CN104152543A - Bacillus coagulans detection primer pair, kit and method thereof - Google Patents

Bacillus coagulans detection primer pair, kit and method thereof Download PDF

Info

Publication number
CN104152543A
CN104152543A CN201410243762.4A CN201410243762A CN104152543A CN 104152543 A CN104152543 A CN 104152543A CN 201410243762 A CN201410243762 A CN 201410243762A CN 104152543 A CN104152543 A CN 104152543A
Authority
CN
China
Prior art keywords
bacillus coagulans
primer
bacillus
detection kit
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410243762.4A
Other languages
Chinese (zh)
Other versions
CN104152543B (en
Inventor
符雷
郗洪生
施腾鑫
陆亚怡
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
JIANGSU HENGFENGQIANG BIOTECHNOLOGY CO Ltd
Original Assignee
JIANGSU HENGFENGQIANG BIOTECHNOLOGY CO Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by JIANGSU HENGFENGQIANG BIOTECHNOLOGY CO Ltd filed Critical JIANGSU HENGFENGQIANG BIOTECHNOLOGY CO Ltd
Priority to CN201410243762.4A priority Critical patent/CN104152543B/en
Publication of CN104152543A publication Critical patent/CN104152543A/en
Application granted granted Critical
Publication of CN104152543B publication Critical patent/CN104152543B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of microbe detection, and discloses a bacillus coagulans LAMP (Loop-Mediated Isothermal Amplification) detection primer pair, a detection kit and a detection method thereof. The bacillus coagulans LAMP detection method disclosed by the invention is peculiar, sensitive, simple, convenient and fast, can be completed within 1.5 hours and can be used for fast detecting samples.

