herbal medicine extract that obtains of screening can the infectivity reducing staphylococcus aureus in various degree.This proves further, and the high throughput screening system of the present invention can effectively filter out the material that anti-Staphylococcus aureus infects.
Many aspects involved in the present invention have been done as explained above.However, it should be understood that put before without departing from spirit of the present invention, those skilled in the art can carry out equivalent to it and change and modify, and described change and modification fall into the coverage of the application claims equally.
Claims (15)
1. a fusion protein, it is characterised in that described fusion protein is made up of following part:
(a) MgrA albumen n end；
(b) fluorescin；
(c) MgrA PROTEIN C end；
D connecting element A that () is positioned between (a) and (b) and connecting element B being positioned between (b) and (c)；
Described MgrA albumen n end is the aminoacid sequence of the 1st to the 110th of MgrA albumen, and described MgrA PROTEIN C end is the aminoacid sequence of the 111st to the 146th of MgrA albumen.
2. fusion protein as claimed in claim 1, it is characterised in that the aminoacid sequence of described MgrA albumen n end is as shown in SEQIDNO1, and the aminoacid sequence of described MgrA PROTEIN C end is as shown in SEQIDNO2.
3. fusion protein as claimed in claim 1, it is characterised in that described fluorescin is yellow fluorescence protein.
4. fusion protein as claimed in claim 1, it is characterised in that described connecting element A and connecting element B are the polypeptide of a length of 3～8 amino acid residues.
5. a nucleic acid molecules, it is characterised in that described nucleic acid molecule encoding fusion protein as claimed in claim 1.
6. nucleic acid molecules as claimed in claim 5, it is characterised in that the sequence of described nucleic acid molecules is as shown in SEQIDNO3.
7. a carrier, it is characterised in that it contains nucleic acid molecules as claimed in claim 5.
8. a genetically engineered cell, it is characterised in that described cell contains carrier as claimed in claim 7；Or
Described cellular genome is integrated and has nucleic acid molecules as claimed in claim 5.
9. the application of the fusion protein described in claim 1, it is characterised in that for screening the potential material that anti-Staphylococcus aureus infects.
Apply the most as claimed in claim 9, it is characterised in that the potential material that described anti-Staphylococcus aureus infects can change the conformation of MgrA albumen.
The method of the potential material of the anti-Staphylococcus aureus infection that 11. 1 kinds are screened with MgrA albumen as target spot, it is characterised in that said method comprising the steps of:
(1) candidate substances is contacted with the fusion protein described in claim 1；
(2) candidate substances impact on the fluorescence signal intensity of fusion protein is observed；
Wherein, if the fluorescence signal intensity that described candidate substances can make described fusion protein strengthens, then show that this candidate substances is the potential material that anti-Staphylococcus aureus infects.
12. methods as claimed in claim 11, it is characterised in that step (1) includes candidate substances and the cells contacting described in claim 8.
13. methods as claimed in claim 11, it is characterised in that
Step (1) including: in test group, adds candidate substances in the culture of the cell described in claim 8；And/or
Step (2) including: the fluorescence signal intensity of the cell of detection test group, and compares with matched group；
Wherein, described matched group is the cell described in the claim 8 without described candidate substances.
14. either method as described in claim 11～13, it is characterised in that if the fluorescence signal intensity that described candidate substances can make described fusion protein or cell strengthens more than 1.5 times, then show that this candidate substances is the potential material that anti-Staphylococcus aureus infects.
