CN104120116A - Chitinase F of hirsutella sinensis of cordyceps sinensis as well as encoding gene and application of chitinase F - Google Patents

Abstract

The invention provides a chitinase F as well as an encoding gene and application of the chitinase F, wherein the chitinase F is from hirsutella sinensis of cordyceps sinensis as a Bailing producing strain and takes part in the hydrolysis of colloid chitin to generate N-acetyl-D-glucosamine. The chitinase F has the amino acid sequence as shown in SEQ ID No.1 and the encoding gene as shown in SEQ ID No.2. The cloned DNA (Deoxyribose Nucleic Acid) of a nucleotide sequence provided by the invention can be transplanted into an engineering bacterium through transduction, transformation and conjugative transfer methods; high expression is given to the host chitinase F through regulating the hydrolysis of the chitin and the expression of a gene for synthesizing N-acetyl-D-glucosamine, so that an effective approach is provided for expanding the biological application range of the chitinase F, and the application prospect is broad.

Description

Cordyceps sinensis China pilose spore chitinase F, encoding gene and application thereof

(1) technical field

The present invention relates to one and produce bacterium Cordyceps sinensis China pilose spore chitinase (Chitinase) F, the gene of this enzyme of encoding and application thereof from " hundred make ".

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma on lepidopteran (Lepidoptera) Hepialidae insect (Hepialus armoricanus Oberthur) larva and the complex body (comprising stroma and polypide) on larva corpse.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the various feature of meta-bolites and biological activity, shows huge application and development prospect at biomedicine field.Cordyceps sinensis with its multiple medicinal efficacy extensively, obviously receive much concern, worldwide enjoys high praise.The traditional Chinese medical science thinks, Cordyceps sinensis enters lung kidney two warps, can tonifying lung the moon, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough weakness, phthisical cough phlegm blood, spontaneous sweatings etc., are unique a kind of balance simultaneously, the Chinese medicine that regulates negative and positive.Modern pharmacology confirms, and Cordyceps sinensis has the biological activity widely such as immunomodulatory, antibacterial, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And what use in the actual production such as artificial culture, liquid fermenting is the Cordyceps fungus in imperfect stage, thereby the qualification of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is being done a lot of work aspect Cordyceps Resources investigation, anamorph confirmation, activeconstituents compartment analysis and the mechanism of action, Application and Development.Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.

But, the research of Cordyceps sinensis China pilose spore mechanism mechanism is almost to blank, especially infect in the machine-processed mechanism of bat moth larvae at China pilose spore.

Chitin (chitin) claim again chitin, chitin, for white or the unformed translucent solid of canescence, be dissolved in concentrated hydrochloric acid, sulfuric acid, glacial acetic acid and 78-97% phosphoric acid and anhydrous formic acid, also dissolve in some title complex flux, as LiCl/DMAC, water insoluble, diluted acid, alkali, alcohol and other organic flux.It is with β-l by 2-Acetamido-2-deoxy-D-glucose (NAG), the straight chain macromole that 4-glycosidic link is polymerized, its structure is similar to Mierocrystalline cellulose, just on cellulosic C (2) atom-OH base quilt-NHCOCH replaces, but there is difference greatly in the character of the two.Approximately 10,000,000,000 tons of the annual biosynthetic chitins of chitin nature, in all natural polymers, reserves account for second, are only second to Mierocrystalline cellulose.Chitin is distributed widely in the shell of Crustacean and insect and the middle intestines peritrophic membrane of insect, form in addition the skeleton of most of fungal cell walls together with other materials, chitinase is the chief component of insect body wall, accounts for the 17%-50% of body wall dry weight.

Chitinase is to decompose chitinous class protein, and many animals, plant, microorganism all can produce chitinase.Since within 1905, Becneck finds chitinase in Ke Shi mattress Bacillus chitinovorus first in erosion chitin, as the main biological degradation enzyme of chitin, the research of chitinase is in widespread attention.Set up up to now a whole set of enzymology method.Large quantity research has been carried out in the aspect such as physico-chemical property, higher structure, primary structure and nucleotide sequence and the enzyme mechanism that biological structure comprises chitinase to various chitinases source.Chitinase has with it dual function that suppresses pathogenic fungi growth and kill pests concurrently, and to animals and plants, body harmless, advantage free from environmental pollution, and have research and utility value at the utmost point aspect plant pest non-environmental pollution control.

Most bacillary chitinases belong to the 18th family, and its major function is the chitin decomposing in surrounding environment, to meet himself demand to nutrition, and to the inhibition ability of fungi weak or nothing.The chitinase major part that plant produces is the 19th family's glycosylation hydrolase, and its function is mainly to suppress the growth of pathogenic fungi, carries out egodefense.Bacterium in some streptomycete and soil also can produce 19 family's chitinases of tool Fungicidally active.

Chitinase is a kind of enzyme with wide application prospect, its utilization is directly depended on to a great extent to the research of structure and the function of chitinase gene.Along with the development of DNA recombinant technology, extensively carry out in the world the mask work of chitinase gene.

Benecke in 1905 has separated first and can utilize microorganism the called after Bacilus chhinovorus of chitin as nutritive substance.Nineteen twenty-one Folpmers finds first to decompose chitinous fungi, bacterium and actinomycetes and forms transparent circle containing on chitinous agar, has proved to contain in culture water miscible chitinase.The use snail enteron aisle enzymes such as nineteen twenty-nine Karrer make chitin change into 2-Acetamido-2-deoxy-D-glucose, indirectly show chitinous moiety.The extract of the discovery Aspergilus such as Grassmann in 1931 can be hydrolyzed into the reducing substances that iodine can detect chitin.ZobeH in 1938 etc. have studied the bacterium of decomposing chitinase in seawater, infer that chitinous decomposition is to be ruptured or coming off of amino group caused by glycosidic link.Zechmeister in 1938 etc. prove that apricot Ruzhong is containing multiple lytic enzymes such as chitinases.Actinomycetes in bacterium and soil that Jeuniaux in 1961 etc. separate from snail enteron aisle also can produce extracellular chitinase.Hiramatsu in 2000 etc. also find that some viruses, as Chlorella virus also can produce chitinase, produce biology chitinase like this and expand to almost whole organic sphere.At present, people are separated to chitinase from multiple-microorganism, plant and animal body, and its physico-chemical property has been done to correlative study.