Description

A kind of Bacillus coagulans detects primer sets, test kit and method thereof
Technical field
The present invention relates to a kind of Bacillus coagulans detection kit, be specifically related to relate in particular to the primer sets, detection kit and the detection method thereof that detect for Bacillus coagulans LAMP, belong to microorganism detection technical field.
Background technology
Bacillus coagulans ( bacillus coagulans) be shaft-like, the blunt circle in two ends, gram-positive microorganism, hydrogen peroxide enzyme positive, brood cell holds life, atrichia.Optimum growth temperature is 45～50 DEG C, and optimal pH value is 6.6～7.0.It can decompose carbohydrate and generate L-lactic acid, is homotype lactic acid fermenting bacteria.Bacillus coagulans is to cause tinned pre-flat cover to become sour and the rotten major microorganisms of milk-product.Traditional plate count has been not suitable with the quick rhythm in foodstuff production workshop gradually, and quantitative fluorescent PCR is applied in food factory, detects the existence of Bacillus coagulans.But PCR method needs expensive PCR instrument, and trivial operations, very restricted in practice.
Loop-mediated isothermal amplification technique (LAMP) is the new technology that the people such as Notomi in 2000 develop, utilize 4 primers, and optionally use ring primer, under the archaeal dna polymerase effect with strand displacement activity, can make target gene be increased in a large number in 60 min.In reaction, there is cyclic single strand structure in primer junction, template two ends circulation, thereby ensure that primer can be combined with template smoothly under isothermal condition, and carry out strand displacement amplification reaction.Dou Mingli etc. have gone out the LAMP primer sets of Bacillus coagulans based on SPO0A gene design, this primer sets specificity is not strong, can check multiple heat-resistant bacillus, and SPO0A gene is present in the middle of a lot of microorganisms simultaneously, can not aimed detection Bacillus coagulans.
Through primer sets, detection kit and the detection method correlative study report thereof of the literature search of prior art not being found to the LAMP of specific detection Bacillus coagulans detects, primer sets, detection kit and the detection method thereof of therefore developing Bacillus coagulans LAMP detection are very necessary.
Summary of the invention
The invention provides a kind of Bacillus coagulans and detect primer sets, test kit and method thereof, to overcome the existing above-mentioned shortcoming and defect of prior art.
First object of the present invention is to provide a kind of Bacillus coagulans LAMP detection primer sets.Second object of the present invention is to provide Bacillus coagulans LAMP detection kit.The 3rd object of the present invention is to provide Bacillus coagulans LAMP detection method.
Detection method of the present invention, through simple constant-temperature amplification once, just can reach the object of rapid detection Bacillus coagulans.Adopt this test kit and detection method to there is simple to operate, highly sensitive feature.
The technical problem that will solve required for the present invention, can be achieved through the following technical solutions:
As a first aspect of the present invention, the primer sets that a kind of Bacillus coagulans detects, it is characterized in that, the two pair primers of described primer sets taking Bacillus coagulans CK gene as target gene, based on loop-mediated isothermal amplification technology design: inner primer FIP/BIP and outer primer F3/B3, its nucleotide sequence is identical with SEQ ID NO.1-4.
Wherein, described two pairs of primers are respectively:
Outer primer F3:TTTTGGCTCACGGAAGAG(SEQ ID NO.1),
Outer primer B3:TGAACTGGCAGTCATACG(SEQ ID NO.2),
Inner primer FIP:AGAACGCCTTCAAAATCGCACTT
TTAGCTTGAATTATTACGGGAC（SEQ?ID?NO.3），
Inner primer BIP:AACTTTAATAAGGCACCGATTGT
GGTTTTATCTCGGGGATTTTGTCG（SEQ?ID?NO.4）。
As a second aspect of the present invention, a kind of Bacillus coagulans detection kit that adopts described primer sets, is characterized in that: described test kit comprises: primer sets, positive reference substance, LAMP reaction solution, Bst archaeal dna polymerase and nitrite ion.
Wherein, described primer sets, comprises inner primer FIP/BIP and outer primer F3/B3, and its nucleotide sequence is identical with SEQ ID NO.1-4, and the mol ratio that described outer primer and inner primer add is 1: 4～8.
Wherein, described positive reference substance is the genomic dna that contains Bacillus coagulans.
Wherein, in described LAMP reaction solution, contain 0.6～1.4mmol/L dNTP, 5～10 mmol/L Mg 2+, 0.5～1.2mol/L Betaine, 10 × Thermopol Buffer.
Wherein, described Bst archaeal dna polymerase and nitrite ion are commercially available, and nitrite ion is GeneFinder.
As a third aspect of the present invention, a kind of Bacillus coagulans detection method of Bacillus coagulans detection kit, is characterized in that: comprise the following steps:
(1) provide testing sample DNA;
(2) in LAMP reaction system, add described primer sets, LAMP reaction solution, BstDNA polysaccharase, carry out deactivation after isothermal amplification reactions;
(3) deactivation rear section product adds nitrite ion, observes colour developing result, and contrasts the colour developing result of positive reference substance simultaneously, if colour developing result is consistent, illustrate and in testing sample, contain Bacillus coagulans, if colour developing result is inconsistent, illustrates and in testing sample, do not contain Bacillus coagulans.
In step (2), the temperature range of described isothermal reaction is 58 DEG C, and the reaction times is 80min.
In step (3), the temperature of described deactivation is 80 DEG C, and inactivation time is 10min.
Beneficial effect of the present invention:
1, this Bacillus coagulans LAMP method is simple to operate, has good specificity.
