CN104107438A

CN104107438A - Use of SPRY2 in preparation of drug for preventing and treating rheumatoid arthritis

Info

Publication number: CN104107438A
Application number: CN201410234333.0A
Authority: CN
Inventors: 于继云; 阎瑾琦; 张巍; 朱静潆; 王芳; 朱晓明; 徐元基; 杜芝燕; 王宇
Original assignee: Institute of Basic Medical Sciences of AMMS
Current assignee: Institute of Basic Medical Sciences of AMMS
Priority date: 2014-05-29
Filing date: 2014-05-29
Publication date: 2014-10-22

Abstract

The invention discloses a novel function of SPRY2. An experiment proves that SPRY2 has the effect of inhibiting abnormal proliferation of FLS cells and can effectively inhibit rat rheumatoid arthritis (RA) condition development. A recombinant adenovirus vector for overexpression of SPRY2 or recombinant adenovirus for overexpression of SPRY2 can be used as an active component and used for preparation of a drug for preventing and treating RA. The SPRY2 has important effects of preventing and treating RA and has a wide application prospect.

Description

The application of SPRY2 in preparation prevention and treatment medicine for treating rheumatoid arthritis

Technical field

The present invention relates to biological technical field, be specifically related to new function and application thereof that gene SPRY2 is relevant to rheumatoid arthritis (RA).

Background technology

1. rheumatoid arthritis (RA) progress

1.1 rheumatoid arthritiss (RA) brief introduction

Rheumatoid arthritis (rheumatoid arthritis, RA) be a kind of autoimmune disease taking articular synovitis as feature, main synovial membrane of invading movable joint, cause synovial membrane hyper-proliferative and cartilage and osteoclasia, disability rate is high, the quality of life and the life expectancy that have a strong impact on patient, RA paathogenic factor and pathogenesis are not yet completely clear, are worldwide study hotspots always ^[1].Apply in the world at present more RA animal model and mainly contain collagen-induced arthritis (collagen-inducedarthritis, CIA) and adjuvant induction arthritis (adjuvant-inducedarthritis, AIA).CIA model utilizes II Collagen Type VI to become antigen, because II Collagen Type VI is the main component of articular cartilage, thereby makes this position of animal body pin carry out the reaction of autoimmune face, thereby produces arthritis, and its most frequently used susceptible animal is DBA/1J mice ^[2]but this type of mice is not easy to obtain at home, therefore we choose AIA model and carry out the correlational study of rheumatoid arthritis, Lewis rat is its most frequently used susceptible animal, convenient sources is guaranteed, and its etiopathogenesis is: be mainly to utilize the tubercule bacillus of heat fire extinguishing to carry out modeling, owing to structurally having individual protein molecular similar with a protein molecular on synovium of joint in conjunction with bacillus, therefore can be identified by corresponding same strain T cell clone, thereby bring out the immunoreation for joint ^[3].

The main pathological characters of rheumatoid arthritis becomes fiber-like synovial cell (fibroblast-like synoviocytes exactly, FLS) abnormality proliferation, FLS cell hyperproliferation, can impel secrete cytokines, chemotactic factor, adhesion molecule and protease etc., these molecules play a significant role in the pathogenesis of rheumatoid arthritis ^[4,5].FLS be main in inflammatory synovial tissue be also the cell type that quantity is maximum, in the time of condition in inflammatory, FLS has the mad characteristic increasing, and this specific character and tumor cell are similar, thereby promote and cause synovial tissue's paraplasm, this is the most important pathological manifestations of RA inflammation.

The selection of 1.2RA Therapeutic Method

At present dissatisfied therapeutic scheme still for the treatment of rheumatoid arthritis, account at present the market share larger be mainly conventional medicament and biological preparation.Traditional Drug therapy is mainly steroidal, NSAID (non-steroidal anti-inflammatory drug) and antirheumatic, lacks specificity, can only alleviate partial symptoms, and can produce corresponding toxic and side effects ^[6-8], have many patients because therapeutic effect is not good enough and untoward reaction drug withdrawal.Although the biological preparation effects such as the cytokine antagonist after this growing up, can not be oral than conventional medicament ideal, necessary subcutaneous or intravenous injection, long-term prescription complex operation increases again patient's misery; In addition, biological preparation expensive, and its Half-life in vivo is short, needs very high drug dose; Moreover the biological preparation of circulation middle and high concentration can produce some serious negative interactions, as increased infection chance etc.

