CN104126496A - Chemical emasculation seed production method by using herbicide-resistant gene rape - Google Patents
Chemical emasculation seed production method by using herbicide-resistant gene rape Download PDFInfo
- Publication number
- CN104126496A CN104126496A CN201410314435.3A CN201410314435A CN104126496A CN 104126496 A CN104126496 A CN 104126496A CN 201410314435 A CN201410314435 A CN 201410314435A CN 104126496 A CN104126496 A CN 104126496A
- Authority
- CN
- China
- Prior art keywords
- gene
- bnaahas3
- seed
- herbicide
- rape
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of crop marker-assisted breeding, and more specifically relates to a chemical emasculation seed production method by using herbicide-resistant gene rape. The method is characterized by comprising a step for culturing a male parent material of a tolerance chemical male gametocide and a chemical emasculation step without shielding. According to the invention, a chemical mutagen is used for mutagenesis of cabbage-type rape seeds, a herbicide tribenuron methyl is sprayed at 5-6 leaf stage, a mutant material for herbicide resistance is primarily obtained, selfing is carried out so that herbicide-resistant mutant strain with stable heredity is obtained, a rape mutant strain genome DNA is extracted, BnaAHAS1 and BnaAHAS3 gene fragments can be obtained through amplification, wherein a nucleotide sequence of a BnaAHAS3 gene fragment is shown in SEQ ID NO: 1, and a C/T mutation is existed on a 536bp site of the gene BnaAHAS3. The invention also discloses a preparation method of an herbicide-resistant specific marker, and an application in shield-free chemical emasculation seed production.
Description
Technical field
The invention belongs to crops marker-assisted breeding technical field, be specifically related to utilize the rape chemical emasculation producing method for seed of anti-herbicide gene, comprise the mutant that utilizes chemical mutagen and herbicide screening to obtain anti-sulfonylurea herbicide, from this mutant, clone obtains the Gene A HAS of antiweed, utilize the fragment of this gene as the rape strain of molecular marker assisted selection antiweed, thereby reach the method for the improvement rape chemical emasculation production of hybrid seeds.
Background technology
Cabbage type rape is the important oil crop of extensively planting in the world.Rapeseed oil not only can be used as edible oil, is also the industrial raw materials such as lubricating oil and biodiesel.From 1975 to 2012 nearly 40 years, the Gross World Product of cabbage type rape has increased by 8 times, and 2012 produce total amounts per year reaches 64.8 hundred ten thousand tons (http://faostat.fao.org/).Cabbage type rape growth rate rapidly like this depends primarily on genetic improvement (low-sulfur glycosides and low erucic acid) and the heterotic utilization of quality.
Hybrid vigour refers to Hybrid (F
1) some proterties of showing or the superiority of Comprehensive Traits to its parental breed and other conventional inbred line kind, in crop breeding, mainly refer to taking yield traits as main Breeding objective.Hybrid vigour is a kind of universal phenomenon of biosphere.Utilize hybrid vigour to become one of the most ripe effective approach of breeding high-yield new quality variety in modern agriculture, extensive use in the important crops such as corn, paddy rice, Chinese sorghum, wheat and rape produce.At present, rape heterosis utilization mainly realizes by various types of male sterile lines.Male sterile line of rape system mainly comprises cytoplasmic male sterility, nuclear male sterility, environmental male sterile, the male sterile of genetic modification and the male sterile of chemical induction, they have brought into play extremely important effect (Fu Tingdong, 1990) in heterosis utilization.
Cabbage type rape chemical induction male sterile line is to utilize gametocide or chemical hybridizing agent (being called for short CHA) to process a kind of male sterile of the bud induction generation of normal inbred line, and its sterility is not heritable, does not therefore need maintainer.Chemical induction male sterile ties up in cross rape production has lot of advantages, and if all kinds are all its restorers, hybrid strain is selected freely, easily screens strong advantage combination and can shorten breeding cycle etc.Because chemical induction male sterile line is with the obvious advantage, be subject in recent years showing great attention to of rapeseed breeding man, the whole nation has a lot of R&D institutions to carry out chemical emasculation breeding, chemical induction male sterility system has become a kind of important channel that rape heterosis utilizes, when the chemical emasculation production of hybrid seeds, female parent is gone and is worked and often plant in 2:1 or 3:1 ratio (being called for short row ratio) with male parent, plants the maternal preparation of two row or three row a line male parent.In the time spraying CHA, because causing pollen amount to reduce, poisoning causes reducing hybrid seed yield for fear of male parent, and the measure of must taking manually to block is protected male parent row plant, has both increased production cost, has restricted again crossbreed production scale.Therefore obtain the rape strain with CHA resistance and can simplify rape chemical emasculation production of hybrid seeds program, reduce risk in hybrid seed production and production cost, significant in rape heterosis utilizes.