S.marcescens can produce 5 kinds of chitinases, and their molecular weight is respectively 21,36,48,52 and 57kDa.1986, Fuchs etc. with EcoR I restriction endonuclease incomplete digestion pLAFRI plasmid construction cohesive end library, be transformed into utilize after E.coli chitin flat screen select can degrade chitin 4 different clones.This clone (recon) Insert Fragment is 22～27kb, obtains the gene of a 9.5kb coding 75KDa chitinase after subclone.The beginning of microorganism chitinase gene clone has been opened in this research.1986, Wortman etc. were in the time of the chitinase gene clone to Vibrio vulnifiels, and having adopted the chitin of [3H] mark is substrate, utilizes liquid scintillation counter to monitor the soluble product decompositing.1988, the amino grape oligosaccharides of 4-Methylumbelliferyl for Robbins etc. (4-MU) glucosides was as substrate, the expression of the chitinase gene that detects Streptomyces plicatus in E.coli.

1993, Tsujibo etc. are by being cloned into the chitinase gene of isolating Alteromonas sp.Strain0-7 in ocean in expression vector e. coli jm109, result shows, the chitinase of generation is not secreted in the outer substratum of born of the same parents, but assembles in periplasmic space.In addition, this research team utilizes side-directed mutagenesis to be cloned into the conserved sequence in the chi85 gene of Aheromonas sp.Strain0-7, and studied the effect of this conserved sequence, and result shows, Asp-290 and Glu-292 are very necessary to the effect of chi85 chitinase.

1993, Miyashita etc. have cloned chitinase gene S.1ividans (ch/A), after being analyzed, its sequence finds, the gene order of the gene order of this chitinase and other Streptomyces chitinases is without any homology, but the C of the catalytic site comprising in this gene order and type III repeating unit end has 36% homology with the gene order of B.circulars chitinase D.1993, the clone's such as Fujii S.1ividans chitinase C gene, obtain the open reading frame (ORF1 and ORF2) that the fragment of 2kb comprises 2 opposite directions, after Northern hybridization, result shows, only have the complementary mRNA of ORF1 just transcribed, illustrate that this gene is subject to the inhibition of chitinous induction and glucose in the time expressing.

1994, Ueda etc. obtained the chitinase II gene clone of Aeromonas sp.No.10S-24 the gene coded sequence of 1626bp, and 542 amino acid of codified find that this section of sequence contains a signal peptide after analyzing.1997, Chernin etc. clone the chitinase gene obtaining from enterobacter agglomerans Enterobacter agglomerans, carry out finding after complete sequence analysis, this sequence comprises 562 amino acid whose open reading frame of a coding, form an amyloid protein precursor that has the 61kDa of guiding polypeptide, this gene is expressed to rear discovery and can produce and secrete chitinase.Prove that by the spore germination inhibition test to Fusarium oxyspomm this transgenosis bacterium has anti-mycotic activity in vitro, and can suppress to cause in Rhizoctonia solani on flat board and greenhouse the fungal growth of cotton seedling root rot.

1999, the discovery Pyrococcus furiosus Pyrococcus kodakaraensis KOD1 such as Tanaka can produce extracellular chitinase and clone chitinase gene.Its sequential analysis is shown, the long 3645bp of this sequence, 1215 amino acid of codified, molecular weight is 134.259kDa, this is the bacterial strain of current known product enzyme molecular weight maximum.1997, the c gene of the clone's such as Morimoto Clostridium paraputriftcum, the long 2493bp of its nucleotide sequence, is an independently open reading frame, 831 amino acid of encoding.The molecular weight of this enzyme is also larger, is about 90kDa.

Calendar year 2001, Thiery etc. separate clone the gram-positive microorganism Arthrobacter subspecies bacterial strain TAD20 obtaining and obtain chitinase gene from the seabed of Aspect On Study of Antarctic Ice Cap, mainly secrete 2 kinds of chitinase chiF and chiB by studying this bacterial strain.

2008, Z.H.Liu etc. were cloned into a new chitinase from Chaetomium globosum, and express in pichia spp.Zymologic property to this new enzyme is studied, and the suitableeest invert point is 45 DEG C, and optimal pH is 5.0, and under the Cu2+ of 5mmol/L condition, has maximum enzyme to live, and can reach 1.42U/ml.

2009, Chi-Yea Yang etc. was newly separated to the new bacterial strain Bacillus subtilis of a strain from the potato of Taiwan, and in this strain bacterium clone obtained having the chitinase gene of anti-mycotic activity.The opening code-reading frame length of this gene is 1791bp, 595 aminoacid sequences of encoding.Construction recombination plasmid is converted into has chitinase activity in intestinal bacteria, and can make Rhizoctonia solani Kuhn pathogenic activity decline more than 90%.

At home, related microorganism chitinase gene clone research is less.1998, Peng Huiyin etc. located the chitinase gene of nuclear polyhedrosis virus (HaSNP:V) respectively, obtained RXbaI-H fragment clone.1998, Zheng Hongwu etc. cloned the chitinase gene of Bacillus circulans C-2.2002, Zhou Ying etc. were separated to a strain efficient chitin degrading bacterium one Aeromonas caviae CB101 (Aeromonas caviae) from Xiamen sea area, and it can produce and secrete the chitinase that various molecular weights is different.Xiong Guoru etc. are by carrying out the fermented liquid of subtilis XF-1 to find a kind of heat-resisting chitinase after ammonium sulfate precipitation, high-temperature heating treatment, SDS-PAGE electrophoresis, amino acid sequencing, and this heat-resisting chitinase is cloned, this chitinase has certain splitting action to pathogen plasmodiophora spore.

2003, the Chinese Academy of Agricultural Sciences tobacco first the chitinase gene that derives from baculovirus is structured on expression vector, and import tobacco, detect through methods such as PCR and Western Blot, obtained turning the transgene tobacco strain of chitinase gene.The result of enzyme assay shows, external source chitinase gene has obtained expression in tobacco, and has produced biologic activity, and the not genetically modified parent of chitinase specific activity of transgenic line is high.