15. either method as described in claim 11～13, it is characterized in that, described method also includes step (3): the potential material obtained is carried out further cell experiment and/or zoopery, to filter out the anti-Staphylococcus aureus effective material of infection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310185248.5A CN104163868B (en) | 2013-05-17 | 2013-05-17 | Anti-S. aureus L-forms medicament sifting motion system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310185248.5A CN104163868B (en) | 2013-05-17 | 2013-05-17 | Anti-S. aureus L-forms medicament sifting motion system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104163868A CN104163868A (en) | 2014-11-26 |
| CN104163868B true CN104163868B (en) | 2016-08-03 |
Family
ID=51907864
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310185248.5A Expired - Fee Related CN104163868B (en) | 2013-05-17 | 2013-05-17 | Anti-S. aureus L-forms medicament sifting motion system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104163868B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007007199A2 (en) * | 2005-03-25 | 2007-01-18 | Evrogen, Jsc | Fluorescent indicators of hydrogen peroxide and methods for using same |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE602008003782D1 (en) * | 2008-07-04 | 2011-01-13 | Univ Dresden Tech | Fluorescence-based reporter gene construct for the direct detection of the activation of TGF-beta receptors and modulators thereof |
-
2013
- 2013-05-17 CN CN201310185248.5A patent/CN104163868B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007007199A2 (en) * | 2005-03-25 | 2007-01-18 | Evrogen, Jsc | Fluorescent indicators of hydrogen peroxide and methods for using same |
Non-Patent Citations (2)
| Title |
|---|
| A genetically encoded fluorescent reporter of ATP:ADP ratio;Jim Berg et al.;《Nature Methods》;20090111;第6卷(第2期);161-166 * |
| A highly selective fluorescent probe for visualization of organic hydroperoxides in living cells;Boxuan Simen Zhao et al.;《JACS》;20101115;第132卷(第48期);17065-17067 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104163868A (en) | 2014-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Buscaill et al. | Glycosidase and glycan polymorphism control hydrolytic release of immunogenic flagellin peptides | |
| Mukaihara et al. | Genome-wide identification of a large repertoire of Ralstonia solanacearum type III effector proteins by a new functional screen | |
| Seymour et al. | A processed multidomain Mycoplasma hyopneumoniae adhesin binds fibronectin, plasminogen, and swine respiratory cilia | |
| CN110628955B (en) | CrRNA target and CRISPR-Cas13a system for detecting Ebola virus | |
| Guan et al. | Effect of exogenous siderophores on iron uptake activity of marine bacteria under iron-limited conditions | |
| Kumar Verma et al. | Xanthomonas oryzae pv. oryzae chemotaxis components and chemoreceptor Mcp2 are involved in the sensing of constituents of xylem sap and contribute to the regulation of virulence‐associated functions and entry into rice | |
| Wassem et al. | TtsI regulates symbiotic genes in Rhizobium species NGR234 by binding to tts boxes | |
| González et al. | A proteomic study of Xanthomonas oryzae pv. oryzae in rice xylem sap | |
| Wang et al. | A type VI secretion system delivers a cell wall amidase to target bacterial competitors | |
| CN101143216A (en) | Escherichia coli TolC antibody targeting effect improving drug-resistant bacteria sensitivity to antibiotic technology | |
| Yan et al. | Ancient co-option of an amino acid ABC transporter locus in Pseudomonas syringae for host signal-dependent virulence gene regulation | |
| CN111363023A (en) | Vitellogenin peptide segment tfVWD for binding tetrodotoxin, nucleotide sequence, polyclonal antibody thereof and preparation method thereof | |
| Ye et al. | The membrane proteins involved in virulence of Cronobacter sakazakii virulent G362 and attenuated L3101 isolates | |
| CN108251446A (en) | A kind of construction method of lead ion responsive type whole-cell biological sensor | |
| Li et al. | Aerobactin-mediated iron acquisition enhances biofilm formation, oxidative stress resistance, and virulence of Yersinia pseudotuberculosis | |
| Meyer et al. | PopF1 and PopF2, two proteins secreted by the type III protein secretion system of Ralstonia solanacearum, are translocators belonging to the HrpF/NopX family | |
| He et al. | Copper stress by nutritional immunity activates the CusS-CusR two-component system that contributes to Vibrio alginolyticus anti-host response but affects virulence-related properties | |
| Jiang et al. | Two functionally deviating type 6 secretion systems occur in the nitrogen-fixing endophyte Azoarcus olearius BH72 | |
| KR20150003013A (en) | Nucleic acid aptamer specifically binding to enrofloxacin or ciprofloxacin | |
| Zembek et al. | Two strategies of Pseudomonas syringae to avoid recognition of the HopQ1 effector in Nicotiana species | |
| Zhang et al. | Analysis of HrpG regulons and HrpG‐interacting proteins by ChIP‐seq and affinity proteomics in Xanthomonas campestris | |
| Liu et al. | LuxR-type regulator AclR1 of Azorhizobium caulinodans regulates cyclic di-GMP and numerous phenotypes in free-living and symbiotic states | |
| Rampioni et al. | Functional characterization of the quorum sensing regulator RsaL in the plant-beneficial strain Pseudomonas putida WCS358 | |
| Wheeler et al. | A cyclic nucleotide sensitive promoter reporter system suitable for bacteria and plant cells | |
| CN104163868B (en) | Anti-S. aureus L-forms medicament sifting motion system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160803 Termination date: 20190517 |