AHAS is first key enzyme of three kinds of branched-chain amino acid route of synthesis such as leucine in plant, isoleucine, valine, is the target enzyme of the five class weed killer herbicides such as sulfonylurea (SUs), imidazolone type (IMIs), triazolo pyrimidine class (TPs), sulfonamides (SCTs) and pyrimidine phosphorothioate benzoates (PTBs).The Main Function mechanism of this five classes weed killer herbicide is the weed killer herbicide binding site that is attached to acetolactate synthestase (AHAS) by the interaction of chemical bond, stops the substrate of AHAS to be combined with catalytic site; Finally suppress the activity of acetolactate synthestase (AHAS), thereby affect the biosynthesis of branched-chain amino acid, destroy the biosynthesis of plant corpus internal protein, and then cause plant death.In producing at present, conventional chemical hybridizing agent (CHA) is generally with acetolactate synthestase (AHAS, acetohydroxyacid synthase) sulfonylurea herbicide of target, for example amidosulfuron (Amidosulfuron), single phonetic sulphur ester sodium (Monosulphuron ester sodium, be called for short MES) and tribenuron-methyl (Tribenuron-methyl) etc. be all good chemical hybridizing agent (Cheng et al., 2013; Yu et al., 2006; Yu et al., 2009).Wherein, tribenuron-methyl has that low price, toxicity are low, noresidue, environmental sound and the advantage such as gametocidal effect is good, has been widely used in during the production of hybrid seeds that induction produces Brassica napus male sterile line produces.
Summary of the invention
The object of the invention is to overcome the defect of prior art, a kind of rape chemical emasculation producing method for seed that utilizes anti-herbicide gene is provided, the method comprises the mutant that utilizes chemical mutagen and herbicide screening to obtain anti-sulfonylurea herbicide, from this mutant, clone obtains the Gene A HAS of antiweed, utilize the fragment of this gene as the rape strain of molecular marker assisted selection antiweed, thereby reach the production of hybrid seeds of improvement rape chemical emasculation, the present invention proposes new method unobstructed, large-scale production cross-bred rape seed; The method can be simplified chemical emasculation production of hybrid seeds program, reduces crossbreed production cost, has ensured the Quality and yield of crossbreed.
The present invention is achieved through the following technical solutions:
A rape chemical emasculation producing method for seed that utilizes anti-herbicide gene, comprises chemical emasculation step, and it also comprises male parent material and the unscreened chemical emasculation step of cultivating tolerance male sterilant, and concrete steps are as follows:
(1) utilize chemical mutagen ethylmethane sulfonate (EMS) to process the two fifth-seededs of cabbage type rape China, screening obtains M
1for seed, plantation M
1for seed, divide the selfing of individual plant bagging flowering stage, obtain M
2for seed; Sow M second planting season
2for seed, at M
2when plant 4-6 leaf phase, spray the weed killer herbicide tribenuron-methyl solution of 2.5mg/L, spray continuously twice by same concentration every 7d, after 20d, select the primary dcreening operation material of unharmed plant as the Brassica napus Mutant Cr of antiweed, collect selfed seed in maturing stage bagging, obtain M
3for seed; Sow this M the 3rd planting season
3for seed, investigate M
3the stability of the Herbicid resistant in generation, checking obtains the mutating strain series M45 of antiweed;
(2) the mutating strain series M45 genomic DNA of the antiweed described in extraction step (1), with Auele Specific Primer increase respectively BnaAHAS1 gene (gene accession number Z11524) and BnaAHAS3 gene (gene accession number Z11526), the DNA sequence dna of the primer of described amplification BnaAHAS1 gene is: BnaAHAS1-F:TCAAGAACAGTTAGATCCAC, BnaAHAS1-R:GATCACCAGCTTCATCTCT; The primer of amplification BnaAHAS3 gene is: BnaAHAS3-F:CTCTCTCTCTCTCATCTAACCAT, BnaAHAS3-R:ACTGAAACTAAGTCTTTTACCAT; Obtain fragment as shown in sequence table SEQ ID NO:1, the 536th of the BnaAHAS3 genetic fragment missense mutation (C/T) that single base occurs, sport thymidine (T) by cytimidine (C), amino acid sports leucine (Leu) by proline (Pro)
(3) according to the SNP flanking sequence of the 536th of BnaAHAS3 genetic fragment the, design the dCAPS mark that a pair of PCR-based and enzyme are cut, this mark is made up of two primer sequences, its DNA sequence dna is as follows: forward primer BnaAHAS3_dCAPS-F:5 '-CACAAACTCATTCATCATCTCTCTCTCATTTC-3 ', reverse primer BnaAHAS3_dCAPS-R:5 '-ACGATTGGCGTCTCTTGGAACGCGTCAGTACCGATCATCCGGCCA-3 ', obtains the nucleotide sequence as shown in sequence table SEQ ID NO:3 by pcr amplification;
(4) by hybridization and molecular marker assisted selection, the genetic fragment shown in SEQ ID NO:1 is imported in cabbage type rape variety or inbred line, obtain the male parent of antiweed, this male parent contains the dominant nuclear gene Bnaahas3 of antiweed;
(5) under the unobstructed condition in field, be maternal with cabbage type rape variety or selfing, make male parent with the kind or the inbred line that carry Bnaahas3 anti-herbicide gene fragment, press the row of Parent 1:2 or 1:3 than plantation, in the time that maternal bud 2-3mm is long, spray the weed killer herbicide tribenuron-methyl solution of 0.05mg/L, interval 7d sprays three times continuously, the crossbreed on maturing stage results female parent.
The mutating strain series M45 of above-mentioned antiweed is named as cabbage type rape M45, Brassica napus L.M45, deliver China on June 17th, 2014. Wuhan. the center preservation of Wuhan University's Chinese Typical Representative culture collection, deposit number is CCTCC NO:P201409.