But, in ncbi database, also retrieve the gene-correlation information less than chitinase in China pilose spore at present at present.

(3) summary of the invention

The object of the invention is for the deficiency of above existence and the technical issues that need to address, enzyme and encoding gene thereof that " hundred make " produced in bacterium Cordyceps sinensis China pilose spore infection mechanism are furtherd investigate, the gene and the application thereof that provide " hundred make " to produce bacterium Cordyceps sinensis China pilose spore infection mechanism chitinase F and coding.

The technical solution used in the present invention is:

Participate in a chitinase F for China pilose spore infection mechanism, there is 90% above homology with sequence shown in SEQ ID No.1.Due to the singularity of aminoacid sequence; any fragment that contains the peptide protein of aminoacid sequence shown in SEQ ID NO.1 or its variant; as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequence homology, more than 90%, all belong to the row of protection domain of the present invention.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in aminoacid sequence; Wherein, change for the conservative property of variant, the amino acid of replacing has the structure similar to original acid or chemical property, and as replaced Isoleucine with leucine, variant also can have non-conservation and change, as replaced glycine with tryptophane.

Preferably, the present invention states chitinase F and produces bacterium Cordyceps sinensis China pilose spore from " hundred make ", and described chitinase F aminoacid sequence (is designated as chiF albumen) as shown in SEQ ID No.1; This enzyme can be prepared corresponding 2-acetylamino-2-deoxy-D-glucose by catalysis colloidal chitin solution.

The path that is obtained corresponding 2-acetylamino-2-deoxy-D-glucose by colloidal chitin is as follows:

The invention still further relates to described chitinase F and prepare the application in 2-acetylamino-2-deoxy-D-glucose in biocatalysis, concrete, described in be applied as: prepare corresponding 2-acetylamino-2-deoxy-D-glucose with chitinase F catalysis colloidal chitin of the present invention.Be specially: the phosphate buffered saline buffer (50mM for wet thallus with the recombinant bacterial strain containing chitinase F gene after inducing culture, pH8.0) 100mL suspends, after ultrasonication, centrifugal, get supernatant liquor as catalyzer, taking tobacco brown spot pathogen solution as substrate, in the acetate buffer solution that is 4.6 in pH value, 37 DEG C of reactions, after reaction finishes, reaction solution is centrifugal, get supernatant liquor and be the mixed solution that contains 2-acetylamino-2-deoxy-D-glucose, by mixed solution separation and purification, obtain 2-acetylamino-2-deoxy-D-glucose, the method of described mixed solution separation and purification is operation known in this field, conventionally adopt the method for affinity chromatography, the volumetric usage of described substrate is counted 3.33mg/L (final concentration) with chitin opaque amount, the consumption of described catalyzer with ultrasonication before the quality of wet thallus count 8.3g/L (final concentration).

Described catalyzer is prepared as follows: recombinant bacterium E.coli BL21 (DE3)/phosphate buffered saline buffer for pET-28a/chiF (50mM, pH8.0) 100mL is suspended, high pressure cracker stops broken 3 times (35Kpa) under 1s condition at power 40%, broken 1s, each 5min, the centrifugal thalline of removing, gets supernatant liquor and obtains crude enzyme liquid.

Further, described catalyzer is prepared as follows: by the LB liquid nutrient medium being inoculated in containing the recombinant bacterial strain of chitinase F containing the Kan resistance of final concentration 50 μ g/ml, 37 DEG C, 250r/min overnight incubation, get 1mL culture, transferred in the LB liquid nutrient medium that (inoculum size by volume concentration 2% is carried out) contain 50 μ g/ml Kan resistances in 50mL, 37 DEG C, it is 0.6～0.8 that 250r/min is cultured to cell concentration OD600, to the IPTG inducing culture 8h that adds final concentration 0.05mmol/L in culture, collect wet thallus, by wet thallus at power 40%, broken 1s stops under 1s condition ultrasonication 3 times, each 5min, centrifugal, get supernatant liquor and be catalyzer.

Described tobacco brown spot pathogen solution is prepared as follows: chitin powder is added in acetone and ground, can add acetone therebetween, be stirred well to pasty state, grind below limit at 10 DEG C and slowly add concentrated hydrochloric acid (mass concentration 36～38%), after several minutes, with filter paper filtering, then filtrate is slowly joined in volumetric concentration 50% aqueous ethanolic solution (be at least 5 times of filtrate more than volume) of vigorous stirring, make colloidal state chitin Precipitation, the centrifugal supernatant liquor that goes, collect colloidal state chitin, extremely neutral for several times with distilled water flushing, be suspended in and in distilled water, be tobacco brown spot pathogen, the volumetric usage of described concentrated hydrochloric acid is several as 40mL/g taking chitin powder quality, the volumetric usage of described distilled water b is several as 100mL/g (described distilled water a and distilled water b are distilled water, name in order to distinguish different step consumption difference) taking chitin powder quality.

The invention still further relates to the gene of the described chitinase F of coding.Concrete, the nucleotide sequence of described gene (is designated as chiF gene as shown in SEQ ID No.2; ChiF genes encoding chiF albumen).

Due to the singularity of nucleotide sequence, the variant of polynucleotide shown in any SEQ ID NO.2, as long as itself and this polynucleotide have 90% above homology, all belongs to the row of protection domain of the present invention.The variant of described polynucleotide refers to a kind of polynucleotide sequence that one or more Nucleotide changes that has.The variant of these polynucleotide can make raw displacement varient or the varient of non-life, comprises and replaces varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of polynucleotide, but can be from not changing in fact the function of peptide protein of its coding.

The invention still further relates to described gene in the application building in the genetic engineering bacterium of can catalysis colloidal chitin preparing 2-acetylamino-2-deoxy-D-glucose, to expand the application of chitinase F, be specially: build the recombinant vectors that contains described chitinase F gene, described recombinant vectors is converted in intestinal bacteria (preferably E.coli BL21 (DE3)), the recombination engineering bacteria obtaining carries out inducing culture, and nutrient solution separation and purification obtains the somatic cells that contains chitinase F gene.

Main points of the present invention have been to provide the nucleotide sequence shown in the aminoacid sequence shown in SEQ ID NO.1 and SEQ ID NO.2, the in the situation that of known this aminoacid sequence and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and the acquisition of related vector, host cell, be all apparent to those skilled in the art.

The bacterial strain that Cordyceps sinensis chitinase F of the present invention and encoding gene thereof can be provided is China pilose spore (Hirsutella sinensis) L0106, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M2011278, in the patent CN102373190A of previously application, discloses.

Beneficial effect of the present invention is mainly reflected in: the present invention prepares corresponding 2-acetylamino-2-deoxy-D-glucose to chitin and studies in detail principle, provide " hundred make " to produce chitinase F and the encoding gene thereof of bacterium Cordyceps sinensis China pilose spore participation infection mechanism mechanism, the cloned DNA of nucleotide sequence provided by the present invention can be used for by transduction, transform, proceed in engineering bacteria in conjunction with the method shifting, by regulating the expression of chitin hydrolysis and 2-acetylamino-2-deoxy-D-glucose synthetic gene, give the high expression level of host's chitinase F, for the biologic applications that expands chitinase F provides effective way, there is major application prospect.

(4) brief description of the drawings

Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produces the total RNA of bacterium Cordyceps sinensis China pilose spore;

Fig. 2 is that China pilose spore infects bat moth larvae mechanism and process annotated map;

Fig. 3 is chitinase F gene PCR amplified production gel electrophoresis figure;

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;

Fig. 5 is restructuring cloned plasmids pMD18-T/chiF physical map;

Fig. 6 is recombinant expression plasmid pET-28a/chiF building process schematic diagram;

Fig. 7 is recombinant expression plasmid pET-28a/chiF physical map;

Fig. 8 is the SDS-PAGE figure of chitinase F albumen.

(5) embodiment

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore

Bacterium source: first gather natural cordyceps from Qinghai, and taken back Hangzhou and carried out separation screening, obtain L0106 bacterial strain, and be China pilose spore (Hirsutella sinensis) through this bacterial strain of strain identification, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M2011278, in the patent CN102373190A of previously application, discloses.

This bacterial classification is inoculated in to inclined-plane, (this is the liquid formulations before solidifying to culture medium prescription, prepare afterwards bevel again in following ratio) be: glucose 2.0% (w/v, 1% represents to contain 1g in 100mL substratum, lower with), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, magnesium sulfate 0.05%, potassium primary phosphate 0.05%, agar powder 1.0%, surplus is water; Cultivate 25 days at 12～16 DEG C; Then bacterial classification is inoculated in to fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, magnesium sulfate 0.01%, potassium primary phosphate 0.02%, and surplus is water; Be placed on shaking table, 12～16 DEG C of cultivations of temperature 25 days, under aseptic condition, carry out solid-liquid separation, and solid are placed in to aseptic utensil after cultivation finishes, for subsequent use.

Embodiment 2: " hundred make " produces the extraction of the total RNA of bacterium Cordyceps sinensis China pilose spore

Extract total RNA with TRIzol reagent, step is specially:

1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly add liquid nitrogen to be fully ground to Powdered, divide and install in the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mix, leave standstill 5min on ice, nucleic acid-protein mixture is separated completely.

2) RNA separates: add 0.2mL chloroform, firmly concussion mixes 15s, leaves standstill 2～3min on ice, 4 DEG C, the centrifugal 15min of 12000rpm, and layering, gets upper strata water, approximately 600 μ L.

3) RNA precipitation: add 500 μ L Virahols, leave standstill 10min on ice, 4 DEG C, the centrifugal 10min of 12000rpm, abandon supernatant.

4) RNA washing: add 1mL75% (v/v) ethanol, will precipitate and hang, leave standstill 10min, 4 DEG C, the centrifugal 15min of 7500rpm on ice; Repeat washing step above, then wash one time.

5) dissolve RNA: centrifuge tube is placed in and opens wide dry 5～10min on ice, add appropriate DEPC water dissolution.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample

Extract after the total RNA of sample, use the enrichment with magnetic bead mRNA with Oligo (dT).Add fragmentationbuffer that mRNA is broken into short-movie section (200～700bp), taking mRNA as template, with the synthetic Article 1 cDNA chain of hexabasic base random primer (random hexamers), then synthetic Article 2 cDNA chain, do end reparation, add polyA and connect sequence measuring joints through QiaQuick PCR test kit purifying and after adding EB buffer solution elution again, then carry out clip size selection with agarose gel electrophoresis, finally carry out pcr amplification, the sequencing library of building up checks order with Illumina GA IIx.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains adaptor sequence in primitive sequencer reads, standby with subsequent analysis.

Embodiment 4: " hundred make " produces the short sequence assembling of reading of bacterium Cordyceps sinensis China pilose spore RNA

Use short reads composite software SOAPdenovo (Li, Zhu et al.De novo assembly of human genomes with massively parallel short read sequencing[J] .Genome Res, 2010,20:265-272.) transcribe group and from the beginning assemble.First SOAPdenovo is linked to be the reads with certain length overlap the longer Contig fragment that does not contain N.Then reads is compared back to Contig, determine from the distance between different Contig and these Contig of same transcript by paired-end reads, SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence represents with N, so just obtains Scaffold.Further utilize paired-end reads to do filling-up hole processing to Scaffold, finally obtain containing N minimum, the Unigene sequence that two ends can not extend again.Finally, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are done to blastx and compare (evalue<0.00001), get the best albumen of comparison result and determine the sequence direction of Unigene.If the comparison result between different sink is contradictory, press nr, Swiss-Prot, the priority of KEGG and COG is determined the sequence direction of Unigene, with above four storehouses all to less than software ESTScan (Iseli for Unigene, Jongeneel et al.ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences[J] .In Proceedings of9th International Conference on IntelligentSystems for Molecular Biology.AAAIPress, Menlo Park, CA, pp.1999, 138-148.) predict its coding region and determine the direction of sequence.Provide its sequence from 5' to 3' direction for the Unigene that can determine sequence direction, provide for the Unigene that cannot determine sequence direction the sequence that composite software obtains.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation

Functional annotation information provides protein function annotation, Pathway annotation, COG functional annotation and Gene Ontology (GO) functional annotation of Unigene.First, by blastx by Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG (evalue<0.00001), obtain thering is the albumen of highest serial similarity with given Unigene, thereby obtain the protein function annotation information of this Unigene.Can further obtain the Pathway annotation of Unigene according to KEGG annotation information.Unigene and COG database are compared, and the function that prediction Unigene is possible is also done function statistic of classification to it.According to nr annotation information, use Blast2GO software (Conesa, Gotz et al.Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research[J] .Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.Obtain after the GO annotation of each Unigene, with WEGO software (Ye, Fang et al.WEGO:a web tool for plotting GO annotations[J] .Nucleic Acids Research, 2006,34:293-297.) all Unigene are done to GO functional classification statistics, be familiar with the gene function distribution characteristics of these species from macroscopic view.

Embodiment 6: " hundred make " produces the analysis of bacterium Cordyceps sinensis China pilose spore infection mechanism and process

Fig. 2 is that China pilose spore infects bat moth larvae mechanism and process annotated map, and after annual 7-8 month Cordyceps sporophore maturation, ， Rang spore ejects with rainwater and infiltrates in soil, forms conidium through growing to change.Now, as being attached to bat moth larvae table, after 2-3 days, starting to sprout and stretch out germ tube, invade in larva body by the synergy of enzyme and mechanical force.Absorbed body fluid nutrient is grown and is fragmented into hyphal fragment, sprouts and sends out the continuous extended volume of increment rapidly with yeast shape.The constantly accumulation in blood of its meta-bolites in early stage, causes blood pH to change, and makes blood lose original transparency and becomes muddy.But do not produce toxin and the symbiosis of host larva.Later stage, because thalline increases, fill the air in larva haemocoele, enteron aisle is blockaded by machinery also, and blood pear flower character changes and causes pathology injury, occurs metabolism disorder, and larva action is dull-witted, does not take food.At this moment mycelium spreads to body surface rapidly, occurs the white hypha that fine rule is sparse on larva body surface, and mycelium absorbs moisture in larva body in a large number, causes the stiff ossified formation bombys batryticatus of larva (being sclerotium).Conventionally, China pilose spore can produce the enzyme of cell walls, cytolemma and intracellular matter of some degraded host insects, as chitinase, proteolytic enzyme, lipase etc., and the compositions such as the chitin that contains with the body wall of degrading, protein, lipoid, thus be conducive to invasion and attack.Transcribe from China pilose spore the Unigene that chitinase detected group order-checking and annotation information.Detect online by the ORF Finder software in NCBI, found out the open reading frame (SEQ ID No.2) of this gene and obtained corresponding protein sequence (SEQ ID No.1).

Embodiment 7: " hundred make " produces the design of bacterium Cordyceps sinensis China pilose spore chitinase F gene primer

The each gene open reading frame DNA sequence dna design primer that uses GENE RUNNER primer-design software to obtain according to prediction, produce the chitinase F gene of bacterium China pilose spore infection mechanism for clone's " hundred make ", primer is synthetic by Sani bio tech ltd, Shanghai, and primer sequence is listed as follows:

ChiF gene: forward primer 5 ' AGAGAATTCCCCGTGGTGCGTACGGAGAG3 '

Reverse primer 5 ' ATAGCGGCCGCTCATTCCATACCCTTCT3 '

ChiF mrna length is 1206bp.

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA the first chain

The method first providing according to embodiment 1 is turned out after sutella sinensis fermented mycelium, the method providing according to embodiment 2 is again carried out the extraction of total RNA to China pilose spore, obtain being undertaken synthesizing of " hundred make " production bacterium Cordyceps sinensis China pilose spore cDNA the first chain by following after total RNA, for follow-up each gene clone experiment.

Adopt synthetic cDNA the first chain of PrimeScript1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is as follows:

1) in Microtube pipe, prepare following mixed solution.

2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the annealing of the specificity of reverse transcription primer and template, can improve reverse transcription reaction efficiency, so carry out sex change, annealing reaction on PCR instrument, condition setting is as follows:

65℃，5min

3) annealing finishes the mixed solution that the rear centrifugal several seconds makes template ribonucleic acid/primer etc. and is gathered in Microtube pipe bottom.

4) in above-mentioned Microtube pipe, prepare following inverse transcription reaction liquid.

5) on PCR instrument, carry out reverse transcription reaction by following condition.

42℃ 15～30min

70℃ 15min

Generalized case, there is a PolyA structure at eukaryote mRNA 3 ' end, the quantity of A base ten to hundreds of not etc., utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, synthetic cDNA the first chain taking mRNA as template, the sequence (providing in PrimeScript1st Strand cDNA Synthesis Kit) in the dT region of being developed alone by TaKaRa is provided in the present invention is primer, if the mRNA integrity obtaining is better, can obtain so cDNA first chain of all zymoprotein encoding genes in species by reverse transcription process.Embodiment 9: " hundred make " produces the detection of clone, expression and the protein vigor of bacterium Cordyceps sinensis China pilose spore infection mechanism chitinase F gene

1, the pcr amplification of chitinase F gene

Taking cDNA the first chain of obtaining in embodiment 8 as template, chitinase F gene primer with synthetic in embodiment 7: 5 ' AGAGAATTCCCCGTGGTGCGTACGGAGAG3 ' and 5 ' ATAGCGGCCGCTCATTCCATACCCTTCT3 ' carry out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase pcr amplification condition:

2, chitinase F gene PCR product gel electrophoresis detection

Concrete detection method is:

1) it is uniformly dissolved 0.9% the sepharose microwave-oven-heating preparing;

2) get 15mL sepharose, in the time that sepharose is cooled to 50 DEG C of left and right, add 1 μ L staining fluid Gold view, after mixing, pour on electrophoresis agarose gel plate, remove and insert point sample comb after bubble;

3) after gel solidifies on agarose gel plate, carefully take out point sample comb, sepharose offset plate is put into electrophoresis chamber (one end, point sample hole is near the negative pole of electrophoresis chamber), in electrophoresis chamber, add TAE electrophoretic buffer;

4) get 5 μ L samples and then add 6 × Loading Buffer1.5 μ L and ddH ₂it is 10 μ L that O4 μ L uses liquid-transfering gun loading, applied sample amount after mixing;

5) connect the supply lead between electrophoresis chamber and electrophoresis apparatus, just very red, negative pole is black;

6) power-on, starts electrophoresis, and maximum voltage is no more than 5V/cm;

7) when sample ran agarose gel plate 2/3 time can stop electrophoresis;

8), after cutting off the electricity supply, gel on agarose gel plate taken out and put into the observation of gel imaging instrument, take pictures.

The size of transcribing group order-checking prediction chitinase F gene is 1206bp, and agarose gel electrophoresis result shows successfully to have amplified chitinase F gene, and size is about 1200bp.Fig. 3 is that " hundred make " produces bacterium China pilose spore infection mechanism chitinase F functional gene PCR product gel electrophorogram.

3, the base A that adds of chitinase F gene PCR product processes and purifying

Because Pfu archaeal dna polymerase PCR product end is flush end, so just can be used for the connection of T carrier also need to add base A processing, purifying after glue reclaims after.It is as follows that glue recovery product adds base A system:

In PCR instrument, 72 DEG C add A base 20min, finally purify with AxyPrep PCR cleaning agents box.

4, being connected of chitinase F gene and cloning vector

Cloning vector pMD18-T Vector is purchased from TaKaRa company (TaKaRa code D101A), its physical map is shown in Fig. 4, the chitinase F gene of step 3 purifying is connected to construction recombination plasmid pMD18-T/chiF with cloning vector, physical map is shown in Fig. 5, and linked system and condition of contact are as follows.

Linked system:

Condition of contact: 16 DEG C, 16h; Deactivation: 65 DEG C, 15min.

5, the conversion of chitinase F recombinant plasmid pMD18-T/chiF

Recombinant plasmid pMD18-T/chiF is proceeded in intestinal bacteria E.coli JM109, structure carries the recombinant bacterium E.coli JM109/pMD18-T/chiF of chitinase F gene, concrete steps are: 1) 10 μ L reaction systems (being the connection product of step 4) are gone in competent cell E.coli JM109 to ice bath 30min; 2) thermal shock: 42 DEG C, 90s; 3) ice bath: 2-3min; 4) add 800 μ L liquid LB, 37 DEG C, 250rpm, 1h; 5) spread plate (containing Amp resistance, final concentration 50 μ g/ml); 6) 37 DEG C of incubator overnight incubation.

6, the screening of the positive recombinant bacterium of chitinase F E.coli JM109/pMD18-T/chiF

Bacterium colony PCR can extract genomic dna, and directly carry out pcr amplification taking the DNA that exposes after thalline pyrolysis as template, the method is easy and simple to handle, quick, can Rapid identification bacterium colony whether be the positive bacterium colony that contains object plasmid, transform in qualification comparatively common.In experiment, carry out bacterium colony PCR by being inoculated into single bacterium colony corresponding in liquid nutrient medium, to verify whether proceed to goal gene.First, add and contain in the 1.5mL centrifuge tube of 50 μ L sterilized waters with toothpick picking list bacterium colony, boiling water bath 30min, then centrifugal using supernatant as template, carry out pcr amplification, PCR program setting is Taq enzymatic amplification general procedure.Finally adopt 0.9% agarose gel electrophoresis detection bacterium colony PCR product.

7, the order-checking of chitinase F recombinant plasmid pMD18-T/chiF

The positive recombinant bacterium liquid inoculation that bacterium colony PCR is detected is to LB substratum, after 37 DEG C, 150rpm overnight incubation, gets 4mL bacterium liquid and extracts plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is completed by Sani bio tech ltd, Shanghai.Through sequence verification, sequence SEQ ID No.2 recombinated to pMD18-T/chiF in.

8, the structure of chitinase F recombinant expression plasmid pET-28a/chiF

Experiment is the principle at expression in escherichia coli according to foreign gene, and expression vector pET-28a and chitinase F gene restriction enzyme site comparison situation, determine that chitinase F uses EcoR I/Not I double enzyme site, and recombination bacillus coli E.coli JM109/pMD18-T/chiF has been carried out to the cultivation of liquid LB test tube shaker, recombinant plasmid extraction.

The recombinant plasmid pMD18-T/chiF of chitinase F gene and expression vector pET-28a use respectively EcoR I/Not I restriction enzyme 37 DEG C respectively enzyme cut process 6h, it is as follows that enzyme is cut system:

EcoR I/Not I double digestion system:

Enzyme is cut and is finished rear 65 DEG C of deactivation 15min, then respectively with Axygen DNA gel recovery test kit reclaim, purifying.

Chitinase F gene and expression vector pET-28a spend the night with 16 DEG C of connections of T4 ligase enzyme after double digestion, purifying again, build recombinant expression plasmid pET-28a/chiF, its building process is shown in Fig. 6, builds the recombinant expression plasmid pET-28a/chiF collection of illustrative plates obtaining and sees Fig. 7.Linked system is composed as follows:

Linked system:

9, the conversion of chitinase F recombinant expression plasmid and the screening of positive monoclonal

The expression plasmid heat shock building is converted in E.coli BL21 (DE3) Host Strains, is then applied on the LB agar plate that contains kantlex (Kan) resistance (final concentration 50 μ g/ml) 37 DEG C of overnight incubation.Random choose list bacterium colony from flat board, carries out pcr amplification with chitinase F gene primer synthetic in step 7, selects positive colony.

10, the abduction delivering of chitinase F recombinant bacterium

Be inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance (final concentration 50 μ g/ml) 37 DEG C, 250r/min overnight incubation by being accredited as positive mono-clonal.Get 1mL culture, transferred in the LB liquid nutrient medium that contains Kan resistance (final concentration 50 μ g/ml) in 50mL, 37 DEG C, 250r/min are cultured to cell concentration OD600 and are about 0.6～0.8 left and right.To the IPTG inducing culture 8h that adds respectively finite concentration (final concentration 0.05mmol/L) in culture.Collecting thalline surveys for electrophoretic analysis and enzyme biopsy.

11, chitinase F recombinant bacterium expression product SDS-PAGE analyzes

With the recombinant bacterium that proceeds to E.coli BL21 (DE3) bacterium of empty carrier and do not add inductor IPTG in contrast.Be accredited as positive recombinant bacterium after IPTG inducing culture 7h, get 0.5mL inducing culture thing, centrifugal collection thalline, be resuspended in 50 μ L distilled water, add 50 μ L sample-loading buffers, after mixing, boil 10min, carry out SDS-PAGE electrophoretic analysis, " A " swimming lane in Fig. 8 is the SDS-PAGE figure of e. coli bl21 (DE3) ghost, " B " swimming lane is that recombinant bacterium E.coli BL21 (DE3)/pET-28a adds the SDS-PAGE figure after IPTG induction, " C " swimming lane is the contrast SDS-PAGE figure that recombinant bacterium E.coli BL21 (DE3)/pET-28a/chiF does not add IPTG, " D " swimming lane is the SDS-PAGE figure of recombinant bacterium E.coli BL21 (DE3)/pET-28a/chiF abduction delivering.Show in recombinant bacterium E.coli BL21 (DE3)/pET-28a/chiF containing chitinase F (through its aminoacid sequence of sequence verification as shown in SEQ ID No.1).

12, the protein vigor of chitinase F recombinant bacterium detects

(1) protein vigor of chitinase F detects

1. the preparation of tobacco brown spot pathogen solution: take 1g fine powder chitin, add 4ml acetone to grind, can add acetone therebetween, be stirred well to pasty state.Grind below limit at 10 DEG C and slowly add concentrated hydrochloric acid (mass concentration 36～38%) 40ml, after several minutes, with filter paper filtering, then filtrate is slowly joined in volumetric concentration 50% aqueous ethanolic solution (be at least 5 times of filtrate more than volume) of vigorous stirring, make colloidal state chitin Precipitation, the centrifugal supernatant liquor that goes, collect colloidal state chitin, extremely neutral for several times with distilled water flushing, then directly miscible in 100mL distilled water, be tobacco brown spot pathogen solution 100mL, keep in Dark Place in refrigerator.

2. 1% paradimethy laminobenzaldehyde (1%DMAB): take 1g paradimethy laminobenzaldehyde, add a small amount of Glacial acetic acid to dissolve, add again the dense HCl of 1.25mL (mass concentration 36～38%), be finally settled to 100mL (it is yellow that solution is) with Glacial acetic acid.

3. saturated borax solution: take 5.0g sodium tetraborate (Na ₂b ₄o ₇10H ₂o), be dissolved in 100mL hot water, cooling rear for subsequent use.

4. the preparation of N-Acetyl-D-glucosamine typical curve: preparation 100 μ g/mL N-Acetyl-D-glucosamine (N-Acetyl-D-glucosamine, GlcNAc) mother liquor, press table 1 preparation production standard curve, typical curve equation is: y=0.0053x+0.003, R ²=0.9976, wherein y is the light absorption value under 585nm, the concentration that x is standard substance.

Table 1N-acetylglucosamine typical curve

Enzyme liquid preparation: take recombinant bacterium E.coli BL21 (DE3)/pET-28a/chiF wet thallus 2g that step 10 is collected, suspend with phosphate buffered saline buffer (50mM, pH8.0) 100mL, high pressure cracker (model FS-600, Shanghai Sheng Xi ultrasonic instrument company limited) stop broken 3 times (35Kpa) under 1s condition at power 40%, broken 1s, each 5min, the centrifugal thalline of removing, gets supernatant liquor and obtains crude enzyme liquid 81.5ml.

Chitinase F transformation system: the each 0.4mL of crude enzyme liquid, 0.4mL acetate buffer solution (0.05mol/L, pH4.6) and the 0.4mL tobacco brown spot pathogen solution that add the fragmentation of E.coli BL21 (DE3)/pET-28a/chiF high pressure to collect afterwards in 1.5mL EP pipe.After 37 DEG C of water-bath 2h, the centrifugal 5min of 12000r/min, termination reaction, gets supernatant liquor and is the mixed solution containing 2-acetylamino-2-deoxy-D-glucose.

Method with reference to Reissig etc. is measured the N-Acetyl-D-glucosamine amount in supernatant liquor.Method is to get 0.4mL supernatant liquor, add the saturated borax solution of 0.2mL, boiling water bath 7min, after cooling, add again 2mL Glacial acetic acid and 1mL1% paradimethy laminobenzaldehyde (DMAB) solution, after 37 DEG C of water bath heat preservation 15min (solution takes on a red color), 585nm place measures solution light absorption value.

A unit of enzyme activity (U) is defined as chitinase F per minute and decomposes tobacco brown spot pathogen and produce the enzyme amount of 1 μ g 2-Acetamido-2-deoxy-D-glucose.

Detect blank that phosphorus chitinase F enzyme lives and be and boil the crude enzyme liquid of inactivation after 20min and substitute former crude enzyme liquid.In addition, under similarity condition, also detect the vigor of the crude enzyme liquid after E.coli BL21 (DE3) and E.coli BL21 (DE3)/pET-28a induction, all found no colour-change, all do not detected that chitinase enzyme is alive.

The protein content that utilizes Xylene Brilliant Cyanine G method to record in chitinase F crude enzyme liquid is 0.3315mg/mL, by Bandscan software, crude enzyme liquid band content in SDS-PAGE is analyzed, chitinase F accounts for 12.6% of total protein, is 0.3315mg/mL × 0.4mL × 0.126=0.0167mg therefore participate in the chitinase F of catalyzed reaction.In the time adding the Ba2+ of 5mM, having maximum enzyme lives: 4.94 μ g/mL × 1.2mL ÷ 120min=0.0494U, therefore the work of high specific enzyme is: 0.0494U ÷ 0.0167mg=2.96U/mg.Therefore, the high specific enzyme of the expressed chitinase F of above-mentioned structure gained chitinase F recombinant bacterium is lived as 2.96U/mg, and the transformation efficiency of above-mentioned reaction is 11.2%.Than enzyme calculation formula alive be: than the Tot Prot of enzyme work=enzyme work/enzyme.Transformation efficiency calculation formula is: transformation efficiency=(starting point concentration-equilibrium concentration)/starting point concentration.

(2) the catalytic process research of chitinase F

Investigate the impact of the lower chitinase F conversion of differing temps (30 DEG C, 35 DEG C, 37 DEG C, 40 DEG C, 45 DEG C, 55 DEG C, 65 DEG C) vigor: the crude enzyme liquid 0.4mL, 0.4mL acetate buffer solution (0.05mol/L, pH4.6) and the 0.4mL tobacco brown spot pathogen solution that in 1.5mL EP pipe, add the fragmentation of E.coli BL21 (DE3)/pET-28a/chiF high pressure to collect afterwards.After 30 DEG C, 35 DEG C, 37 DEG C, 40 DEG C, 45 DEG C, 55 DEG C, 65 DEG C water-bath 2h, the centrifugal 5min of 12000r/min, termination reaction, detects than enzyme and lives according to preceding method.It is optimal reaction temperature that result shows 37 DEG C, and ratio enzyme is now lived as 2.04U/mg.

Also investigate the impact that different pH (3.0,4.0,5.0,6.0,7.0,8.0,9.0,10.0,11.0,12.0) transform chitinase F: the phosphate buffered saline buffer and the 0.4mL tobacco brown spot pathogen solution that in 1.5mL EP pipe, add the different pH of crude enzyme liquid 0.4mL, 0.4mL that the fragmentation of E.coli BL21 (DE3)/pET-28a/chiF high pressure collects afterwards.After 37 DEG C of water-bath 2h, the centrifugal 5min of 12000r/min, termination reaction, detects than enzyme and lives according to preceding method.Result shows that optimum response pH is 5.0, and ratio enzyme is now lived as 2.15U/mg.

Also investigate the impact that different metal ion (5mM) transforms chitinase F: the crude enzyme liquid 0.4mL, the 0.4mL acetate buffer solution (0.05mol/L that in 1.5mL EP pipe, add the fragmentation of E.coli BL21 (DE3)/pET-28a/chiF high pressure to collect afterwards, and 0.4mL tobacco brown spot pathogen solution, and add respectively the Mn of 5mM pH4.6) ²⁺, Ba ²⁺, Al ³⁺, Ca ²⁺deng and EDTA, after 37 DEG C of water-bath 2h, the centrifugal 5min of 12000r/min, termination reaction, according to preceding method detect than enzyme live.Result shows that Ba2+ has obvious promoter action to transforming, and enzyme is now lived as 2.96U/mg, and Co ²⁺have obvious restraining effect to transforming, enzyme is now lived as 0.16U/mg.

Detected result sees the following form:

Claims (9)

1. a Cordyceps sinensis China pilose spore chitinase F, is characterized in that the aminoacid sequence of described chitinase F is as shown in SEQ ID No.1.

2. chitinase F as claimed in claim 1 generates the application in 2-acetylamino-2-deoxy-D-glucose in biocatalysis tobacco brown spot pathogen.

3. application as claimed in claim 2, it is characterized in that described being applied as: by containing chitinase F recombinant bacterial strain, the pH8.0 of the wet thallus after inducing culture phosphate buffered saline buffer suspends, ultrasonication, centrifugal, get supernatant liquor as catalyzer, taking tobacco brown spot pathogen solution as substrate, in the acetate buffer solution that is 4.6 in pH value, reaction at 37 DEG C, after reaction finishes, reaction solution is centrifugal, get supernatant liquor, obtain the mixed solution containing 2-acetylamino-2-deoxy-D-glucose;

Described tobacco brown spot pathogen solution is prepared as follows: chitin powder is added and in acetone, is ground to pasty state, grind below limit at 10 DEG C and slowly add concentrated hydrochloric acid, with filter paper filtering, then filtrate is slowly joined in volumetric concentration 50% aqueous ethanolic solution of vigorous stirring, separate out precipitation, the centrifugal supernatant liquor that goes, collects tobacco brown spot pathogen, rinse for several times to neutral with distilled water a, be suspended in and in distilled water b, be tobacco brown spot pathogen solution; The volumetric usage of described concentrated hydrochloric acid is several as 40mL/g taking chitin powder quality, and the volumetric usage of described distilled water b is several as 100mL/g taking chitin powder quality.

4. application as claimed in claim 3, is characterized in that: the volumetric usage of described substrate is in chitin opaque amount, and final concentration is 3.33mg/L; The consumption of described catalyzer in ultrasonication before the quality of wet thallus, final concentration is 8.2g/L.

5. application as claimed in claim 3, it is characterized in that described catalyzer prepared as follows: by the LB liquid nutrient medium being inoculated in containing the recombinant bacterial strain of chitinase F containing the Kan resistance of final concentration 50 μ g/ml, 37 DEG C, 250r/min overnight incubation, get culture, transfer in the LB liquid nutrient medium that contains 50 μ g/ml Kan resistances in 50mL with the inoculum size of volumetric concentration 2%, 37 DEG C, it is 0.6～0.8 that 250r/min is cultured to cell concentration OD600, to the IPTG inducing culture 8h that adds final concentration 0.05mmol/L in culture, collect wet thallus, by wet thallus at power 40%, broken 1s stops ultrasonication under 1s condition, centrifugal, get supernatant liquor and be catalyzer.

6. the gene of chitinase F described in the claim 1 of encoding.

7. encoding gene as claimed in claim 6, is characterized in that the nucleotide sequence of described encoding gene is as shown in SEQID No.2.

8. the encoding gene as described in claim 6 or 7 is in the application building in the genetic engineering bacterium that can biocatalysis colloidal chitin generates 2-acetylamino-2-deoxy-D-glucose.

9. application as claimed in claim 8, it is characterized in that described being applied as: build the recombinant vectors that contains described chitinase F gene, described recombinant vectors is converted in intestinal bacteria, the recombination engineering bacteria obtaining carries out inducing culture, and nutrient solution separation and purification obtains the somatic cells that contains chitinase F gene.