2, this rapid reaction test kit reaction conditions gentleness, required instrument is simple, and amplification rapidly and efficiently, can complete less than 1.5h, and quicker compared with PCR, economical, applicable surface is wider.
Brief description of the drawings
Fig. 1 is the gel electrophoresis figure of Bacillus coagulans LAMP primer pair kind DNA of bacteria amplified production in embodiment 1.
M swimming lane is standard DNA marker 2000.
The amplification that No. 1 swimming lane is Bacillus coagulans.
2-6 swimming lane be respectively contain Bacillus subtillis ( bacillus subtilis), bacillus cereus ( bacillus cereus), bacillus megaterium ( bacillus megaterium), Bacillus licheniformis ( b a c i l l u s l i c h e n i f o r m i s) and intestinal bacteria type strain ( escherichia coli).
Fig. 2 is Bacillus coagulans LAMP primer pair kind DNA of bacteria amplified production GeneFinder colored graph in embodiment 1.
The amplification of managing as Bacillus coagulans for No. 1.
2-6 pipe be respectively contain Bacillus subtillis ( bacillus subtilis), bacillus cereus ( bacillus cereus), bacillus megaterium ( bacillus megaterium), Bacillus licheniformis ( b a c i l l u s l i c h e n i f o r m i s), intestinal bacteria type strain ( escherichia coli).
Fig. 3 is the gel electrophoresis figure of Bacillus coagulans LAMP primer pair different quantities Bacillus coagulans in embodiment 2.
M swimming lane is standard DNA marker 2000
Be respectively 6cfu/ system, 60 cfu/ systems, 600 cfu/ systems, 6000 cfu/ systems, 60000 cfu/ systems for No. 1-5.
Embodiment
In conjunction with following specific embodiments and the drawings, the present invention is described in further detail.Implement process of the present invention, condition, reagent, experimental technique etc., except the content of mentioning specially below, be universal knowledege and the common practise of this area, the present invention is not particularly limited content.
Embodiment 1
Testing sequence
1, extract Bacillus coagulans ( bacillus coagulans), Bacillus subtillis ( bacillus subtilis), bacillus cereus ( bacillus cereus), Bacillus licheniformis ( b a c i l l u s l i c h e n i f o r m i s), bacillus megaterium ( bacillus megaterium) and intestinal bacteria type strain ( escherichia coli) DNA, above-mentioned bacterial classification is originated in table 1.
2,, taking the DNA of bacteria in step 1 as template, increase by Bacillus coagulans LAMP primer sets.
Amplification system is: 25 μ l are by 2.5 μ l 10 × Buffer, 9 μ ldNTP(2.5mmol/L), 2 μ l FIP(20 mmol/L), 2 μ l BIP(20 mmol/L), 0.25 μ l F3(20 mmol/L), 0.25 μ l B3(20 mmol/L), 1 μ lBst DNA Polymerase(8U/ μ l), 2 μ l MgSO 4(100 mmol/L), 4 μ lBetaine(5mol/L), 2 μ l DNA profilings.
Amplification condition is: 58 DEG C of 80min carry out isothermal amplification reactions, and 80 DEG C of inactivation times are 10min, 4 DEG C of preservations.
3, get 5ul deactivation product and carry out 1% agarose gel electrophoresis, remaining liq product adds nitrite ion, observes colour developing result.
Experimental result
Detected result as shown in Figure 1, as can be seen from Figure 1 present embodiment can amplify a large amount of gradient magnitude nucleic acid fragments with the special LAMP primer of amplification Bacillus coagulans from Bacillus coagulans DNA, and fails to belong to DNA of bacteria and amplify nucleic acid fragment from other.
As shown in Figure 2, Bacillus coagulans DNA is grass green after adding GeneFinder with the product liquid that the special LAMP primer of Bacillus coagulans carries out LAMP amplification, and other genus DNA of bacteria are orange-yellow after adding GeneFinder with the product liquid that the special LAMP primer of Bacillus coagulans carries out LAMP amplification.
Fig. 1 shows that with Fig. 2 result is consistent, has all illustrated that the special LAMP primer specificity of Bacillus coagulans is good.
Table 1 bacterial classification source table
Embodiment 2
Testing sequence
1, the Bacillus coagulans bacterium liquid in logarithm latter stage is carried out to the dilution of continuous 10 times of gradients, then plate count extract respectively DNA profiling.
2,, taking the DNA of the different bacterium amount in step 1 as template, increase by Bacillus coagulans LAMP primer sets.
Pcr amplification system is: 25 μ l are by 2.5 μ l 10 × Buffer, 9 μ l dNTP(2.5mmol/L), 2 μ l FIP(20 mmol/L), 2 μ l BIP(20 mmol/L), 0.25 μ l F3(20 mmol/L), 0.25 μ l B3(20 mmol/L), 1 μ l Bst DNA Polymerase(8U/ μ l), 2 μ l MgSO 4, 4 μ l Betaine(5mol/L), 2 μ l DNA profilings.
Amplification condition is: 58 DEG C of 80min carry out isothermal amplification reactions, and 80 DEG C of inactivation times are 10min, 4 DEG C of preservations.
3, get 5ul deactivation product and carry out 1% agarose gel electrophoresis.
Experimental result
Detected result as shown in Figure 3, can also be seen nucleic acid fragment clearly at 2-5 swimming lane from Fig. 3, and what No. 2 swimming lanes were corresponding is 60cfu/ system, and this illustrates that the sensitivity of this system is 60cfu/ system.
The Bacillus coagulans LAMP detection method that the present invention sets up is special, sensitive, simple and efficient, in 1.5h, can complete, and can be used for the rapid detection of sample.
Above the specific embodiment of the present invention is illustrated, but the present invention is as limit, only otherwise depart from aim of the present invention, the present invention can also have various variations.
Sequence table
<110> Jiangsu Hengfengqiang Bio-Technology Co., Ltd.
<120> Bacillus coagulans detects primer sets, test kit and method thereof
<130> HDPI1400328
<160> 4
<170>PatentIn?version?3.3
<210> 1
<211> 18
<212> DNA
<213> artificial sequence
<400> 1
ttttggctcacggaagag 18
<210> 2
<211> 18
<212> DNA
<213> artificial sequence
<400> 2
tgaactggcagtcatacg 18
<210> 3
<211> 45
<212> DNA
<213> artificial sequence
<400> 3
agaacgccttcaaaatcgcacttttagcttgaattattacgggac 45
<210> 4
<211> 47
<212> DNA
<213> artificial sequence
<400> 4
aactttaataaggcaccgattgtggttttatctcggggattttgtcg 47

Claims (10)

1. the primer sets that Bacillus coagulans detects, it is characterized in that, the two pair primers of described primer sets taking Bacillus coagulans CK gene as target gene, based on loop-mediated isothermal amplification technology design: inner primer FIP/BIP and outer primer F3/B3, its nucleotide sequence is identical with SEQ ID NO.1-4.
2. primer according to claim 1, is characterized in that, described two pairs of primers are respectively:
Outer primer F3:TTTTGGCTCACGGAAGAG,
Outer primer B3:TGAACTGGCAGTCATACG,
Inner primer FIP:AGAACGCCTTCAAAATCGCACTT
TTAGCTTGAATTATTACGGGAC，
Inner primer BIP:AACTTTAATAAGGCACCGATTGT
GGTTTTATCTCGGGGATTTTGTCG。
3. a Bacillus coagulans detection kit that adopts primer sets as claimed in claim 1, is characterized in that: described test kit comprises: primer sets, positive reference substance, LAMP reaction solution, Bst archaeal dna polymerase and nitrite ion.
4. Bacillus coagulans detection kit according to claim 3, it is characterized in that: described primer sets, comprise inner primer FIP/BIP and outer primer F3/B3, its nucleotide sequence is identical with SEQ ID NO.1-4, and the mol ratio that described outer primer and inner primer add is 1: 4～8.
5. Bacillus coagulans detection kit according to claim 3, is characterized in that: described positive reference substance is the genomic dna that contains Bacillus coagulans.
6. Bacillus coagulans detection kit according to claim 3, is characterized in that: in described LAMP reaction solution, contain 0.6～1.4mmol/L dNTP, 5～10 mmol/L Mg 2+, 0.5～1.2mol/L Betaine, 10 × Thermopol Buffer.
7. Bacillus coagulans detection kit according to claim 3, is characterized in that: described Bst archaeal dna polymerase and nitrite ion are commercially available, and nitrite ion is GeneFinder.
8. a Bacillus coagulans detection method for Bacillus coagulans detection kit as claimed in claim 3, is characterized in that: comprise the following steps:
(1) provide testing sample DNA;
(2) in LAMP reaction system, add described primer sets, LAMP reaction solution, BstDNA polysaccharase, carry out deactivation after isothermal amplification reactions;
(3) deactivation rear section product adds nitrite ion, observes colour developing result, and contrasts the colour developing result of positive reference substance simultaneously, if colour developing result is consistent, illustrate and in testing sample, contain Bacillus coagulans, if colour developing result is inconsistent, illustrates and in testing sample, do not contain Bacillus coagulans.
9. Bacillus coagulans detection method according to claim 8, is characterized in that: in step (2), the temperature range of described isothermal reaction is 58 DEG C, and the reaction times is 80min.
10. Bacillus coagulans detection method according to claim 8, is characterized in that: in step (3), the temperature of described deactivation is 80 DEG C, and inactivation time is 10min.
CN201410243762.4A 2014-06-04 2014-06-04 A kind of Bacillus coagulans detection primer group, test kit and method thereof Active CN104152543B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410243762.4A CN104152543B (en) 2014-06-04 2014-06-04 A kind of Bacillus coagulans detection primer group, test kit and method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410243762.4A CN104152543B (en) 2014-06-04 2014-06-04 A kind of Bacillus coagulans detection primer group, test kit and method thereof