Said method of the present invention can be used in the production of hybrid seeds of unobstructed rape chemical emasculation.
Applicant clone obtains the genetic fragment of nucleotide sequence as shown in sequence table SEQ ID NO:1, and this fragment can be applied in the production of hybrid seeds of unobstructed rape chemical emasculation.
Applicant separates the molecular labeling of the anti-herbicide gene obtaining, and the nucleotide sequence of this molecular labeling is as follows:
CACAAACTCATTCATCATCTCTCTCTCATTTC and ACGATTGGCGTCTCTTGGAACGCGTCAGTACCGATCATCCGGCCA.This molecular labeling can be used in the production of hybrid seeds of unobstructed rape chemical emasculation.
More detailed technical scheme is referring to " embodiment ".
Brief description of the drawings
Sequence table SEQ ID NQ:1 is the nucleotide sequence of the present invention's BnAHAS3 genetic fragment of cloning.Fragment length is 612bp, has an allelic mutation (that is: C/T) the 536th of this fragment.
Sequence table SEQ ID NQ:2 and SEQ ID NQ:3 are the nucleotide sequences of the molecular labeling prepared of the present invention.
Sequence table SEQ ID NQ:4 is the product sequence that molecular labeling prepared by the present invention increases out, fragment length is 633bp, be that the nucleotide sequence of BnaAHAS3_dCAPS marked product is (at an allelic mutation of the 588bp place of this fragment existence, this mutational site is exactly the mutational site of the genetic fragment shown in SEQ ID NQ:1, the 1-52bp of this sequence is the sequence increasing on the basis of the genetic fragment shown in SEQ ID NQ:1, causes the mutational site of this sequence to be moved relatively afterwards).
Fig. 1, Technology Roadmap of the present invention.
In Fig. 2, TA of the present invention clone, apply
carrier figure.
Fig. 3, cabbage type rape wild type China pair No. 5 phenotypes under tribenuron-methyl variable concentrations is processed.The two fifth-seededs of China are seeded in experimental field, and every 5 row spray identical tribenuron-methyl concentration.Description of symbols in figure: A: negative control (water spray is processed); B: tribenuron-methyl 0.01mg/L; C: tribenuron-methyl 0.025mg/L; D: tribenuron-methyl 0.5mg/L; E: tribenuron-methyl 2.5mg/L; F: tribenuron-methyl 5.0mg/L.
The resistant phenotype of Fig. 4, cabbage type rape tribenuron-methyl resistance strain M45.The first row: negative control (water spray is processed); The second row: the tribenuron-methyl solution-treated that is 2.5mg/L by concentration..WT: wild type; M45: resistant strain (or claiming resistance strain, tribenuron-methyl resistance strain)
The resistance scope of Fig. 5, cabbage type rape tribenuron-methyl resistance strain M45.Description of symbols in figure: A: positive control (the tribenuron-methyl solution-treated WT that concentration is 2.5mg/L); B: negative control (water spray is processed WT); C-F: concentration is the tribenuron-methyl solution-treated M45 strain of 2.5mg/L, 5.0mg/L, 7.5mg/L and 10mg/L.
The PCR product of Fig. 6, BnaAHAS1 and BnaAHAS3 gene magnification detects and reclaims detection (taking M45 as example).Description of symbols in figure: A figure: swimming lane M, 1kb marker; 1-2, BnaAHAS3 gene magnification WT and M45; 3-4, BnaAHAS1 gene magnification WT and M45; Left and right arrow points to respectively the specific amplified fragment of 2.0kb BnaAHAS3 gene and 2.2kb BnaAHAS1.B figure: swimming lane M, 1kb marker; 1-2, cuts WT and M45BnaAHAS1 genetic fragment after glue reclaims; The fragment of arrow points 2.2kb BnaAHAS1.
Fig. 7, BnaAHAS3 gene nucleotide and partial amino-acid fragment comparison result.Description of symbols in figure: arrow refers to the amino acid residue there are differences; At3g48560: arabidopsis AHAS amino acid sequence (gene accession number At3g48560, http://www.arabidopsis.org/); BnaAHAS3: wild-type amino acid sequence; Bnaahas3: resistance strain M45 amino acid sequence.
The polymorphic detection of Fig. 8, tribenuron-methyl resistance allele specific marker BnaAHAS3_dCAPS.Description of symbols in figure: (A) parent and F
1augmentation detection; (B) F
2augmentation detection in colony; P
1, M45; P
2, in two 11; M, 1kb molecular weight marker.
Fig. 9, cabbage type rape chemical emasculation are processed rear pollen fertility feature.Description of symbols in figure: (A) flowering stage stamen morphological feature; (B) aceto-camine staining examine pollen grain activity; (C) stamen Length Ratio.
Figure 10, the techniqueflow chart that carries out heterosis utilization (application) as male parent taking anti-tribenuron-methyl strain M45.
Figure 11, be the flow chart that male parent is carried out heterosis utilization (application) with derivative inbred line or the product of anti-tribenuron-methyl strain.
Embodiment
Be below specific embodiments of the invention, but the present invention is not limited to following examples.
Embodiment 1: the acquisition of anti-tribenuron-methyl cabbage type rape strain
(1) take the two fifth-seededs (this material is provided by genetics breeding of rape research department of Hua Zhong Agriculture University, is the cabbage type rape new varieties of Chinese spread) of China that 1000g high-quality is isozygotied, seed is placed in to distilled water and soaks 8 hours.Seed after soaking is placed in to 0.30% chemical mutagen ethylmethane sulfonate (EMS) to be stirred and makes its abundant mutagenesis in good time.After mutagenesis completes for 18 hours, rinse 3-4 hour with running water, slightly dry the seed of mutagenesis.
(2) untreated China pair is seeded in to the experiment Tanaka of Hua Zhong Agriculture University for No. 5, every row is sowed 8 strains, in the time of 4-6 sheet true leaf, spray 0mg/L twice every other week, design 0.01mg/L, 0.025mg/L, 0.5mg/L, 2.5mg/L, the weed killer herbicide tribenuron-methyl solution of the variable concentrations of 5.0mg/L, observed phenotype after 20 days, and specifying its lethal concentration is 2.5mg/L (Fig. 3).
(3) simultaneously also by the seed (M of mutagenesis
1) be seeded in Hua Zhong Agriculture University experimental field, broadcast sowing at random, in the time there is 4-6 sheet true leaf, observe phenotype after spraying every other week twice, 20 day with the tribenuron-methyl solution of 2.5mg/L, the plant of selecting not to be subject to any injury carries out bagging selfing and is M
2generation.
(4) by M
2for seed, with the plantation of single file district, every row program request 8-10 strain, obtains M according to above-mentioned identical spray medicine (the tribenuron-methyl solution of 2.5mg/L, method is the same) screening
3for resistant plant.
(5) by M
3for seed, with the plantation of duplicate rows district, every row program request 8-10 strain, has obtained 1 pure and mild resistance strain according to the method screening of above-mentioned identical spray medicine screening, by its called after M45 (Fig. 4).
(6) sow with zone taking resistance strain M45 as research object, every row 8-10 strain, in the time there is 5-6 sheet true leaf, with 2.5mg/L, 5mg/L, 7.5mg/L, the tribenuron-methyl of the variable concentrations of 10mg/L sprays twice every other week, after 20 days, observe phenotype, can find that M45 product tie up to upgrowth situation under the tribenuron-methyl processing that concentration is 7.5mg/L and have been subject to obvious impact (Fig. 5), result shows that resistant strain can tolerate the tribenuron-methyl that concentration is 5mg/L.
Embodiment 2: the clone of cabbage type rape tribenuron-methyl resistant gene
(1) utilize CTAB method (for this area common method) to extract the genomic DNA of cabbage type rape China two No. 5 (wild type) and resistance strain, the Open-reading frame (ORF) of 2 AHAS homologous genes of cabbage type rape (AHAS1, AHAS3) that may be associated with resistance is increased respectively with Auele Specific Primer (as follows).The amplimer of BnaAHAS1 gene (gene accession number Z11524) is BnaAHAS1-F (TCAAGAACAGTTAGATCCAC) and BnaAHAS1-R (GATCACCAGCTTCATCTCT); The amplimer of BnaAHAS3 gene (gene accession number Z11526) is BnaAHAS3-F (CTCTCTCTCTCTCATCTAACCAT) and BnaAHAS3-R (ACTGAAACTAAGTCTTTTACCAT).
(2) gene magnification adopts KOD-plus-standard reaction system (TOYOBO), and 50 μ l PCR reaction systems comprise: 100ng genomic DNA template, 5 μ l10 × PCR buffer for KOD-plus-, 5 μ l dNTPs (2mM), 2 μ l MgSO
4(25mM), (1U/ μ l), supplements ddH for 3 μ l PCR primers (the each 1.5 μ l of forward and reverse primer, concentration is respectively 10 μ M) and 1 μ l KOD-plus-
2o to 50 μ l.
(3) PCR response procedures: 94 DEG C of denaturation 3min; 94 DEG C of sex change 30sec, 55 DEG C of renaturation 30sec, 68 DEG C are extended 2.5min, totally 32 circulations; 68 DEG C are extended 10min, 4 DEG C of preservations.Get amplified production 1 μ l, add 2 μ l sample-loading buffers (98% deionized formamide, 10mM EDTA, the blue or green FF of 0.005% dimethylbenzene and 0.005% bromophenol blue), after Ago-Gel (containing 0.1% ethidium bromide) electrophoresis through 1%, gel imaging system (Bio-Rad, Gel DocTM XR+) is taken a picture and observed result (Fig. 6).
(4) BnaAHAS1 gene amplification product cuts the fragment of object size under uviol lamp, gel reclaims and adopts Axygen DNA gel to reclaim kit (Axygen Biosciences), reclaims product and detects the above-mentioned identical method (Fig. 4) that adopts.
BnaAHAS1 and BnaAHAS3 genetic fragment add A tail, reaction system comprises: 7 μ l PCR products, 1 μ l10 × Taqbuffer, 0.4 μ l dNTPs (10mM), 0.6 μ l MgCl2 (25mM), (MBI Fermentas, 5U/ μ l) for 1 μ l Taq DNA polymerase.
(5) target fragment is connected to
carrier (is acted on behalf of purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, be Promega company of the U.S.), coupled reaction system comprises 5 μ l2X Rapid Ligation Buffer, 1 μ l Vector, (3U/ μ l) for 1 μ l T4DNA Ligase, 125ng adds A product, supplements ddH
2o to 10 μ l, reaction condition is 4 DEG C and spends the night.Connect product and be transformed into bacillus coli DH 5 alpha by electric shock, by ampicillin LB screening positive clone, extract plasmid;
(6) positive colony plasmid is in the upper order-checking of DNA sequencer (model ABI3500), BnaAHAS1 gene sequencing primer used is SP6 (ATTTAGGTGACACTATAG), T7 (TAATACGACTCACTATAGGG), BnaAHAS1-F1 (GCTCCTCCACCATCCGTAA) and BnaAHAS1-R1 (ATTGCCTTCCCTTCGGTTA), and BnAHAS3 gene sequencing primer used is SP6 (sequence is the same), T7 (sequence is the same) and BnaAHAS3-R1 (ATTGCCTTCCCTTGGGTTAG).
In step (1), primer sequence derives from " heredity and the Gene cloning of rape inhibitor of acetolactate synthetase class Herbicid resistant mutant M9 " (Hu Maolong etc., 2012).
In step (1), be respectively 2.2kb and 2.0kb by BnAHAS1 and the BnAHAS3 gene target fragment size of pcr amplification.
Embodiment 3: the qualification in cabbage type rape tribenuron-methyl resistant gene mutational site
(1) utilize BnaAHAS1 and the BnaAHAS3 gene order of Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/) to wild type and resistant strain to compare.
As shown in Figure 7, in resistance strain M45, BnaAHAS3 gene has 2 mutational sites to result, and 96 and 536 bit bases are undergone mutation, and are mutated into thymidine (T) by cytimidine (C).
(2) adopt above-mentioned identical method compare and show two wild type China No. 5 with the amino acid sequence of two genes of resistance strain M45.
Result as shown in Figure 7, the proline (Pro) of the 197th of the BnaAHAS3 gene of resistance strain M45 has been mutated into leucine (Leu) and (has used arabidopsis amino acid position nomenclature, see: gene accession number At3g48560, http://www.arabidopsis.org/); This mutational site is consistent (Duggleby et al.2008) with 17 weed killer herbicide binding sites of the AHAS gene of reporting; Therefore, we are using the BnaAHAS3 gene of sudden change as the functional gene of resistant strain.
Embodiment 4: exploitation and the detection of cabbage type rape tribenuron-methyl resistance allele specific marker
(1) for 536 SNP (C>T) of BnaAHAS3 genetic fragment, we utilize the specific forward primer of equipotential: BnaAHAS3_dCAPS-F of dCAPS Finder2.0 (http://helix.wustl.edu/dcaps/) design (5 '-ACGATTGGCGTCTCTTGGAACGCGTCAGTACCGATCATCCGGCCA-3 '), and reverse primer BnaAHAS3_dCAPS-R (5 '-CACAAACTCATTCATCATCTCTCTCTCATTTC-3 ') is positioned at 5 ' UTR region.
(2) utilize conventional CTAB method to extract in resistance strain M45, susceptibility kind two 11 (from Inst. of Oil Crops, Chinese Academy of Agriculture, open cabbage type rape new varieties of promoting) and utilize the constructed F of two parents (M45, in two 11)
1strain, F
2the DNA of colony's (17 of resistance individual plant and responsive individual plants).
(3) PCR reaction system and program.20 μ l systems comprise: 75ng DNA profiling, 2 μ l10 × Taq buffer, 1.6 μ l MgCl
2(25mM), 0.4 μ l dNTPs (10mM), 2 μ l PCR primers (the each 1 μ l of forward and reverse primer, concentration is respectively 10 μ M) and 5U Taq DNA polymerase (recombinat, Fermentas), supplement ddH
2o to 20 μ l.Response procedures: 94 DEG C of denaturation 3min; 94 DEG C of sex change 30sec, 65 DEG C of renaturation 30sec, 72 DEG C are extended 40sec, totally 40 circulations; 72 DEG C are extended 5min, 4 DEG C of preservations.
(5) endonuclease reaction system and program: 30 μ l reaction systems: 10 μ l PCR products, 2 μ l10 × FastDigest Green buffer, 1 μ l
(Fermentas, EcoR II), supplements ddH2O to 30 μ l.Response procedures: hatch 30min for 37 DEG C.Get enzyme and cut product 10 μ l, after Ago-Gel (containing the 0.1% ethidium bromide) electrophoresis through 3%, gel imaging system (Bio-Rad, Gel DocTM XR+) is taken a picture and observed result.
Result as shown in the A of Fig. 8, by PCR and enzyme cut detect show this be marked at parent M45 and in show good polymorphism between two 11.In susceptibility parent, two 11 PCR product can be named as allelomorph S by the banding pattern being shown that FastDigestMvaI cuts; And the PCR product of M45 mutant can not be named as allelomorph R by the banding pattern being shown that FastDigestMvaI cuts; This is marked at F
1middle two bands that occurred expection show as heterozygous genes type, are named as genotype H.Utilize BnaAHAS3_dCAPS flag F
2the resistance of choosing in segregation population and susceptibility individual plant have carried out genotyping, result as shown in the B of Fig. 8,17 resistance individual plants and resistance parent M45 or F
1banding pattern identical, genotype is R or H; 17 susceptibility individual plants are identical with the banding pattern of in susceptibility parent pair 11, and genotype is S.These results show allele-specific mark BnaAHAS3_dCAPS and tribenuron-methyl resistant phenotype be divided into from, the missense mutation (C/T) and the amino acid mutation (proline (Pro) sports leucine (Leu)) that this coding mutation causes that show single base of the 536th generation of BnaAHAS3 gene in M45 resistance strain are the functional sites that this mutating strain series produces Herbicid resistant, and this result also shows can be used for auxiliary cabbage type rape tribenuron-methyl resistance inbred line or the strain of cultivating of molecular labeling simultaneously.
Embodiment 5: anti-tribenuron-methyl cabbage type rape product tie up to the application of unobstructed chemical emasculation production crossbreed
(1) by two conventional cabbage type rape variety China No. 5 and antiweed mutant strain M45 in sowing Hua Zhong Agriculture University experimental field, every row is planted 8 strains, carries out according to a conventional method field management.
(2) in the time that rapeseed plants is buddingged (maximum bud is no more than 2-3mm), at the tribenuron-methyl solution (every liter of solution adds 2-3g washing powder and can ensure that solution better sticks on blade face) of sunny calm weather foliage-spray 0.05mg/L, every about 7 days, spray again once, spray altogether 3 times.
(3) in the time that full-bloom stage weather is fine, get respectively the flower pesticide of two No. 5 and anti-tribenuron-methyl Brassica napus Mutant Cr strain M45 of China, with after aceto-camine dyeing at optical microphotograph Microscopic observation, what flower pesticide was large and round and energy is painted is fertile pollen, flower pesticide little and flat can not be painted be pollen sterile, and record result.
Experimental result is as shown in the C in A and Fig. 9 in Fig. 9, compared with control group (not spraying processing), the stamen development that the rear China of tribenuron-methyl processing is two No. 5 has been subject to inhibition, and (stamen obviously shortens, P < 0.0001), the basic agensis of flower pesticide, shows as sterile; And M45 strain is identical with control group (not spraying processing) after processing, show as stamen development normal (P=0.2264) and fertility normal.As shown in Figure 9 B, when pollen grain that control group wild type China is two No. 5 is untreated, present redness, active normal, after processing pollen occurred 100% sterile; And M45 strain process after when untreated the painted identical redness that all presents of pollen grain, represent that M45 strain pollen activity after tribenuron-methyl processing still keeps normal.
According to this experimental result, the present invention proposes an improvement program, the method of utilizing the chemical emasculation production of hybrid seeds that can simplify, safety and economy: under unobstructed measure condition, when utilizing weed killer herbicide tribenuron-methyl, process (spraying the tribenuron-methyl solution of same concentrations) Parent, allow maternal plant male sterile, paternal plant male-fertile.This program main feature is the safety in production that both can ensure elite hybrid; can allow again the scale of CHA tribenuron-methyl to spray (need under the condition of blocking, not protect male parent) can reduce production costs, and improves heterosis utilization in the efficiency of producing cabbage type rape crossbreed.
Specifically can realize by following approach:
A, as shown in figure 10, directly utilizes the chemical emasculation producing method for seed of the tribenuron-methyl resistance strain M45 in the present invention, taking tribenuron-methyl resistance strain M45 as Testers, selects the hybrid combination (Yang Guangsheng etc., 2009) of strong advantage by combining ability test; Then adopt the present invention to propose unscreened chemical emasculation producing method for seed and prepare cabbage type rape crossbreed.
B, as shown in figure 11, utilizing the tribenuron-methyl resistance strain M45 that carries Bnaahas3 anti-herbicide gene fragment is donor parents, and inbred line good, high-combining ability is improved; Each generation is carried out assisted Selection (common method that the method for marker assisted selection is this area) in conjunction with BnaAHAS3_dCAPS mark, retaining whole or most of proterties of major clique keeping under the prerequisite of high-combining ability characteristic, by the transformation of tribenuron-methyl resistant gene in target inbred line.Then select the hybrid combination (Yang Guangsheng etc., 2009) of strong advantage by combining ability test; Then adopt the unscreened chemical emasculation producing method for seed that the present invention proposes to produce crossbreed.
C, utilize transgene method that Bnaahas3 anti-herbicide gene fragment is converted into rape host cell by Agrobacterium tumefaciens-mediated Transformation method, obtain turning the rapeseed plants of Bnaahas3 anti-herbicide gene, then adopt the unscreened chemical emasculation producing method for seed that the present invention proposes to produce crossbreed.
According to the present invention, in chemical emasculation production of hybrid seeds process, CHA tribenuron-methyl sprays processing and can as insecticide sprays, carry out in field unprotect (not needing the measure of blocking) scale and spray.In this simplification cultivation situation, both can ensure maternal male sterile, also can ensure that male parent 100% can educate, because no longer consider the safety problem of male parent, the present invention provides the more program of economical and convenient on the basis of original chemical emasculation production of hybrid seeds.Moreover, those skilled in the art can carry out the application of assisted Selection in conjunction with traditional inbred line backcross improvement method and molecular labeling (weed killer herbicide), in this application, cabbage type rape male parent, in obtaining Herbicid resistant, does not change other good economical characters and higher coordinate force characteristic.
Main bibliography
1. Fu Ting, General Statement On The Studies And Utilization of Rapeseed Heterosis In China. crop investigations, 1990,4 (3): 1-4.
2. Hu Maolong etc., heredity and the Gene cloning of rape inhibitor of acetolactate synthetase class Herbicid resistant mutant M9. Scientia Agricultura Sinica .2012,45 (20): 4326-4334.
3. Yang Guang sage etc., 2009. crop breeding principles. Beijing: Science Press.
4.Cheng YF etc., Cytological and comparative proteomic analyses on male sterility in Brassica napus L.induced by the chemical hybridization agent monosulphuron ester sodium.PLoS ONE, 2013,8:e80191.
5.Duggleby RG etc., Structure and mechanism of inhibition of plant acetohydroxyacid synthase.Plant Physiol Biochem, 2008,46:309-324
6.Yu C etc., Inducing male sterility in Brassica napus L.by a sulphonylurea herbicide, tribenuron-methyl.Plant Breeding, 2006,125:61-64
7.Yu CY etc., Efficiency of a novel gametocide amidosulfuron on rapeseed (Brassica napus) .Plant Breeding, 2009,128:538-540.
Claims (5)
1. a rape chemical emasculation producing method for seed that utilizes anti-herbicide gene, comprises chemical emasculation step, it is characterized in that, it also comprises male parent material and the unscreened chemical emasculation step of cultivating tolerance male sterilant, comprises the steps:
(1) utilize chemical mutagen ethylmethane sulfonate (EMS) to process the two fifth-seededs of cabbage type rape China, screening obtains M
1for seed, plantation M
1for seed, divide the selfing of individual plant bagging flowering stage, obtain M
2for seed; Sow M second planting season
2for seed, at M
2when plant 4-6 leaf phase, spray the weed killer herbicide tribenuron-methyl solution of 2.5mg/L, spray continuously twice by same concentration every 7d, after 20d, select the primary dcreening operation material of unharmed plant as the Brassica napus Mutant Cr of antiweed, collect selfed seed in maturing stage bagging, obtain M
3for seed; Sow this M the 3rd planting season
3for seed, investigate M
3the stability of the Herbicid resistant in generation, checking obtains the mutating strain series M45 of antiweed;
(2) the mutating strain series M45 genomic DNA of the antiweed described in extraction step (1), with Auele Specific Primer increase respectively BnaAHAS1 gene (gene accession number Z11524) and BnaAHAS3 gene (gene accession number Z11526), the DNA sequence dna of the primer of described amplification BnaAHAS1 gene is: BnaAHAS1-F:TCAAGAACAGTTAGATCCAC, BnaAHAS1-R:GATCACCAGCTTCATCTCT; The primer of amplification BnaAHAS3 gene is: BnaAHAS3-F:CTCTCTCTCTCTCATCTAACCAT, BnaAHAS3-R:ACTGAAACTAAGTCTTTTACCAT; Obtain the fragment as shown in sequence table SEQ ID NO:1, in C/T sudden change of the 536th existence of this fragment; `
(3) according to the SNP flanking sequence of the 536th of BnaAHAS3 genetic fragment the, design the dCAPS mark that a pair of PCR-based and enzyme are cut, this mark is made up of two primer sequences, its DNA sequence dna is as follows: forward primer BnaAHAS3_dCAPS-F:5 '-CACAAACTCATTCATCATCTCTCTCTCATTTC-3 ', reverse primer BnaAHAS3_dCAPS-R:5 '-ACGATTGGCGTCTCTTGGAACGCGTCAGTACCGATCATCCGGCCA-3 ', obtains the nucleotide sequence as shown in sequence table SEQ ID NO:3 by pcr amplification;
(4) by hybridization and molecular marker assisted selection, the genetic fragment shown in SEQ ID NO:1 is imported in cabbage type rape variety or inbred line, obtain the male parent of antiweed, this male parent contains the dominant nuclear gene Bnaahas3 of antiweed;
(5) under the unobstructed condition in field, be maternal with cabbage type rape variety or selfing, make male parent with the kind or the inbred line that carry Bnaahas3 anti-herbicide gene fragment, press the row of Parent 1:2 or 1:3 than plantation, in the time that maternal bud 2-3mm is long, spray the weed killer herbicide tribenuron-methyl solution of 0.05mg/L, interval 7d sprays three times continuously, the hybrid seed on maturing stage results female parent.
2. the application of method claimed in claim 1 in unobstructed rape chemical emasculation producing method for seed.
3. the application of the genetic fragment of nucleotide sequence as shown in sequence table SEQ ID NO:1 in the production of hybrid seeds of unobstructed rape chemical emasculation.
4. a molecular labeling for the anti-herbicide gene of separation, is characterized in that, the nucleotide sequence of this molecular labeling is as follows:
CACAAACTCATTCATCATCTCTCTCTCATTTC and ACGATTGGCGTCTCTTGGAACGCGTCAGTACCGATCATCCGGCCA.
5. the application of molecular labeling claimed in claim 4 in the production of hybrid seeds of unobstructed rape chemical emasculation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314435.3A CN104126496B (en) | 2014-07-03 | 2014-07-03 | Utilize the Brassica campestris L chemical emasculation producing method for seed of anti-herbicide gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314435.3A CN104126496B (en) | 2014-07-03 | 2014-07-03 | Utilize the Brassica campestris L chemical emasculation producing method for seed of anti-herbicide gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104126496A true CN104126496A (en) | 2014-11-05 |
| CN104126496B CN104126496B (en) | 2016-08-24 |
Family
ID=51799548
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410314435.3A Expired - Fee Related CN104126496B (en) | 2014-07-03 | 2014-07-03 | Utilize the Brassica campestris L chemical emasculation producing method for seed of anti-herbicide gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104126496B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789682A (en) * | 2015-04-29 | 2015-07-22 | 江苏省农业科学院 | Primers for detecting anti-sulfonylurea herbicide gene BnALS3R of cabbage type rape and application of primer |
| CN110679480A (en) * | 2019-11-22 | 2020-01-14 | 江苏省农业科学院 | Breeding method of high-resistance sulfonylurea herbicide rape |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010036771A2 (en) * | 2008-09-26 | 2010-04-01 | Basf Agrochemical Products B.V. | Herbicide-resistant ahas-mutants and methods of use |
| CN102172212A (en) * | 2011-03-02 | 2011-09-07 | 西南大学 | Method for breeding new sterile line by use of gene engineering |
| CN102948365A (en) * | 2012-11-29 | 2013-03-06 | 江苏省农业科学院 | Method for increasing hybrid rape planting purity by applying herbicide resistant mutant character |
-
2014
- 2014-07-03 CN CN201410314435.3A patent/CN104126496B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010036771A2 (en) * | 2008-09-26 | 2010-04-01 | Basf Agrochemical Products B.V. | Herbicide-resistant ahas-mutants and methods of use |
| CN102172212A (en) * | 2011-03-02 | 2011-09-07 | 西南大学 | Method for breeding new sterile line by use of gene engineering |
| CN102948365A (en) * | 2012-11-29 | 2013-03-06 | 江苏省农业科学院 | Method for increasing hybrid rape planting purity by applying herbicide resistant mutant character |
Non-Patent Citations (2)
| Title |
|---|
| CECILIA GHIO,ET AL.: "Molecular characterization of Als1, an acetohydroxyacid synthase mutation conferring resistance to sulfonylurea herbicdes", 《THEOR APPL GENET》 * |
| 张宝娟等: "苯磺隆对甘蓝型油菜中双9号的杀雄效果", 《中国油料作物学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789682A (en) * | 2015-04-29 | 2015-07-22 | 江苏省农业科学院 | Primers for detecting anti-sulfonylurea herbicide gene BnALS3R of cabbage type rape and application of primer |
| CN104789682B (en) * | 2015-04-29 | 2019-05-17 | 江苏省农业科学院 | Detect primer and the application of Cabbage type rape anti-sulfonylurea herbicide gene BnALS3R |
| CN110679480A (en) * | 2019-11-22 | 2020-01-14 | 江苏省农业科学院 | Breeding method of high-resistance sulfonylurea herbicide rape |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104126496B (en) | 2016-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nelson et al. | The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula | |
| Ge et al. | Genetic mapping and localization of quantitative trait loci for chlorophyll content in Chinese cabbage (Brassica rapa ssp. pekinensis) | |
| Cao et al. | Chinese experiences in breeding three-line, two-line and super hybrid rice | |
| Kaneko et al. | Radish | |
| CN106754954A (en) | A kind of corn MS8 gene mutation bodies and its method for identifying molecules and application | |
| Rahman et al. | Improvement of spring canola Brassica napus by use of winter canola | |
| CN109136400B (en) | QTLs (quantitative trait loci) for related characters of fleshy roots of radishes and positioning method thereof | |
| Kumar et al. | Introgression of durable blast resistance gene Pi-54 into indica rice cv. samba mahsuri, through Marker Assisted Backcross Breeding | |
| Schneider et al. | Detection of various U and M chromosomes in wheat-Aegilops biuncialis hybrids and derivatives using fluorescence in situ hybridisation and molecular markers. | |
| CN104126496B (en) | Utilize the Brassica campestris L chemical emasculation producing method for seed of anti-herbicide gene | |
| Yoneya et al. | The temperature sensitive hybrid breakdown 1 induces low temperature-dependent intrasubspecific hybrid breakdown in rice | |
| Uddin et al. | Identification of a low tiller gene from a new plant type cultivar in rice (Oryza sativa L.) | |
| Fan et al. | Molecular marker-directed development of a novel cytoplasmic male sterile line in rice | |
| Ji et al. | Application of a simplified marker-assisted backcross technique for hybrid breeding in rice | |
| CN103834647B (en) | Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof | |
| CN104762298A (en) | Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof | |
| Tagle et al. | Characterization of QTL for unique agronomic traits of new-plant-type rice varieties using introgression lines of IR64 | |
| Chattopadhyay et al. | Genetic improvement of Rice for multiple stress tolerance in unfavorable Rainfed ecology | |
| CN109006456A (en) | A kind of selection of pimento genic male sterility dual purpose | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN108504770B (en) | CAPS marker closely linked with cowpea rust-resistant gene and application thereof | |
| Nguyen et al. | Development and molecular characterization of a doubled haploid population derived from a hybrid between japonica rice and wide compatible indica rice | |
| Valarmathi et al. | Development of early maturing, high yielding, drought tolerant rice variety with superior grain quality through molecular breeding and its performance evaluation | |
| CN105850722A (en) | Culture method for stable and homozygous tobacco chromosome single fragment substitution line | |
| CN108570515B (en) | Cold-resistant gene qCT6.7 for rice at booting stageDODMolecular marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160824 Termination date: 20170703 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |