CN104141014B - A kind of kit and using method thereof of fast detecting common deletion type α-thalassemia - Google Patents

A kind of kit and using method thereof of fast detecting common deletion type α-thalassemia Download PDF

Info

Publication number
CN104141014B
CN104141014B CN201410417598.4A CN201410417598A CN104141014B CN 104141014 B CN104141014 B CN 104141014B CN 201410417598 A CN201410417598 A CN 201410417598A CN 104141014 B CN104141014 B CN 104141014B
Authority
CN
China
Prior art keywords
sea
section
prob
characteristic sequence
fluorescence probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201410417598.4A
Other languages
Chinese (zh)
Other versions
CN104141014A (en
Inventor
龙驹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201410417598.4A priority Critical patent/CN104141014B/en
Publication of CN104141014A publication Critical patent/CN104141014A/en
Application granted granted Critical
Publication of CN104141014B publication Critical patent/CN104141014B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of kit and using method thereof of fast detecting common deletion type α-thalassemia. Described kit comprises: the primer of the characteristic sequence y1 of Y1 section and the characteristic sequence y2 of Y2 section in a pair of α-globin gene cluster that can simultaneously increase, in pair for amplification α-globin gene cluster--SEAGenotypic primer, the fluorescence probe of the characteristic sequence y2 of the fluorescence probe of the characteristic sequence y1 of the primer of α 2 genes, a specific detection Y1 section, a specific detection Y2 section, a specific detection in pair for amplification α-globin gene cluster--SEAThe fluorescence probe of the fluorescence probe of genotype amplified production and specific detection α 2 gene amplification products. Kit of the present invention detects sensitivity, stability, accuracy and the higher specificity with height to α-thalassemia globin gene disappearance.

Description

A kind of kit and using method thereof of fast detecting common deletion type α-thalassemia
Technical field
The present invention relates to technical field of medical detection, be specifically related to a kind of fast detecting common deletion type α-thalassemiaKit and using method thereof.
Background technology
Thalassemia (MediterraneanAnemia), also claims Thalassemia (Thalassemia), Ku Le(Cooley) anaemia, globin dyssynthesis anaemia, be called for short poor. Thalassemia is modal monogenic inheritance diseaseOne of, the poor kind in common ground has that α-ground is poor and β-ground is poor, respectively by α-GFP bunch and beta-globin gene cluster exception tableReach and cause. In China, Guangxi, Guangdong and Hainan are thalassemic provinces occurred frequently, and wherein the poor incidence of disease in α-ground, Guangxi is15.5%. In Chinese population, the poor common genotype of genotype in deletion form α-ground is--SEA、-α3.7With-α4.2. Detect and lack at presentThe thalassemic main method of mistake type has Gap-PCR, high-resolution solubility curve (HRM, High-ResolutionMelting)、MLPA(MultiplexLigation-DependentProbeAmplificationAssay)、Southernblot analytic approach etc. Above method is applied in separately respectively pluses and minuses in thalassemia genotype detection.
Homologous gene quantitative technique is a kind of according to the homology of gene, adopts common amplimer to enter homologous geneRow amplification, finally adopts fluorescent marker method or sonde method the content of gene to be carried out to the method for relative quantification. α-globin baseBecause bunch (NG_000006.1) is by regulatory factor (HS-40), α gene (α 1 and α 2), ζ gene (ζ 2), pseudogene (Ψ ζ 1, Ψ α2and Ψ α 1) and θ composition, it puts in order as HS40 – ζ 2 – Ψ ζ 1 – Ψ α 2 – Ψ α 1 – α 2 – α 1 – θ. Gene of alpha thalassemiaAccording to its homology, can be divided into X1, X2, Y1, Y2, Z1 and Z2 interval, wherein-α3.7The formation of (also referred to as rightward deletion) comes fromHomologous recombination between Z1 and Z2, and-α4.2(also referred to as lefrward deletion) derives from the homologous recombination between X1 and X2, as Fig. 1Shown in, in Fig. 1, Y1 and Y2 homology. Have not yet to see the combination Taqman being formed by the amplimer of increase Y1 and Y2 simultaneouslyThe relevant report of the kit of the fast detecting common deletion type α-thalassemia of technology.
Summary of the invention
It is common scarce that the technical problem to be solved in the present invention is to provide a kind of fast detecting based on homologous gene quantitative techniqueKit and the using method thereof of mistake type α-thalassemia. Adopt this kit to detect α-globin gene by relative quantificationα 1 and the copy number of α 2 functional genes and the variation of copy number in bunch.
The kit of fast detecting common deletion type α-thalassemia of the present invention, comprises amplimer and fluorescenceProbe, described amplimer is: characteristic sequence y1 and the Y2 of Y1 section in a pair of α-globin gene cluster that can simultaneously increasePrimer Y1Y2-F and the Y1Y2-R of the characteristic sequence y2 of section, in pair for amplification α-globin gene cluster--SEAGenotypic Gap-PCR primer SEA-F and SEA-R, and primer A2-F and the A2-R of α 2 genes in pair for amplification α-globin gene cluster; DescribedFluorescence probe is: the fluorescence probe Y1-Prob of the characteristic sequence y1 of a specific detection Y1 section, a specific detection Y2The fluorescence probe Y2-Prob of the characteristic sequence y2 of section, a specific detection--SEAThe fluorescence probe of genotype amplified productionSEA-Prob, and the fluorescence probe A2-Prob of specific detection α 2 gene amplification products;
Wherein:
The characteristic sequence y1 of Y1 section and the feature order of Y2 section in the described α-globin gene cluster that can simultaneously increaseIn the primer pair of row y2,
Y1Y2-F:5’-TGCACCCACTGGCACTC-3’；
Y1Y2-R:5’-AGGAAGGAAGGGGTGGACT-3’；
In described amplification α-globin gene cluster--SEAIn genotypic Gap-PCR primer pair,
SEA-F:5’-AGAAGCTGAGTGATGGGTCC-3’；
SEA-R:5’-TGGACTTAAGTGATCCTCCTGC-3’；
In described amplification α-globin gene cluster in the primer pair of α 2 genes,
A2-F:5’-TCCTGGCTTCTGTGAGCAC-3’；
A2-R:5’-GCAGAGAGGTCCTTGGTCTG-3’；
The fluorescence probe Y1-Prob of the characteristic sequence y1 of described specific detection Y1 section is:
Y1-Prob:5’-6-FAM-CACCTCCCACCCTTCCCCAGA-BHQ-1-3’；
The fluorescence probe Y2-Prob of the characteristic sequence y2 of described specific detection Y2 section is:
Y2-Prob:5’-ROX-CTCCCACCCTCCCCCTCGCCA-BHQ-2-3’；
Described specific detection--SEAThe fluorescence probe SEA-Prob of genotype amplified production is:
SEA-Prob:5’-HEX-CTTCGCAGGAACTCGGTCGTCCC-BHQ-1-3’；
The fluorescence probe A2-Prob of described specific detection α 2 gene amplification products is:
A2-Prob:5’-CY5-ACCTCCATTGTTGGCACATTCCGGGA-BHQ-2-3’。
In fluorescence probe of the present invention, FAM refers to Fluoresceincarboxylic acid, and HEX refers to chlordene-6-methyl fluorescein, and ROX refers to carboxylicBase-X-rhodamine, CY5 refers to cyanine dye molecule 5, BHQ-1 and BHQ-2 refer to fluorescent quenching group.
In technique scheme, the sequence of described Y1 section is: 5 '-AGTCCACCCCTTCCTTCCTCACCCTGCAGGAGCTGGCCAGCCTCATCACCCCAACATCTCCCCACCTCCATTCTCCAACCACAGGGCCCTTGTCTCCTCTGTCCTTTCCCCTCCCCGAGCCAAGCCTCCTCCCTCCTCCACCTCCTCCACCTAATACATATCCTTAAGTCTCACCTCCTCCAGGAAGCCCTCAGACTAACCCTGGTCACCTTGAATGCCTCGTCCACACCTCCAGACTTCCTCAGGGCCTGTGATGAGGTCTGCACCTCTGTGTGTACTTGTGTGATGGTTAGAGGACTGCCTACCTCCCAGAGGAGGTTGAATGCTCCAGCCGGTTCCAGCTATTGCTTTGTTTACCTGTTTAACCAGTATTTACCTAGCAAGTCTTCCATCAGA TAG-3 '; The feature of this Y1 sectionSequences y 1 is: 5 '-TGCACCCACTGGCACTCCTGCACCTCCCACCCTTCCCCAGAAGTCCACCCCTTCCT TCCT-3 '.
In technique scheme, the sequence of described Y2 section is: 5 '-AGTCCACCCCTTCCTTCCTCACCCCACATCCCCTCACCTACATTCTGCAACCACAGGGGCCTTCTCTCCCCTGTCCTTTCCCTACCCAGAGCCAAGTTTGTTTATCTGTTTACAACCAGTATTTACCTAGCAAGTCTTCCATCAGATAG-3 '; The characteristic sequence y2 of this Y2 section is: 5 '-TGCACCCACTGGCACTCCTGCACCTCCCACCCTCCCCCTCGCCAAGTCCACCCCTTCCTTCCT-3’。
The kit of fast detecting common deletion type α-thalassemia of the present invention also comprises some available reagentsConventional and necessary component in box, as buffer solution, enzyme liquid, MgCl2With dNTP etc., concrete, enzyme liquid is archaeal dna polymerase, toolBody can adopt the GoldStarTaqDNAPolymerase of health for producing in century, and buffer solution is and GoldStarTaqThe buffer solution that DNAPolymerase is supporting.
The present invention also provides and adopts mentioned reagent box to carry out the method for fast detecting common deletion type α-thalassemia, wrapsDraw together following steps:
1) extracting sample genomic dna, prepares DNA profiling;
2) preparation reaction system, is specially:
Get the characteristic sequence y1 of Y1 section and the characteristic sequence y2 of Y2 section in the α-globin gene cluster that can simultaneously increasePrimer Y1Y2-F and Y1Y2-R, amplification α-globin gene cluster in--SEAGenotypic Gap-PCR primer SEA-F and SEA-R,Primer A2-F and the A2-R of α 2 genes in amplification α-globin gene cluster; The fluorescence of the characteristic sequence y1 of specific detection Y1 sectionFluorescence probe Y2-Prob, the specific detection of the characteristic sequence y2 of probe Y1-Prob, specific detection Y2 section--SEAGeneThe fluorescence probe A2-Prob of the fluorescence probe SEA-Prob of type amplified production and specific detection α 2 gene amplification products; AndPCR buffer solution, enzyme liquid, MgCl2, dNTP, water and DNA profiling be mixed with reaction system;
3) pattern detection: respectively the reaction system of preparation is carried out to pcr amplification, record the fluorescence in each PCR reaction tubeThe cycle-index Cq (size of Cq value can reflect detected template number number) that signal experiences while arriving the thresholding of setting;
4) data analysis and result are judged: the Cq value obtaining according to quantitative detection, and with normal genotype (α α/α α) sampleFor contrast sample, calculate by following formula:
The gene Δ Cq=Cq of sample to be checked_Y2-Cq_Y1；
The gene Δ Δ Cq=Δ Cq of sample to be checked_ sample to be checked-ΔCq_ normal sample；
The Y1 of sample to be checked and the relative copy number ratio of Y2 (using Y1 and Y2 here)
Carry out result judgement according to the value of R in conjunction with following table 1:
Table 1:
Genotype Y2/Y1 (theoretical value) SEA A2
αα/αα 1 - +
--SEA/αα 1 + +
-α3.7/αα 2 - +
-α4.2/αα 0.5 - +
--SEA/-α3.7 Y2+，Y1- + -
--SEA/-α4.2 Y1+，Y2- + -
-α3.7/-α3.7 Y2+，Y1- - -
-α4.2/-α4.2 Y1+，Y2- - -
-α3.7/-α4.2 1 - -
--SEA/--SEA Y1-，Y2- + -
Wherein, when R is during in 0.75～1.26 scope, its result matches " 1 " in table theoretical value; When R is 1.8～2.6When scope, its result matches " 2 " in table theoretical value; When R is during in 0.33～0.53 scope, its result matches table theoretical valueIn " 0.5 "; If the result of calculation of R not within the scope of R value defined above time, should adopt additive method to carry out auxiliary judgment;In table, "+" represents the positive, represents to exist amplified production; "-" represents negative, do not have this amplified production.
General principle of the present invention is to be the morbidity machine that causes the poor basic reason in α-ground based on α-globin gene delectionSystem.-α3.7With-α4.2The Molecular Biology Mechanism as shown in Figure 1. Adopt kit of the present invention to carry out in conjunction with said methodWhen detection, work as Y1=Y2, and A2 is while having amplification curve, do not comprise-α of sample to be tested3.7Or-α4.2; If Y1=2Y2, and A2While having amplification curve, contain-α of the genotype of sample to be tested4.2, without other α disappearances; If 2Y1=Y2, and A2 has amplification curveTime, contain-α of the genotype of sample to be tested3.7, without other α disappearances; If Y1=0, must reference--SEAIf SEA has amplification bentLine, the genotype of this sample is--SEAWith-α3.7The genotype of composition, if SEA does not have amplification curve, this sample genotypeFor-α3.7/-α3.7; If Y2=0, must reference--SEAIf SEA has amplification curve, the genotype of this sample is--SEAWith-α4.2Composition genotype, if without SEA amplification curve this sample genotype be-α4.2/-α4.2; If Y1=Y2 and A2 be without amplification curve,And SEA is during without amplification curve, and the poor genotype in the α-ground of sample to be tested is-α3.7/-α4.2; If while only having SEA to have amplification curve,This sample genotype is--SEA/--SEA。
Kit of the present invention, is to adopt quadruple TaqMan fluorescent quantitation technology, quantitatively detects α 1 in sample, α 2The copy number of gene, and the having or not of SEA and A2, comprehensively realize the poor rapid molecular diagnosis in common deletion type α-ground. Due toIn use, its quantitative result is not to follow perfect theoretical value to TaqMan fluorescent quantitation technology, and its result can be in theoretical valueLeft and right float, therefore, the applicant's statistics after to the checking of a large amount of known type samples is just drawn in said methodCorresponding relation in the calculated value of described R and table 1 in theoretical value, if the result of calculation of R is not in R value scope defined aboveWhen interior, should adopt additive method to carry out auxiliary judgment.
The step 1 of said method) in, adopt existing conventional method to prepare DNA profiling.
The step 2 of said method) in:
The characteristic sequence y1 of Y1 section and the feature order of Y2 section in the described α-globin gene cluster that can simultaneously increaseIn the primer pair of row y2,
Y1Y2-F:5’-TGCACCCACTGGCACTC-3’；
Y1Y2-R:5’-AGGAAGGAAGGGGTGGACT-3’；
In described amplification α-globin gene cluster--SEAIn genotypic Gap-PCR primer pair,
SEA-F:5’-AGAAGCTGAGTGATGGGTCC-3’；
SEA-R:5’-TGGACTTAAGTGATCCTCCTGC-3’；
In described amplification α-globin gene cluster in the primer pair of α 2 genes,
A2-F:5’-TCCTGGCTTCTGTGAGCAC-3’；
A2-R:5’-GCAGAGAGGTCCTTGGTCTG-3’；
The fluorescence probe Y1-Prob of the characteristic sequence y1 of described specific detection Y1 section is:
Y1-Prob:5’-6-FAM-CACCTCCCACCCTTCCCCAGA-BHQ-1-3’；
The fluorescence probe Y2-Prob of the characteristic sequence y2 of described specific detection Y2 section is:
Y2-Prob:5’-ROX-CTCCCACCCTCCCCCTCGCCA-BHQ-2-3’；
Described specific detection--SEAThe fluorescence probe SEA-Prob of genotype amplified production is:
SEA-Prob:5’-HEX-CTTCGCAGGAACTCGGTCGTCCC-BHQ-1-3’；
The fluorescence probe A2-Prob of described specific detection α 2 gene amplification products is:
A2-Prob:5’-CY5-ACCTCCATTGTTGGCACATTCCGGGA-BHQ-2-3’；
In fluorescence probe, FAM refers to Fluoresceincarboxylic acid, and HEX refers to chlordene-6-methyl fluorescein, and ROX refers to carboxyl-X-rhodamine,CY5 refers to cyanine dye molecule 5, and BHQ-1 and BHQ-2 refer to fluorescent quenching group.
The step 2 of said method) in, in described reaction system, the concentration of each component is preferably: each primer: 0.25～0.5 μMol/L; DNA profiling: 20～200ng; Magnesium ion: 1.5～1.9mmol/L; The final volume of reaction system is preferably 20 μ L.
The step 3 of said method) in, pcr amplification condition is: 95 DEG C of denaturations 8～10 minutes, then 95 DEG C 15～30Second, to anneal 50～70 seconds for 60 DEG C, 39～49 circulations, gather fluorescence signals in 60 DEG C of annealing steps ends. Preferred pcr amplificationCondition is: 95 DEG C of denaturations 10 minutes, then 95 DEG C 15 seconds, 60 DEG C of annealing 60 seconds, 40 circulations.
Compared with prior art, feature of the present invention is:
1, in kit of the present invention, need quantitative 2 genes (Y1 and Y2) only to adopt 1 group of primer can increase,The uniformity of amplification efficiency and quantitative accuracy are ensured to greatest extent;
2, kit of the present invention, without introducing reference gene, adopts relative quantification method, by ratio result, andCan accurately judge genotype in conjunction with having or not of SEA and A2 curve;
3, α-thalassemia globin gene disappearance is detected to sensitivity, stability and the accuracy with height, withAnd higher specificity.
Brief description of the drawings
Fig. 1 is-α3.7With-α4.2Molecular biology structure chart, from structural analysis in figure, the copy number ratio of Y1 and Y2Value can be used as differentiation-α3.7With-α4.2Foundation.
Detailed description of the invention
With specific embodiment, the invention will be further described below, but the present invention is not limited to these embodiment.
Embodiment 1: adopt the testing result of kit of the present invention in known type sample
1, the composition of kit:
(1) can simultaneously increase the characteristic sequence y1 of Y1 section and the characteristic sequence y2 of Y2 section in α-globin gene clusterPrimer pair Y1Y2-F and Y1Y2-R:
Y1Y2-F:5’-TGCACCCACTGGCACTC-3’(SEQIDNO：1)；
Y1Y2-R:5’-AGGAAGGAAGGGGTGGACT-3’(SEQIDNO：2)；
(2) in amplification α-globin gene cluster--SEAGenotypic Gap-PCR primer pair SEA-F and SEA-R:
SEA-F:5’-AGAAGCTGAGTGATGGGTCC-3’(SEQIDNO：3)；
SEA-R:5’-TGGACTTAAGTGATCCTCCTGC-3’(SEQIDNO：4)；
(3) primer pair A2-F and the A2-R of α 2 genes in amplification α-globin gene cluster:
A2-F:5’-TCCTGGCTTCTGTGAGCAC-3’(SEQIDNO：5)；
A2-R:5’-GCAGAGAGGTCCTTGGTCTG-3’(SEQIDNO：6)；
(4) the fluorescence probe Y1-Prob of the characteristic sequence y1 of specific detection Y1 section:
Y1-Prob:5’-6-FAM-CACCTCCCACCCTTCCCCAGA-BHQ-1-3’(SEQIDNO：7)；
(5) the fluorescence probe Y2-Prob of the characteristic sequence y2 of specific detection Y2 section:
Y2-Prob:5’-ROX-CTCCCACCCTCCCCCTCGCCA-BHQ-2-3’(SEQIDNO：8)；
(6) specific detection--SEAThe fluorescence probe SEA-Prob of genotype amplified production:
SEA-Prob:5’-HEX-CTTCGCAGGAACTCGGTCGTCCC-BHQ-1-3’(SEQIDNO：9)；
(7) the fluorescence probe A2-Prob of specific detection α 2 gene amplification products:
A2-Prob:5’-CY5-ACCTCCATTGTTGGCACATTCCGGGA-BHQ-2-3’(SEQIDNO：10)；
Above-mentioned each primer and fluorescence probe are all for designing in α-globin gene cluster, wherein:
The sequence of described Y1 section is:
5’-AGTCCACCCCTTCCTTCCTCACCCTGCAGGAGCTGGCCAGCCTCATCACCCCAACATCTCCCCACCTCCATTCTCCAACCACAGGGCCCTTGTCTCCTCTGTCCTTTCCCCTCCCCGAGCCAAGCCTCCTCCCTCCTCCACCTCCTCCACCTAATACATATCCTTAAGTCTCACCTCCTCCAGGAAGCCCTCAGACTAACCCTGGTCACCTTGAATGCCTCGTCCACACCTCCAGACTTCCTCAGGGCCTGTGATGAGGTCTGCACCTCTGTGTGTACTTGTGTGATGGTTAGAGGACTGCCTACCTCCCAGAGGAGGTTGAATGCTCCAGCCGGTTCCAGCTATTGCTTTGTTTACCTGTTTAACCAGTATTTACCTAGCAAGTCTTCCATCAGATAG-3 ' (SEQIDNO:11); The characteristic sequence y1 of this Y1 section is: 5 '-TGCACCCACTGGCACTCCTGCACCTCCCACCCTTCCCCAGAAGTCCACCCCTTCCTTCCT-3’(SEQIDNO：12)；
The sequence of described Y2 section is:
5’-AGTCCACCCCTTCCTTCCTCACCCCACATCCCCTCACCTACATTCTGCAACCACAGGGGCCTTCTCTCCCCTGTCCTTTCCCTACCCAGAGCCAAGTTTGTTTATCTGTTTACAACCAGTATTTACCTAGCAAGTCTTCCATCAGATAG-3 ' (SEQIDNO:13); The characteristic sequence y2 of this Y2 section is: 5 '-TGCACCCACTGGCACTCCTGCACCTCCCACCCTCCCCCTCGCCAAGTCCACCCCTTCCTTCCT-3’(SEQIDNO：14)。
(8) other constituent:
GoldStarTaqDNAPolymerase, with the supporting buffer solution of GoldStarTaqDNAPolymeraseWith dNTPs be all century purchased from health, MgCl2Purchased from LifeTechnology.
Prepare PCR reaction system by following table 2:
Table 2:(mM represents mmol/L, and μ M represents μ mol/L)
2, implementation method:
PCR reaction instrument is the real-time thermal cycler CFX96 of Bio-Rad. PCR response procedures is:
95 DEG C of denaturation 10min; 95 DEG C of 15sec+60 DEG C of 1min, 40 circulations, gather fluorescence in 60 DEG C of annealing steps endsSignal.
Sample process: adopt the extracting of Lab-AidDNAminiextractionkid (Bio-V, Xiamen) kitDNA, is diluted to 20～200ng/ μ L with distilled water for subsequent use. DNA sample also can adopt other conventional DNA extracting methods to extract.
Pattern detection: by sample to be checked, and 3 parts of normal genotypes (α α/α α) sample, according to above-mentioned reaction system and anti-Answer program, on quantitative real time PCR Instrument, carry out augmentation detection, record Cq value.
3, sample source: all sample standard deviations source conventional Gap-PCR technology of hanging oneself is determined the DNA sample of caryogram.
4, data analysis and result are judged: by formula of the present invention (Δ Cq=Cq_Y2-Cq_Y1) calculate normal sample baseBecause of the gene Δ Cq of Δ Cq and sample to be checked_ sample to be checked; Using the average delta Cq value of above-mentioned 3 parts of normal genotype samples as ΔCq_ normal sample, result as described in Table 3, according to formula Δ Δ Cq=Δ Cq_ sample to be checked-ΔCq_ normal sampleCalculate Δ Δ Cq value, pass throughFormulaCalculate the ratio of Y1 and Y2, and determine and detect the Y1 obtaining according to aforementioned table 1 criterion by its resultWith the relative copy number of Y2, result is as shown in following table 3 and table 4:
Table 3:
Note: in table, "+" represents that this passage has amplification curve positive, and "-" represents that this passage is without amplification curve, negative.
Table 4:
Note: in table, "+" represents that this passage has amplification curve positive, and "-" represents that this passage is without amplification curve, negative.
From result, the present invention can distinguish by data analysis--SEA/ α α genotype, α α/α α genotype ,-α3.7/ α α genotype and-α4.2/ α α genotype; And the genotype of all samples that detect is definite through conventional Gap-PCR technology with itGenotype identical, illustrate that kit of the present invention has good accuracy in the time of the detection to known type sample.
Embodiment 2: the detection effect of the present invention in random gene type sample.
1, the composition of kit:
With embodiment 1.
2, implementation method:
With embodiment 1.
3, sample source:
Sample is 36 routine random samples (Xin Yue Bioisystech Co., Ltd provides by Jinan), with distilled water be diluted to 20～200ng, as sample to be checked), and the normal samples of 3 example of verifying through Gap-PCR.
4, data analysis and result are judged:
Calculate according to data analysis formula of the present invention, and true according to aforementioned table 1 criterion by its resultRegular inspection is surveyed the Y1 that obtains and the relative copy number of Y2, and result is as shown in following table 5 and table 6; Using kit of the present inventionAnd method is when detecting above-mentioned sample, adopts existing Gap-PCR method to verify, result as following table 5 andShown in table 6:
Table 5:
Note: in table, "+" represents that this passage has amplification curve positive, and "-" represents that this passage is without amplification curve, negative.
Table 6:
Note: in table, "+" represents that this passage has amplification curve positive, and "-" represents that this passage is without amplification curve, negative.
From the above results, adopt kit of the present invention in conjunction with method of the present invention in common deletion typeDuring α-thalassemia detects, its result is consistent with Gap-PCR method.

Claims (2)

1. a kit for fast detecting common deletion type α-thalassemia, comprises amplimer and fluorescence probe, its spyLevy and be:
Described amplimer is: the characteristic sequence y1He Y2 district of Y1 section in a pair of α-globin gene cluster that can simultaneously increasePrimer Y1Y2-F and the Y1Y2-R of the characteristic sequence y2 of section, in pair for amplification α-globin gene cluster--SEAGenotypic Gap-PCR primer SEA-F and SEA-R, and primer A2-F and the A2-R of α 2 genes in pair for amplification α-globin gene cluster;
Described fluorescence probe is: the fluorescence probe Y1-Prob of the characteristic sequence y1 of a specific detection Y1 section, Yi TiaoteThe opposite sex detects the fluorescence probe Y2-Prob of the characteristic sequence y2 of Y2 section, a specific detection--SEAGenotype amplified productionFluorescence probe SEA-Prob, and the fluorescence probe A2-Prob of specific detection α 2 gene amplification products;
Wherein:
The characteristic sequence y1 of Y1 section and the characteristic sequence y2 of Y2 section in the described α-globin gene cluster that can simultaneously increasePrimer pair in,
Y1Y2-F:5’-TGCACCCACTGGCACTC-3’；
Y1Y2-R:5’-AGGAAGGAAGGGGTGGACT-3’；
In described amplification α-globin gene cluster--SEAIn genotypic Gap-PCR primer pair,
SEA-F:5’-AGAAGCTGAGTGATGGGTCC-3’；
SEA-R:5’-TGGACTTAAGTGATCCTCCTGC-3’；
In described amplification α-globin gene cluster in the primer pair of α 2 genes,
A2-F:5’-TCCTGGCTTCTGTGAGCAC-3’；
A2-R:5’-GCAGAGAGGTCCTTGGTCTG-3’；
The fluorescence probe Y1-Prob of the characteristic sequence y1 of described specific detection Y1 section is:
Y1-Prob:5’-6-FAM-CACCTCCCACCCTTCCCCAGA-BHQ-1-3’；
The fluorescence probe Y2-Prob of the characteristic sequence y2 of described specific detection Y2 section is:
Y2-Prob:5’-ROX-CTCCCACCCTCCCCCTCGCCA-BHQ-2-3’；
Described specific detection--SEAThe fluorescence probe SEA-Prob of genotype amplified production is:
SEA-Prob:5’-HEX-CTTCGCAGGAACTCGGTCGTCCC-BHQ-1-3’；
The fluorescence probe A2-Prob of described specific detection α 2 gene amplification products is:
A2-Prob:5’-CY5-ACCTCCATTGTTGGCACATTCCGGGA-BHQ-2-3’；
The sequence of described Y1 section is:
5’-AGTCCACCCCTTCCTTCCTCACCCTGCAGGAGCTGGCCAGCCTCATCACCCCAACATCTCCCCACCTCCATTCTCCAACCACAGGGCCCTTGTCTCCTCTGTCCTTTCCCCTCCCCGAGCCAAGCCTCCTCCCTCCTCCACCTCCTCCACCTAATACATATCCTTAAGTCTCACCTCCTCCAGGAAGCCCTCAGACTAACCCTGGTCACCTTGAATGCCTCGTCCACACCTCCAGACTTCCTCAGGGCCTGTGATGAGGTCTGCACCTCTGTGTGTACTTGTGTGATGGTTAGAGGACTGCCTACCTCCCAGAGGAGGTTGAATGCTCCAGCCGGTTCCAGCTATTGCTTTGTTTACCTGTTTAACCAGTATTTACCTAGCAAGTCTTCCATCAGATAG-3’；
The sequence of described Y2 section is:
5’-AGTCCACCCCTTCCTTCCTCACCCCACATCCCCTCACCTACATTCTGCAACCACAGGGGCCTTCTCTCCCCTGTCCTTTCCCTACCCAGAGCCAAGTTTGTTTATCTGTTTACAACCAGTATTTACCTAGCAAGTCTTCCATCAGATAG-3’；
The characteristic sequence y1 of described Y1 section is: 5 '-TGCACCCACTGGCACTCCTGCACCTCCCACCCTTCCCCAGAAGTCCACCCCTTCCTTCCT-3’；
The characteristic sequence y2 of described Y2 section is: 5 '-TGCACCCACTGGCACTCCTGCACCTCCCACCCTCCCCCTCGCCAAGTCCACCCCTTCCTTCCT-3’。
2. the kit of fast detecting common deletion type α-thalassemia according to claim 1, is characterized in that: instituteThe kit of stating also comprises PCR buffer solution, enzyme liquid, MgCl2And dNTP.
CN201410417598.4A 2014-04-16 2014-08-22 A kind of kit and using method thereof of fast detecting common deletion type α-thalassemia Expired - Fee Related CN104141014B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410417598.4A CN104141014B (en) 2014-04-16 2014-08-22 A kind of kit and using method thereof of fast detecting common deletion type α-thalassemia

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CN201410152706.XA CN103911455A (en) 2014-04-16 2014-04-16 Kit for quickly detecting common deletion-form alpha-thalassemia and application method thereof
CN201410152706X 2014-04-16
CN201410152706.X 2014-04-16
CN201410417598.4A CN104141014B (en) 2014-04-16 2014-08-22 A kind of kit and using method thereof of fast detecting common deletion type α-thalassemia

Publications (2)

Publication Number Publication Date
CN104141014A CN104141014A (en) 2014-11-12
CN104141014B true CN104141014B (en) 2016-05-11

Family

ID=51037457

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201410152706.XA Pending CN103911455A (en) 2014-04-16 2014-04-16 Kit for quickly detecting common deletion-form alpha-thalassemia and application method thereof
CN201410417598.4A Expired - Fee Related CN104141014B (en) 2014-04-16 2014-08-22 A kind of kit and using method thereof of fast detecting common deletion type α-thalassemia

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201410152706.XA Pending CN103911455A (en) 2014-04-16 2014-04-16 Kit for quickly detecting common deletion-form alpha-thalassemia and application method thereof

Country Status (1)

Country Link
CN (2) CN103911455A (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105154577A (en) * 2015-10-26 2015-12-16 钦州市妇幼保健院 Reagent kit for rapidly detecting alpha2 mutant alleles
CN109112210A (en) * 2017-06-23 2019-01-01 陈治中 Primer sets and kit for 4.2 deletion form thalassemia of Genotyping detection-α
CN109112205A (en) * 2017-06-23 2019-01-01 陈治中 The primer sets and kit of 3 kinds of deletional α-thalassemias are detected for Genotyping
CN109112203A (en) * 2017-06-23 2019-01-01 陈治中 α is detected for Genotyping+The primer sets and kit of deletion form thalassemia
CN109112208A (en) * 2017-06-23 2019-01-01 陈治中 For detecting the primer sets and kit of deletion form α-thalassemia
CN107245528B (en) * 2017-08-04 2020-04-21 亚能生物技术（深圳）有限公司 Rapid detection kit for common thalassemia mutant genes of Chinese population
CN110438219B (en) * 2019-08-12 2023-05-23 广东省妇幼保健院 Primers, probes, kit and method for noninvasive prenatal diagnosis of Papanic edema fetuses based on microdroplet digital PCR
CN111961717B (en) * 2020-08-28 2023-08-01 南方医科大学 Fluorescent PCR kit for simultaneously detecting deletion type and non-deletion type alpha-thalassemia genes by single tube

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102344925B (en) * 2011-10-20 2014-04-30 昆明金域医学检验所有限公司 Depletion alpha thalassemia-2 gene and assay kit and PCR sequencing method thereof
CN102864153B (en) * 2012-08-03 2014-02-19 李泽松 Deleted alpha-mediterranean anemia gene, test kit and method

Also Published As

Publication number Publication date
CN103911455A (en) 2014-07-09
CN104141014A (en) 2014-11-12

Similar Documents

Publication Publication Date Title
CN104141014B (en) A kind of kit and using method thereof of fast detecting common deletion type α-thalassemia
CN104178573B (en) For detecting test kit and the using method thereof of common deletion type α-thalassemia
CN104263848B (en) A kind of deaf susceptibility gene mutation detection kit and preparation method thereof and application
CN105506111B (en) Method for detecting CNV (CNV) marker of MAPK10 gene of Nanyang cattle and application of CNV marker
JPWO2020160414A5 (en)
CN105316418B (en) For detecting the specific primer of duck derived component, probe, kit and its detection method in meat products
JP2019509051A5 (en)
CN105861641A (en) Primer, kit and method for detecting CHO cell DNA residues
CN106480201A (en) Metastasis in Breast Cancer assesses test kit
CN111534514A (en) Novel coronavirus detection kit based on Crisper
CN106048034A (en) Method for scanning and analyzing animal-source components in food based on PCR-RLFP-DHPLC technology
CA2882253C (en) Gene expression profile associated with prostate cancer
Su et al. Real‐world outcomes of NSCLC patients receiving tissue or circulating tumor DNA‐guided osimertinib treatment
Berdal et al. A statistical approach for evaluation of PCR results to improve the practical limit of quantification (LOQ) of GMO analyses (SIMQUANT)
Li et al. The cornerstone of integrating circulating tumor DNA into cancer management
CN105176995A (en) Hydrolysis probe method based kit capable of simultaneously detecting deletion -alpha<21.9> and alpha2 variation of thalassemia
CN104911260A (en) Novel detection kit for copy number of fibroblast growth factor 19 (FGF19) gene
CN105200122B (en) Quantitative detection kit for wheat stripe rust and application thereof
CN106591447A (en) Sequencing method of single cell whole genome
CN102899397B (en) Woolens and Cashmere quantitative determination method based on DNA analysis
CN105483267A (en) Plasma cfDNA (cell-free deoxyribonucleic acid) bi-molecular marker, method for marking and detecting plasma cfDNA and application of plasma cfDNA bi-molecular marker
CN105154575A (en) Kit for quickly detecting sinotype deletional thalassemia based on hydrolysis probe method
Kang et al. Validation of a one-step genomics-based molecular classifier for endometrial carcinoma in a large Chinese population
CN105087566B (en) Identify fluorescence quantifying PCR method, primer and probe and its application of suspension culture of Aquilaria sinensis
CN105713965A (en) Kit for detecting PIK3CA gene mutation

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20160511

Termination date: 20200822