Publications (2)

Publication Number Publication Date
CN104152543A true CN104152543A (en) 2014-11-19
CN104152543B CN104152543B (en) 2016-08-24

Family

ID=51878168

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410243762.4A Active CN104152543B (en) 2014-06-04 2014-06-04 A kind of Bacillus coagulans detection primer group, test kit and method thereof

Country Status (1)

Country Link
CN (1) CN104152543B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102304559A (en) * 2010-02-05 2012-01-04 山东出入境检验检疫局检验检疫技术中心 Fluorescence quantitative polymerase chain reaction (PCR) method for detecting bacillus coagulans quickly

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102304559A (en) * 2010-02-05 2012-01-04 山东出入境检验检疫局检验检疫技术中心 Fluorescence quantitative polymerase chain reaction (PCR) method for detecting bacillus coagulans quickly

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MARISA MANZANO ET AL.: "Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides differentiation using a PCR-RE technique", 《INTERNATIONAL JOURNAL OF FOOD MICROBIOLOGY》 *
杨大伟等: "凝结芽孢杆菌PCR-DHPLC检测方法", 《青岛科技大学学报(自然科学版)》 *

Also Published As

Publication number Publication date
CN104152543B (en) 2016-08-24

Similar Documents

Publication Publication Date Title
CN111041113B (en) Rapid constant-temperature detection method, primer group and kit for bacillus cereus
Burtscher et al. Evaluation of the use of PCR and reverse transcriptase PCR for detection of pathogenic bacteria in biosolids from anaerobic digestors and aerobic composters
CN106367493B (en) Method, primer and application for rapid constant-temperature detection of salmonella
CN111073987B (en) Rapid constant-temperature detection method, primer group and kit for yersinia enterocolitica
CN111088377B (en) Rapid constant temperature detection method for staphylococcus aureus, primer set and application
CN106367501B (en) Method, primer and kit for rapid constant-temperature detection of salmonella
CN104004846A (en) Method for identifying bacillus coagulans
CN104152543B (en) A kind of Bacillus coagulans detection primer group, test kit and method thereof
CN110438203B (en) Method for improving loop-mediated isothermal amplification reaction efficiency and application
JP2011000008A (en) Method for detecting bacillus coagulans in test sample specifically, in a short period of time and with high sensitivity
CN104164499B (en) A kind of for expanding the specific primer that Psychrobacter belongs to
US9738939B2 (en) Method for differentiating between living and dead cells
CN118240950A (en) LAMP-based escherichia coli detection kit and rapid detection method
CN116426670A (en) Primer composition for rapidly detecting melon and other fungus by LAMP technology and detection method thereof
CN111004856A (en) Rapid constant-temperature detection method, primer group and kit for vibrio vulnificus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant