CN104140945A

CN104140945A - Engineering bacteria based on glutamine synthetase and implementation method of engineering bacteria

Info

Publication number: CN104140945A
Application number: CN201410374683.7A
Authority: CN
Inventors: 周培; 冯海玮; 孙玉静; 毛亮; 支月娥; 唐冬; 卫星; 罗艳青
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2014-07-31
Filing date: 2014-07-31
Publication date: 2014-11-12

Abstract

The invention discloses engineering bacteria based on glutamine synthetase and an implementation method of the engineering bacteria in the genetic engineering technical field. The method includes the steps of firstly, conducting PCR amplification on primers containing enzyme cutting sites with the streptomyces griseorubens genome DNA serving as a template so as to obtain glutamine synthetase encoding genes; secondly, inserting the genes into the escherichia coli expression vector pET-22b(+) to obtain a recombinant expression vector containing the glutamine synthetase encoding genes; thirdly, introducing the recombinant expression vector into escherichia coli expression bacterial strains, and conducting screening to obtain the engineering bacteria of glutamine synthetase. In order to overcome the defects that in the prior art, due to the fact that glutamine synthetase is generally endoenzyme in vivo and the expression quantity is low, the application range and the effect are seriously limited, a large amount of glutamine synthetase can be expressed and synthesized in vitro through the genetic engineering means.

Description

Engineering bacteria based on glutamine synthetase and its implementation

Technical field

What the present invention relates to is a kind of gene and engineering strain thereof of technical field of biological genetic engineering, specifically the slightly engineering bacteria based on glutamine synthetase and its implementation of red streptomyces of a kind of ash.

Background technology

Nitrogen is one of most important nutritive element in plant growth and development process.At present, maintain or the main method that improves crop yield is heavy dressing, but using in a large number of nitrogenous fertilizer not only increases peasant's production cost, and can aggravate the eutrophication of water body and the discharge of greenhouse gases.

For crop, can assimilation NO ₃ ^-, NH ₄ ⁺and the different nitrogen form such as ammonia state N, but generally with NO ₃ ^-for major nitrogen source.Plant is with NO ₃ ^-during for nitrogenous source, nitrogen assimilation can be divided into 3 stages: the inorganic assimilation (NO of (1) nitrogen ₃ ^-?NO ₂?NH ₄ ⁺); (2) assimilation of ammonia, i.e. NH ₄ ⁺through the synthetic glutamine of glutamine synthetase (GS), then synthesize L-glutamic acid by glutamine through glutamate synthase (GOGAT); (3) organic assimilation of ammonia, by glutamine and synthetic other amino acid of L-glutamic acid, and then synthetic protein and other materials.As can be seen here, glutamine synthetase plays a part very crucial in nitrogen assimilation path.

Organism is very important physiological process to the assimilation of nitrogen element, and the organonitrogen that inorganic nitrogen must assimilate into glutamine form could be absorbed by organism.Glutamine synthetase (glutamine synthetase, GS) is the key enzyme of nitrogen assimilation approach, it and NADPH-linked glutamate synthase acting in conjunction, catalyzing N H ₄ ⁺with changing into glutamine, glutamine under the catalysis of glutamate synthase, is transferred to its acid amides on α ?ketoisocaproic again, thereby generates two molecule L-glutamic acid.Glutamine is as nitrogen donor in the biosynthesizing of organism itrogenous organic substance, and extraneous inorganic nitrogen also must just can enter the nitrogen cycle in organism by this approach.Therefore glutamine synthetase plays very important effect in organism nitrogen assimilation process.

In soil, contain very abundant bacterial population.Bacterium glutamine synthetase is contained three major types glutamine synthetase GS I, GS II and the GS III of current discovery, and compares Glutamine Synthetase in Plants gene and have that kind is many, the easy advantage such as clone.Ash slightly red streptomyces (Streptomyces griseorubens) is a kind of common soil bacteria, and the clone of its glutamine synthetase gene and Function Identification are for qualification nitrogen high efficiency gene and to be applied under adverse environmental factor the improvement of soil physico-chemical property significant.

Summary of the invention

The present invention is directed to the deficiency that prior art exists, a kind of engineering bacteria and its implementation based on glutamine synthetase proposed, can omit red streptomyces glutamine synthetase from ash by a kind of clone of high efficient expression by method of the present invention, can overcome the shortcomings such as glutamine synthetase expression amount in original strain is lower, contribute to solve the problems such as utilization rate of fertilizer is lower, in addition for rapid conversion and then the fertilizing soil of realizing ammonium salt in soil, finally realize precision agriculture and be significant.

The present invention is achieved by the following technical solutions:

The present invention relates to a kind of engineering bacteria of glutamine synthetase, this project bacterium is the intestinal bacteria of heterogenous expression glutamine synthetase.

In described born of the same parents, glutamine synthetase is specially the slightly large subunit gene SG of red streptomyces (Streptomyces griseorubens) JSD ?1 glutamine synthetase ?GE of ash, its nucleotide sequence is as shown in SEQ ID No.1, and its aminoacid sequence is as shown in SEQ ID No.2; Nucleotides sequence is classified 1377bp as, 453 amino acid of encoding.

Described glutamine synthetase encoding gene is cloned acquisition by the mode of genome sequencing and pcr amplification.

Described ash slightly red streptomyces (Streptomyces griseorubens) JSD ?1, now be preserved in Chinese common micro-organisms culture presevation administrative center (CGMCC), deposit number is CGMCC No.5706, preservation date is on January 9th, 2012, preservation address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica's postcode 100101.

The present invention relates to the implementation method of above-mentioned engineering bacteria, omit red streptomyces genomic dna as template taking ash, carry out pcr amplification with the primer that contains restriction enzyme site and obtain glutamine synthetase encoding gene; Then this gene is inserted coli expression carrier pET ?obtain the recombinant expression vector that contains glutamine synthetase encoding gene in 22b (+); Recombinant expression vector is imported to escherichia coli expression bacterial strain, screening obtains the engineering bacteria of glutamine synthetase again.

The described primer that contains restriction enzyme site comprises:

GE‐Msc?I‐F:GATGGCCATGGGGAAGCGGAAGATGGACAAGCAGC

GE‐EcoR?I‐R:GGAATTCTCA ATGATGATGATGATGATGCAGCACCGGCAGCAGGTTC

The condition of described pcr amplification is: 98 DEG C of denaturation 3min; 98 DEG C of sex change 10s, 55 DEG C of annealing 15s, 68 DEG C are extended 2min; 30 rear 68 DEG C of whole 5min that extend of circulation.

Described escherichia coli expression bacterial strain is Transetta (DE3) intestinal bacteria.

The present invention relates to a kind of application of engineering bacteria of glutamine synthetase, be applied to the external high efficient expression of glutamine synthetase, and finally realize the industrial fermentation production of glutamine.

Technique effect

Existing glutamine synthetase is that intracellular enzyme and expression amount are very low in ash omits red streptomyces, has therefore seriously limited its use range and effect; Compared with prior art, the invention provides a kind of brand-new glutamine synthetase gene sequence; Under special conditions, (as high temperature and alkalescence) has more stable biologic activity; The present invention, by building heterogenous expression carrier, has realized external mistake of glutamine synthetase and has expressed, and passed through the method for adding polyhistidyl label expressing recombinant protein c end, has also farthest ensured purity of protein when maintaining protein-active.

Brief description of the drawings

Fig. 1 is the slightly red streptomyces nitrate metabolic pathway prognostic chart of ash based on KEGG;

Fig. 2 is that different concns nitrate is cultivated lower L-Glutamine deaminase synthetase expression level variation diagram;

Fig. 3 is slightly red streptomyces glutamine synthetase signal peptide prediction figure of ash;

Fig. 4 is slightly red streptomyces glutamine synthetase aminoacid sequence comparison diagram of ash;

Fig. 5 is slightly red streptomyces glutamine synthetase 3D structural models prognostic chart of ash.

Embodiment

Below embodiments of the invention are elaborated, the present embodiment is implemented under taking technical solution of the present invention as prerequisite, provided detailed embodiment and concrete operating process, but protection scope of the present invention is not limited to following embodiment.

Embodiment 1

The present embodiment comprises the following steps:

1) slightly separation and the cultivation of red streptomyces of ash

Ash slightly red streptomyces separates the rotten stalk of collecting from Pujiang town, Shanghai City, and deposit number is CGMCC No.5706.This bacterial classification is inoculated in to LB liquid nutrient medium, cultivates 48h for 32 DEG C.

Above-mentioned LB liquid nutrient medium component is: peptone 10.0g/L, yeast extract 5.0g/L, NaCl10.0g/L, pH6.8 ?7.2.In liquid medium within, add 15.0 ?20.0g/L agar obtain LB solid medium.

2) extracting genome DNA

Collect 2.0mL bacterium liquid, the centrifugal 2min of 12000rpm.Abandon supernatant, collect bacterial sediment, add 180 μ L N,O-Diacetylmuramidases (20mg/mL) and 20 μ L EDTA solution (0.5M, pH8.0), process 45min, add 4 μ L RNase A (100mg/mL) for 37 DEG C, concussion mixes 15s, room temperature is placed 5min, extracts test kit (TIANGEN) operation instructions subsequently complete remaining operation according to DNA of bacteria, obtains high purity genomic dna.Determine genomic dna quality by 0.8% agarose gel electrophoresis, guarantee without obvious RNA band, genome band cleans, complete, nothing degraded, pollution-free.

3) gene order-checking

Determine full genome shotgun (WGS) strategy, adopt s-generation sequencing technologies, build the library of different Insert Fragment length, adopt Illumina Miseq (2 × 250bp) platform to check order.Collect the raw data of order-checking, belt lacing, low-quality data are filtered, adopt subsequently Newbler v2.8 from the beginning to splice the sequencing data of removing joint, build contig and scaffold, finally use GapCloser program to carry out gap fill and obtain streptomyces gene group sketch.

4) protein coding gene function prediction

Adopt Glimmer3.0 software to carry out predictive genes to whole genome sequence.Predictive genes model is chosen self training predictive genes model, extracts the longest sequence in assembled sequence, the sequence using this sequence as predictive genes model training.Then with the predictive genes model of this sequence construct, all sequences is carried out to predictive genes, the length of setting open reading frame is 110bp, the default setting that all the other parameters are Glimmer3.0.

Nitrate metabolic pathway figure based on KEGG: KEGG (Kyoto Encyclopedia of Genes and Genomes) is the database of genome decoding aspect.The main purpose of KEGG annotation comprises two: KO (KEGG Ortholog) annotation, is undertaken annotating across species by the relevant information of molecular network; KEGG Pathway annotation, i.e. metabolic pathway annotation, the network of molecular interaction and reaction in acquisition species.

The main KAAS automatization annotation system that adopts KEGG of the KO of protein coding gene and Pathway annotation completes, and wherein gene set is selected " For Prokaryote ", the transmission rule of gene KO choose bi ?directional best hit (BBH).After KO has annotated, KO is mapped on corresponding KEGG Pathway path, obtains the slightly interior nitrate metabolic pathway (Fig. 1) of red streptomyces of ash.

5) extraction of total RNA

Streptomycete is inoculated in KNO ₃for the minimal medium of sole carbon source, under 32 DEG C, 150rpm condition, cultivate 72h.Every 12h sampling, centrifugal collection bacterial sediment, and extract the total RNA of highly purified streptomycete by bacterium total RNA extraction reagent box requirement (TIANGEN).

Above-mentioned minimal medium component is: glucose 20g/L, KH ₂pO ₄1.0g/L, NaCl0.5g/L, MgSO ₄0.25g/L, CaCl ₂2H ₂o0.1g/L, FeSO ₄7H ₂o0.01g/L and KNO ₃(10mM, 30mM, 50mM, 100mM).

6) glutamine synthase expression level determination

According to glutamine synthetase gene sequence, by DNAMAN6.0 software design specific PCR primer, primer sequence is as follows:

GE‐F:GCTGAGCCTGATGGAACGCA

GE‐R:GCCTCCCACTCCTGCTTCT

Same, according to the specific sequence design primer of 16S rRNA, and as reference gene, primer sequence is as follows:

16S?rRNA‐F:CGTATTCACCGCAGCAATGC

16S?rRNA‐R:GCGAGGTGGAGCGAATCTCA

Carry out reverse transcription with the total RNA template of streptomycete and obtain cDNA library, and require to carry out relating operation according to PCR kit for fluorescence quantitative (TaKaRa).Three repetitions are set, wait to have tested collection and treatment data, analyze at different concns KNO ₃under effect, the expression amount of glutamine synthetase (as Fig. 2).Result shows, in the substratum taking nitrate as sole carbon source, the expression amount of glutamine synthetase significantly raises, and proves the metabolic process of this gene involved in nitrate.

Above-mentioned quantitative fluorescent PCR reaction conditions is: 95 DEG C of denaturation 30s; 95 DEG C of sex change 10s, 60 DEG C of annealing 30s, 72 DEG C are extended 15s, totally 40 circulations.

7) sequential detection:

Glutamine synthetase film location prediction: adopt SignalP4.1 respectively glutamine synthetase to be carried out to signal peptide simulation and forecast, as shown in Figure 3.Result shows that glutamine synthetase does not exist obvious signal peptide sequence, infers that this enzyme is intracellular enzyme.

Glutamine synthetase aminoacid sequence comparison diagram: carry out blastp search in ncbi database, obtain 3 with ash slightly red streptomyces (Streptomyces griseorubens) JSD ?the aminoacid sequence that approaches the most of 1 L-Glutamine deaminase synthetic enzyme sequence, and carry out sequence alignment by ClustalX and BOXshade program, result is as shown in Figure 4.This L-Glutamine deaminase synthetic enzyme sequence and known glutamine synthetase aminoacid sequence have higher similarity, and similarity maximum can reach 98%.

Nitrate reductase 3D model prediction: use PHYRE2 at sequence of threads, the 3d space model of L-Glutamine deaminase synthetic enzyme to be predicted.Result shows that the highest similarity of existing albumen model in L-Glutamine deaminase synthetic enzyme and PDB database can reach 35% respectively, predicts the outcome and has 100% confidence level.As shown in Figure 5, the C end (dated) of glutamine synthetase is exposed at protein expression, is therefore set the connection site into polyhistidyl label (His6Taq).

Embodiment 2

Glutamine synthase expression vector construction

1) according to glutamine synthetase sequence, the primer that design contains restriction enzyme site, sequence is as follows:

GE‐Msc?I‐F:GATGGCCATGGGGAAGCGGAAGATGGACAAGCAGC

GE‐EcoR?I‐R:GGAATTCTCA ATGATGATGATGATGATGCAGCACCGGCAGCAGGTTC

2) omit red streptomyces (Streptomyces griseorubens) genomic dna as template taking ash, carry out pcr amplification and obtain glutamine synthetase gene sequence with containing Msc I and EcoR I restriction enzyme site primer, use DNA A ?Tailing Kit add be connected to after A T ?Vector PMD ^tM19 ?T (TaKaRa), and connection product is proceeded in DH5 α intestinal bacteria.In ammonia benzyl (50 μ g/mL) resistant panel, select positive colony, shake bacterium and extract plasmid order-checking.If errorless, Msc I and EcoR I carry out double digestion (37 DEG C), reclaim the large subunit DNA fragmentation of glutamine synthetase GE.With identical endonuclease digestion expression vector pET ?22b (+) reclaim carrier DNA fragment.GE is mixed with carrier segments, T4 DNA Ligase (TaKaRa) connection (16 DEG C) of spending the night, connection product is proceeded in DH5 α competent escherichia coli cell, by resistant panel and bacterium colony PCR screening contain plasmid pET ?22 ?the positive colony of GE.Picking positive colony is inoculated in the LB liquid nutrient medium that contains penbritin (50 μ g/mL), and 180rpm, 37 DEG C of cultivations were extracted plasmid after 16 hours.

Above-mentioned pcr amplification condition is: 98 DEG C of denaturation 3min; 98 DEG C of sex change 10s, 68 DEG C are extended 1min; 30 rear 68 DEG C of whole 5min that extend of circulation.

The archaeal dna polymerase that above-mentioned PCR reaction is used is gXL Polymerase (TaKaRa).

3) glutamine synthetase is crossed the structure of express transgenic bacterial strain: by above-mentioned glutamine synthase expression carrier pET ?22 ?GE proceed to Transetta (DE3) intestinal bacteria, and screen on the LB solid medium that contains penbritin (50 μ g/mL) and paraxin (34 μ g/mL), obtain glutamine synthetase and cross expression strain.

Above-mentioned Transetta (DE3) has following characteristics: this bacterial strain has paraxin (Cam ^r), and contain 6 kinds of rare codons (AGA, AGG that intestinal bacteria lack, AGA, CUA, CCC, GGA) corresponding tRNA, can effectively improve foreign gene, especially the expression level of the high GC content such as eukaryote and streptomycete biological gene in prokaryotic system.

Claims

1. an engineering bacteria for glutamine synthetase, is characterized in that, this project bacterium is the intestinal bacteria of heterogenous expression glutamine synthetase;

2. engineering bacteria according to claim 1, it is characterized in that, described ash slightly red streptomyces (Streptomyces griseorubens) JSD ?1, now be preserved in Chinese common micro-organisms culture presevation administrative center (CGMCC), deposit number is CGMCC No.5706, and preservation date is on January 9th, 2012.

3. according to an implementation method for the engineering bacteria described in claim 1 or 2, it is characterized in that, omit red streptomyces genomic dna as template taking ash, carry out pcr amplification with the primer that contains restriction enzyme site and obtain glutamine synthetase encoding gene; Then this gene is inserted coli expression carrier pET ?obtain the recombinant expression vector that contains glutamine synthetase encoding gene in 22b (+); Recombinant expression vector is imported to escherichia coli expression bacterial strain, screening obtains the engineering bacteria of glutamine synthetase again.

4. method according to claim 3, is characterized in that, the described primer that contains restriction enzyme site comprises:

GE‐Msc?I‐F:GATGGCCATGGGGAAGCGGAAGATGGACAAGCAGC

GE‐EcoR?I‐R:GGAATTCTCA ATGATGATGATGATGATGCAGCACCGGCAGCAGGTTC。

5. method according to claim 3, is characterized in that, the condition of described pcr amplification is: 98 DEG C of denaturation 3min; 98 DEG C of sex change 10s, 55 DEG C of annealing 15s, 68 DEG C are extended 2min; 30 rear 68 DEG C of whole 5min that extend of circulation.

6. method according to claim 3, is characterized in that, described escherichia coli expression bacterial strain is Transetta (DE3) intestinal bacteria.

7. contain engineering bacteria and the application thereof of the glutamine synthetase described in above-mentioned arbitrary claim, it is characterized in that, use it for the external high efficient expression of glutamine synthetase, and the industrial fermentation of finally realizing glutamine is produced.