Gene therapy is to utilize molecular biology method that genes of interest is imported in patient body, makes it to express genes of interest product, thereby disease is obtained medical treatment, and is modern medicine and the molecular biology new technique being born that combines.Gene therapy is highly integrated, a comprehensive and highly difficult biological high-technology.It has concentrated the separation, gene of gene to importing and the many-sided technology such as high efficient expression and regulation and control thereof of gene in human body of human body.Gene therapy, as the new tool of new disease treatment, has brought light to the radical cure of some refractory diseases.For rheumatoid arthritis, gene therapy can be taked local gene transfer method, reaches desirable protein concentration at pathological changes local joint, has reduced the danger that normal structure and organ and external source medicament contact cause.Gene therapy promises to be the better rheumatoid arthritis treatment means of effect after biological preparation very much thus, has good application prospect.

Early 1980s, first Anderson has set forth the overview of gene therapy; Nineteen ninety, the Blease etc. of NIH successfully carried out the first clinical gene therapy in the world, in recent years, the research in this field has obtained major progress, gene therapy, as the new disease treatment means of a kind of safety, will change the historical progress of human disease treatment to a certain extent.

The carrier system of 1.3 gene therapies

Due to gene therapy to as if human body, therefore gene therapy had both required to guarantee effectively again safety.The carrier system of gene therapy, has determined the expression that can exogenous gene efficient, stable in receptor.Desirable gene transfer vector is that gene therapy can enter one of clinical key, thereby is emphasis and the focus of gene therapy research all the time.Gene therapy vector is mainly divided into two classes: a class is viral vector, and another kind of is non-virus carrier ^[9].

1.3.1 viral carrier

Virus can natural infection cell, thereby the hereditary material of self can be brought to host cell.RNA and DNA viruses removal pathogenic gene guarantee people there is no grievous injury, can carry after genes of interest again, all likely as gene delivery vehicle.Efficient gene vehicle is exactly recombinant viral vector at present, because it has natural route of infection, up to the present, viral vector is most widely used carrier in gene therapy, include retrovirus retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, slow virus and multiple hybrid viral vector etc., wherein, adenovirus vector (adenovirus vector, AD) there is host range wide, pathogenic low to people, in propagation and non-proliferative cell, infect and expressing gene, titre is high, with human genome homology, can express the advantages such as multiple genes simultaneously, basic research and clinical practice field in gene therapy are extremely paid attention to, be widely used in gene therapy.

(1) retrovirus retrovirus

A kind of diplornavirus that contains two RNA chains of retrovirus retrovirus, once will reverse transcription become double-stranded DNA in it arrives at cell, can, by its entrained exogenous origin gene integrator in cellular genome, be copied and be expressed by the mitosis of cell.In animal and clinical experiment, retrovirus vector is the viral vector of using at most, and it has energy and cellular genome is stably integrated and carrier do not produced to immunoreactive advantage.Mukherjee etc. ^[10]the gene of coding p55TNFR:Fc fusion rotein is utilized to retrovirus vector, import in the rat joint of CIA arthritis model, obtained good effect.Though retrovirus retrovirus transfection efficiency in vitro is high, but also there are a lot of shortcomings, as infected the cell in division, can not be by the extremely cell of non-division of gene transfection, therefore only in the time of cell division, viral DNA just can enter random integration in cell, brings out sudden change, cause malignant tumor generation etc., these drawbacks limit its in clinical application on this.

(2) adenovirus

Adenovirus is the nonenveloped virus of a kind of nonconformity class, linear dsdna ^[11], after infection cell, the hereditary material oneself is not incorporated on the chromosome of cell.Its advantage is that host range is wide, pathogenic low to people, with human genome homology, can express multiple genes simultaneously; Preparation is simple, and the titre of virus is high; Can infect cell and Unseparated Cell in division stage, infection rate is high, available vivo gene transfer mode direct transfection; Foreign gene-carrying capacity is large.Although there are some shortcomings in it, can not long-term expression as gene, there is stronger immunogenicity and have the possibility of the reaction of causing inflammation ^[12].But along with the raising of the deep and technological means of studying, these shortcomings can be overcome, and nowadays in view of the clear superiority of adenovirus vector, have set it as the applied main carriers of gene therapy.

(3) adeno-associated virus

Adeno-associated virus be a class without cyst membrane single stranded DNA defective virus, be the associated virus of adenovirus, can be incorporated on No. 19 chromosomes of host by specificity.It belongs to parvovirus family, to the mankind without obvious virus side-effects.The expression of gland relevant viral vector has many advantages, if the effective polytype cell of transfection comprises division stage and non-division cells, after adeno-associated virus shifts in by body, can express in vivo safely for a long time ^[13].The shortcoming of adeno-associated virus is preparation difficulty, and foreign gene-carrying capacity little (4kb), is difficult to become high titre recombinant virus.

1.3.2 non-viral vector

Comprise liposome, particle gun, nude DNA, DNA part, non-virus carrier can utilize the special receptor of cell surface, makes target DNA enter cell, and impels cell to enter in core.There is good chemical stability; And because they do not contain extraneous protein and other strong antigenic substances, so conventionally can Reusability.But compared with viral vector, ubiquity the low problem of therapeutic gene expression efficiency.

The progress of 2.SPRY2 gene

The brief introduction of 2.1SPRY family

Sprouty (SPRY) gene is found at first in fruit bat body, and is determined participation fruit bat bronchus ^[14]and eyes ^[15]growth course.Sprouty albumen is the albumen of the 63kD that comprises 124 cysteine enrichment residues, finds by the research to xenopous laevis, chicken, mice and people, and Sprouty has homology at cysteine-rich domain.In four kinds of mammals, it is found that Sprouty albumen subsequently, the Spry gene of they and fruit bat has very strong sequence similarity.In structure, the C-terminal that is rich in cysteine of Spry albumen has very strong conservative, is that it is positioned the target region on activating cell after birth ^[16-18], and there is stronger variability in N-terminal.According to its sequence difference, Spry albumen is divided into 4 kinds of hypotypes, i.e. SPRY1-4.The palmitin acidylate phosphoprotein of these 4 kinds of gene code 32-34kD.A large amount of evidences show, Sprouty albumen by covalent modification regulate and control self location, stable, in conjunction with and degraded ^[19].

Clear and definite at present, Sprouty family protein can antagonism receptor tyrosine kinase (receptor tyrosine kinase, RTK) signal, the variation of its expression can cause RTK signal path abnormal, causes tissue growth to grow imbalance or cellular abnormality hypertrophy etc. ^[20].

The 26S Proteasome Structure and Function of 2.2SPRY2

People Sprouty2 gene (referring to sequence 1) is positioned 13q31.1, and coding is containing the protein of 315 amino acid residues, and its C-terminal 178-282 amino acids residue is rich in cysteine.SPRY2 molecule is the feedback suppression molecule of RTK signal path, Lao etc. ^[21]research discovery, Spry2 is significantly higher than other hypotypes of SPRY family to the inhibitory action of RTK signal pathway.

SPRY2 albumen can pass through the inhibition to signal paths such as RTK, suppresses cell hyperplasia, conversion and new vessels generation etc.SPRY2 albumen can utilize two regions (59-64 amino acids residue and 303-307 amino acids residue) of its proline rich, this region can binding growth factor receptor connects the SH3 region of protein N terminal, thereby stops fibroblast growth factor acceptor to be connected albumen with its substrate, growth factor receptors and Guanine nucleotide exchange factor is combined into a kind of complex.This complex can be by activating Ras and Raf-MEK (MA P K)-extracellular signal-regulated kinase (a cellular signal regulated kinase, ERK) path, transmit RTK signal, make the multiple target protein generation phosphorylations such as the interior transcription factor of the signal transduction factor, phosphinositides 3 kinases, MAPK, Phospholipase C, transcriptional activators and core ^[22].

The progress of 2.3SPRY2

Sprouty2 (SPRY2) Main Function, in MAPK signal path, is the important inhibitive factor of this path, thereby performance suppresses the biological functions such as cell proliferation, differentiation and migration ^[23,24].Within 1998, found first Sprouty family in fruit bat body, mainly comprised tetra-members of Sprouty1-4, wherein Sprouty2 is the negative feedback regulatory factor of tyrosine kinase receptor (RTK) signal path ^[14,25-26], be therefore subject to tyrosine kinase receptor signal can regulate and control the expression of Sprouty2 ^[27-30].

The discoveries such as Chong-Chou Lee, under HSF/SF effect, Sprouty2 can be induced to express, and meanwhile, Sprouty2 can also express by regulation and control HSF/SF in inhibition ground; In the time of Sprouty2 high expressed, can suppress significantly propagation, growth and the migration of cell, and Sprouty2 can promote cell adhesion, stretching, extension significantly.Utilized cell cycle analysis, result shows that Sprouty2 can suppress cell and enter the S phase from the G1 phase, thereby judges that Sprouty2 is a kind of tumor suppressor protein ^[31].In most of tumor cells, receptor tyrosine kinase signal path occurs abnormal, and Sprouty2 is the inhibitive factor of this path, thereby Sprouty2 may be also a kind of antioncogene, in the tumor cell such as carcinoma of prostate and breast carcinoma, confirm at present, the expression of Sprouty2 has downward (downward scope from 40% to 96%) in various degree ^[27,32].Sutterluty ^[33]in non-small cell type pulmonary carcinoma, find, Sprouty2 can bring into play the effect that is similar to antioncogene, and the malignant behaviors of inhibition tumor cell, as characteristics such as height transfer and high proliferations.Sprouty albumen be also proved can with some memebrane protein, as Cav-1, occur directly to interact, and then realize it and suppress the biological effects such as cell proliferation, migration ^[34].

In order to analyze the expression of Sprouty2 in prostate gland cancer cell, B.Kwabi Addo etc. ^[35]people transfers and has analyzed 407 routine carcinoma of prostate samples, by comparing the normal prostate tissue of cancerous tissue and periphery, finds that the expression of Sprouty2 declines 39% in cancerous tissue; McKie etc. ^[36]people finds in the research of prostate gland cancer cell expression at another Sprouty2, and compared with optimum prostate samples, in the clinical sample that grade malignancy is higher and high metastatic prostate cell line, the expression of Sprouty2 significantly reduces.Whether the decline of further exploring Sprouty2 expression causes because of supermethylation, McKie utilizes 5-aza-DC to process prostate cancer cell line, raising appears in the expression of Sprouty2, this result is contrary with result of study in another cell DU145 before, but because CpG zone methylation in clinical sample can suppress the expression of Sprouty2, this has just supported the viewpoint of Mckie, again owing to showing to have in prostate gland cancer cell and cell line the generation of Sprouty2 gene mutation without any experimental evidence, therefore think that the main mechanism of Sprouty2 down-regulated expression may be the apparent inactivation of Sprouty2 gene.

Fong CW etc. ^[37]recent findings Sprouty2 lowers at human hepatocellular carcinoma, and contrary with the people's such as McKie conclusion, Fong etc. but do not find the apparent deactivation phenomenom of Sprouty2 gene.But find equally the MAPK that high expressed Sprouty2 can suppress to be activated by HGF, thereby the effect of performance anti-tumour cell proliferative, when the Sprouty2 gene knocking out in HIH3T3 cell, the multiplication capacity of this cell obviously increases, and this just shows that Sprouty2 may be a tumor-inhibiting factor.

The high expressed experiment of Sprouty in osteoma cell line LM8 confirms that the rise of this developed by molecule can suppress growth and the transfer of tumor, and the function that Sprouty2 suppresses cell migration is to realize by the ERK signal activation of inhibition FGF and Serum-induced.In tumor cell, cross expression Sprouty2 molecule, and by this tumor cell injection in nude mouse, by animal experimental observation, find effectively to have suppressed growth and the transfer of tumor.Shift in order to get rid of cell that to be suppressed be to have suppressed because of Sprouty2 the probability that cell proliferation causes, experimenter directly injects tumor cell in nude mice vein blood vessel, the transfer of finding the high cell of Sprouty2 developed by molecule declines, and shows that Sprouty2 suppresses cell migration by suppressing Ras/Erk activity ^[38].

These study discovery, and SPRY2 molecule is in carcinoma of prostate ^[39], breast carcinoma ^[40], hepatocarcinoma ^[41]and pulmonary carcinoma ^[33]obviously suppressed Deng the expression in tumor cell, thereby make the signal path escapes such as RTK suppress and by excessive activation, cause tumor cell abnormality proliferation, thereby promoted generation and the development of tumor ^[42].Owing to having significant negative regulation effect in tumor cell, SPRY2 molecule has become one of study hotspot of current immunotherapy of tumors.

SPRY2 is a kind of important biomolecule molecule that can oppositely suppress RTK signal path, has important function, thereby become the study hotspot of current cancer immunotherapy in tumor occurs and develops.Evidences show in a large number, and SPRY2 molecule is expressed suppressed in kinds of tumor cells, in close relations with tumor cell abnormality proliferation ^[39-42], cross and express the Proliferation and invasion that SPRY2 molecule can inhibition tumor cell ^[31].Think at present, SPRY2 suppresses propagation and the development of tumor by lowering RAS/ERK and PI3K/AKT activation signal ^[39,43], and these two paths are the major avenues of approach of FLS propagation and generation inflammatory reaction just, thus therefore point out this molecule probably to bring into play the development that the inhibitory action of FLS is suppressed to RA.

Summary of the invention

The object of the invention is to propose the new application of SPRY2.

Concrete, the recombinant adenoviral vector that first the present invention proposed to express SPRY2 is in the application of preparing in prevention and treatment rheumatoid arthritis (RA) medicine.

Specifically, with adenovirus vector, for the carrier that sets out imports, SPRY2 is gene constructed to be obtained the recombinant adenoviral vector that described mistake is expressed SPRY2, called after pAd5-hSPRY2 (or pAd-SPRY2).

The construction method of crossing the recombinant adenoviral vector pAd-SPRY2 that expresses SPRY2, can comprise the following steps:

1) pcr amplification carries the hSPRY2 gene of EcoR I and BamH I recognition site, and the nucleotide sequence of hSPRY2 gene is as shown in sequence in sequence table 1;

2) hSPRY2 gene and pDC315 carrier are carried out to double digestion with EcoR I and BamH I;

3) hSPRY2 genetic fragment is connected with pDC315 carrier segments, obtains recombinant vector pDC315/hSPRY2;

4) pDC315-hSPRY2 plasmid and 5 type adenovirus skeleton plasmid pBHGlox (delta) E1,3Cre (its physical map as shown in Figure 5A) cotransfection is to HEK293 cell, in HEK293, utilize the effect of Cre/loxP recombinase to realize homologous recombination, be packaged into 5 type adenovirus vector pAd5-hSPRY2.

The recombinant adenovirus that the present invention also further provides a kind of mistake to express SPRY2 is that recombinant adenoviral vector pAd5-hSPRY2 that described mistake is expressed to SPRY2 carries out recombinant adenovirus packaging and a large amount of amplification purification and obtains in human embryo kidney 293 cells (HEK293) cell.

Cross and express the recombinant adenoviral vector of SPRY2 or the application of recombinant adenovirus in preparation prevention and treatment rheumatoid arthritis (Rheumatoid arthritis, RA) medicine is also content of the present invention.

The invention provides the new function of SPRY2, experimental results show that SPRY2 can play inhibitory action to the abnormality proliferation of FLS cell, and SPRY2 can effectively suppress the development of the rat RA state of an illness.Therefore, can cross the recombinant adenovirus of expressing the recombinant adenoviral vector of SPRY2 or excessively expressing SPRY2 is active fraction preparation prevention and treatment rheumatoid arthritis (RA) medicine.The present invention, by playing a significant role in the prevention of rheumatoid arthritis (RA) and treatment field, has a extensive future.

The invention has the beneficial effects as follows:

1) SPRY2 molecule is a kind of novel functional molecular, there is no in the world the correlational study of this molecule at rheumatoid arthritis treatment at present, and therefore innovation of the present invention is SPRY2 molecular application in the Biotherapeutics of rheumatoid arthritis;

2) originally studies confirm that SPRY2 molecule down-regulated expression in the one-tenth fiber-like synovial cell (FLS) of abnormality proliferation, cross and express the abnormality proliferation that SPRY2 molecule can effectively suppress rheumatoid arthritis and become fiber-like synovial cell, and in zoopery, confirm that it can effectively suppress the development of the Lewis rat RA state of an illness, therefore, can be expressed the recombinant adenoviral vector of SPRY2 or be crossed the recombinant adenovirus of expressing SPRY2 by mistake be active fraction preparation prevention and treatment rheumatoid arthritis (RA) medicine.

Below in conjunction with specific embodiment, the present invention is described in further details.

Brief description of the drawings

Behave reverse transcriptional PCR (RT-PCR) testing result of the natural expression of hSPRY2 gene in FLS cell of Fig. 1

The behave Western Blot testing result of the natural expression of hSPRY2 gene in FLS cell of Fig. 2

Fig. 3 is that the mrna expression level of SPRY2 in FLS cell is with the raise situation of change of (0,1,10ng/mL) of TNF irritaiting concentration

Fig. 4 is the situation of change that 10ng/mL TNF-α stimulates the mrna expression level of SPRY2 in different time (0min, 30min, 60min, 4h, 24h) hFL S cell

Fig. 5 is for building each stage product in recombinant vector pDC315/hSPRY2, wherein:

A width is shown as taking people SPRY2cDNA as template with the hSPRY2 gene of specific primer PCR amplification

B width shows EcoR I and the BamH I double digestion qualification result of recombinant vector pDC315/hSPRY2

C width shows the PCR the selection result of recombinant adenoviral vector pAd-SPRY2

Fig. 5 A is 5 type adenovirus skeleton plasmid pBHGlox (delta) E1, the physical map of 3Cre

Fig. 6 for excessively expressing the impact of SPRY2 molecule on FLS cell proliferation under without TNF-α stimulation (A width) and 10ng/mL TNF-α stimulation (B width) condition

Fig. 7 is the clinical manifestation of rat adjuvant induction arthritis (AIA)

Fig. 8 is clinical indices observation and the measurement result that recombinant adenovirus AdSPRY2 suppresses the arthritis (AIA) of (effectively alleviating) rat adjuvant induction

Fig. 9 is the histological observation result (× 40) that AdSPRY2 significantly suppresses rat arthritis

Figure 10 is the ELISA testing result of proinflammatory cytokine IL-1 β, TNF-alpha expression level

Detailed description of the invention

Rheumatoid arthritis (Rheumatoid arthritis, RA) be a kind of chronic autoimmune disease of pathogenesis more complicated, its main pathological characters is into fiber-like synovial cell (fibroblast-like synoviocytes, FLS) hyper-proliferative, inflammatory cell are invaded profit etc., the synovial tissue of hypertrophy forms pannus and corrodes articular cartilage and bone, causes even afunction etc. of destruction of joint.FLS, as the final target cell of RA pathological change, plays an important role in the evolution of RA.FLS has the mad characteristic increasing of cells like tumor cells sample, is also similar to the tumor of local invasive growth taking FLS as the growth characteristics of main synovial tissue, and therefore the approach of prompting blocking-up tumor cell proliferation may be used for the treatment of RA.

Sprouty (SPRY) gene is found at first in fruit bat body, and Sprouty albumen has 4 kinds of hypotypes, i.e. SPRY1-4.Clear and definite at present, Sprouty family protein can antagonism receptor tyrosine kinase (receptor tyrosine kinase, RTK) signal, the variation of its expression can cause RTK signal path abnormal, causes tissue growth to grow imbalance or cellular abnormality hypertrophy etc.Wherein SPRY2 is a kind of new function molecule being in recent years concerned, and SPRY2 is significantly higher than other hypotype in family to the inhibitory action of RTK signal pathway.Research finds that SPRY2 expresses and lowered in some tumor cells, suppresses and hyper-proliferative thereby tumor cell is escaped, and divides the period of the day from 11 p.m. to 1 a.m when cross expression SPRY2 in some tumor cell, and the propagation of tumor cell is effectively suppressed.SPRY2 realizes the inhibitory action to tumor cell by suppressing ERK and AKT path, and these two paths are the major avenues of approach of FLS propagation and generation inflammatory reaction just, thereby therefore points out this molecule probably to bring into play the development that the inhibitory action of FLS is suppressed to RA.

In vitro cell experiment: first determined the natural expression of SPRY2 molecule in FLS cell by reverse transcriptional PCR (RT-PCR, Fig. 1) and Western Blot (Fig. 2) method, we choose 3 TNF α concentration: 0,5 and 10ng/mL, stimulate FLS cell 24 hours, collecting cell, RT-PCR amplification SPRY2 gene, agarose gel electrophoresis and quantitative analysis results show, compared with during with cell normal growth situation, the mRNA horizontal expression of SPRY2 in FLS cell reduces (Fig. 3) with the increase of TNF α concentration, for further determining that SPRY2 molecule stimulates at TNF α the inhibitory action that may bring into play in the process of FLS cell proliferation, select 10ng/mL TNF-α to stimulate FLS cell different time (0, 30min, 60min, 4h, RT-PCR amplification SPRY2 gene 24h), result shows, the mrna expression level of SPRY2 in FLS cell weakens with the growth of TNF α stimulation time, disclose at FLS and occurred after abnormality proliferation, the expression of SPRY2 gene is lowered, therefore conjecture divides the period of the day from 11 p.m. to 1 a.m when cross expression SPRY2 in FLS, likely can suppress the propagation (Fig. 4) of FLS cell.For verifying this hypothesis, by the external expression SPRY2 molecule of crossing, test by Brdu the cell proliferation situation that detects in FLS cell.Result shows, when without TNF-α incentive condition, when FLS cell normal growth, crosses expression SPRY2 molecule, does not affect the normal growth (Fig. 6 A) of FLS cell; Stimulate at 10ng/mL TNF-α under the condition of FLS abnormality proliferation, compared with matched group, in hFL S, cross the propagation (Fig. 6 B) that expression SPRY2 molecule can significantly suppress the alpha mediated FLS of TNF-(p < 0.05).Therefore, disclose SPRY2 and can effectively suppress to stimulate by TNF-α the FLS abnormal cell proliferation causing, this gene therapy to RA provides new thinking.

In addition, also carried out interior animal experiment, first utilized AIA revulsion successfully to carry out the modeling of rat RA, treatment group is crossed and is expressed the AdSPRY2 recombinant adenovirus of SPRY2 and treat to rat intra-articular injection for the 7th day after modeling.After the measurement result analysis of rat clinical parameter, find, joint index scoring and the ankle joint thickness for the treatment of group are all starkly lower than matched group; Negative control group rat is along with the increase of modeling time, aggravation, thereby body weight increases slowly, and treatment group rat disease is lighter, body weight increases rapidly, and statistical analysis shows, treatment group body weight is apparently higher than matched group, and this mental status of having reacted treatment group rat is good.These results are from the development of the effective inhibition rat kind of clinical observation angle explanation SPRY2 molecular energy rheumatic arthritis.In addition, also can draw this result (Fig. 9) by tissue slice H & E dyeing.The expression of putting to death rat ankle joint proinflammatory cytokine is analyzed, by detecting the expression of pro-inflammatory cytokine IL1 β and TNF-α, as can be seen from the results, in AdSPRY2 treatment group, the expression of pro-inflammatory cytokine IL-1 β, TNF-α is all lower than negative control group, and the expression for the treatment of group IL-1 β is starkly lower than matched group (p < 0.05, Figure 10).Therefore, by In vitro cell experiment and interior animal experiment, we have obtained consistent result, and SPRY2 molecule expression in the human synovial cell of abnormality proliferation reduces, and express but cross the abnormality proliferation that SPRY2 molecule can effectively suppress hFL S cell; Zoopery shows, SPRY2 molecule can effectively suppress the development of the rat RA state of an illness, but this concrete inhibition mechanism also requires further study.This gene therapy that is rheumatoid arthritis provides a new direction.

Adenovirus vector (adenovirus; Ad) having that Genome Size is moderate, host cell scope is wide, safety good, transduction efficiency is high, it is static to infect and the advantage such as the productive rate of the cell of division, recombinant adenovirus is high, scale production process is ripe, better stability of preparation, is one of carrier having in gene therapy bright prospects.

In following embodiment, method therefor is conventional method if no special instructions, concrete steps can be referring to: " Molecular Cloning:A Laboratory Manual " (Sambrook, J., Russell, David W., Molecular Cloning:A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

Described percent concentration is mass/mass (W/W if no special instructions, the g/100g of unit) percent concentration, mass/volume (W/V, the g/100mL of unit) percent concentration or volume/volume (V/V, Unit/mL/100mL) percent concentration.

In embodiment, be described to the approach that obtains of various biomaterials be only to provide approach that a kind of experiment obtains to reach concrete disclosed object, should not become the restriction to biological material source of the present invention.In fact, the source of biomaterial used is widely, any keep on the right side of the law and the moral ethics biomaterial that can obtain can be replaced and use according to the prompting in embodiment.

Embodiment implements under taking technical solution of the present invention as prerequisite, has provided detailed embodiment and concrete operating process, and embodiment will contribute to understand the present invention, but protection scope of the present invention is not limited to following embodiment.

Embodiment 1, SPRY2 vitro inhibition rheumatoid arthritis (Rheumatoid arthritis, RA) become fiber-like synovial cell's (fibroblast-like synoviocytes, FLS) propagation and inflammatory reaction

Rheumatoid arthritis (rheumatoid arthritis, RA) be a kind of chronic autoimmune disease, main infringement movable joint, its pathological characteristics shows as a large amount of inflammatory cell infiltration synovium of joint and produces articular synovitis and may cause articular cartilage and osteoclasia.Become fiber-like synovial cell (fibroblast-like synoviocytes, FLS) be the maximum cell type of quantity in inflammatory synovial tissue, FLS propagation is the main pathological characters of RA, FLS secrete cytokines chemotactic factor adhesion molecule and the protease etc. of hyper-proliferative play a significant role in the pathogenesis of destruction of joint.Under inflammatory condition, FLS has the mad characteristic increasing of cells like tumor cells, thereby promotes synovial tissue's paraplasm, and this is the most important pathological manifestations of RA inflammation.In RA pathogenesis, tumor necrosis factor α (TNF-α) is considered to one of most important proinflammatory cytokine, can promote the abnormality proliferation of the inflammatory cells such as synovial cell, and can participate in the pathological processes such as articular cartilage damage directly.

SPRY2 is a kind of important biomolecule molecule that can oppositely suppress RTK signal path, has important function, thereby become the study hotspot of current cancer immunotherapy in tumor occurs and develops.A large amount of evidences show, SPRY2 molecule is expressed suppressed in kinds of tumor cells, in close relations with tumor cell abnormality proliferation, cross and express the Proliferation and invasion that SPRY2 molecule can inhibition tumor cell.Think at present, SPRY2 suppresses propagation and the development of tumor by lowering RAS/ERK and PI3K/AKT activation signal.And these two paths are the major avenues of approach of FLS propagation and generation inflammatory reaction just, thereby therefore point out this molecule probably to bring into play the development that the inhibitory action of FLS is suppressed to RA.

Experiment material:

1.1 primers, bacterial strain, cell

The services such as the synthetic and gene sequencing of primer complete by calm and peaceful biotech firm of Sino-U.S., are mixed with 20 μ mol/L with sterile purified water, and-20 DEG C save backup; HFL S cell is purchased from cell Application company of the U.S.; PMDl8-simple-T is purchased from the precious biological company limited in Dalian, and carrier for expression of eukaryon pDC315 is purchased from Microbix Biosystems, Inc. company, and pBHGlox (delta) E1,3Cre carrier is purchased from Microbix Biosystems, Inc. company.

1.2 enzyme and reagent

FLS special culture media and serum are purchased from cell Application company of the U.S.; Pancreatin is purchased from sigma company; HumanTNF-α's factor is purchased from Biolegend company; Brdu cell proliferation detecting kit is purchased from Millipore company; CCK-8 cell proliferation/inhibition detection kit purchased from Shanghai with people's chemistry institute; DNase I is century biotech firm purchased from health; The anti-His tag antibody of mice, anti-SPRY2 antibody purchased from Origene company, the anti-β-actin of mice antibody purchased from company of Zhong Shan Golden Bridge; The anti-mice two of rabbit of HRP labelling is anti-purchased from company of Zhong Shan Golden Bridge; Contain the LaemmLi protein electrophoresis buffer of 5% mercaptoethanol purchased from Bio-Rad company; It is ShiJi Co., Ltd purchased from health that ultrapure RNA extracts test kit, and RT-PCR test kit is purchased from Takara company; Restricted enzyme purchased from Biolab company, pcr amplification enzyme and ligase etc. purchased from TaKaRa company; PCR fragment recovery purification kit and plasmid extraction kit are purchased from Beijing Tian Gen Bioisystech Co., Ltd; Other reagent is domestic analytical pure.

1.3 key instrument equipment

GeneAmp PCR System2400PCR amplification instrument (purchased from PE company); High speed tabletop centrifuge (Liuyi Instruments Plant, Beijing); 2500R gel imaging system is purchased from Shanghai Tian Neng Science and Technology Ltd.; Superclean bench (Suzhou good precious cleaning project equipment company limited); EPC3000 constant current constant voltage electrophresis apparatus (Liuyi Instruments Plant, Beijing); GL-21M refrigerated centrifuger is Hunan instrument centrifuge instrument company limited product; The desk-top constant-temperature shaking incubator of THZ-95 type; Electric heating three use water baths (the long wind instrument and meter factory in Beijing); Model680 type microplate reader (BIO-RAD company).DYY-6C type nucleic acid electrophoresis apparatus is purchased from Beijing Liuyi Instrument Factory; Power Pac Basic protein electrophoresis instrument is purchased from Bio-Rad company; 150i constant temperature cell culture incubator comes from Thermo company; DHG-9140A type electric heating constant-temperature blowing drying box is purchased from Shanghai Yi Heng Science and Technology Ltd.; MLS-3780 type autoclave sterilizer is purchased from electrical machinery of Japanese sanyo Co., Ltd.; WFZUV-2800H type ultraviolet-uisible spectrophotometer is purchased from UNICO(Shanghai) Instruments Co., Ltd..

Two, detect the natural expression of SPRY2 molecule in hFL S cell

2.1 reverse transcriptional PCRs (RT-PCR) detect the natural expression of hSPRY2 gene in hFL S cell

2.1.1 extract total RNA of hFL S cell

Get the cell in exponential phase hFL S, with 2 × 10 ⁵individual/hole is inoculated in 6 orifice plates, is placed in 37 DEG C, 5%CO ₂constant incubator cultivate 24h, with health be total RNA that ultrapure RNA of century extracts test kit extraction FLS, concrete steps are as follows:

1) will in every porocyte, add 1mL Buffer RLT, piping and druming several times, makes the abundant cracking of cell repeatedly, and room temperature is placed 5min, and protein nucleic acid complex is separated completely;

2) add the ratio of 200ul chloroform to add chloroform with every 1mL Buffer RLT, build pipe thermal agitation 15 seconds, room temperature is placed 2min;

3) 4 DEG C, the centrifugal 10min of 12000rpm, now sample is divided into three layers: the colourless water in red organic facies, intermediate layer and upper strata, RNA is mainly in the water of upper strata, by upper water phase transfer to new RNase-Free centrifuge tube;

4) in above aqueous phase solution, add isopyknic 70% ethanol (without the water preparation of RNase), put upside down and mix;

5) upper step gained solution is all joined in the adsorption column that has packed collecting pipe into and (if can not once add solution, can be proceeded to several times), centrifugal 20 seconds of 12000rpm, outwells the waste liquid in collecting pipe, and adsorption column is relay and reclaimed in collector;

6) in adsorption column, add 700ul Buffer RW1, centrifugal 20 seconds of 12000rpm, outwells the waste liquid in collecting pipe, and adsorption column is relay and reclaimed in collector;

7) in adsorption column, add 500ul Buffer RW2, centrifugal 20 seconds of 12000rpm, outwells the waste liquid in collecting pipe, and adsorption column is relay and reclaimed in collector;

8) repeating step 7);

9) the centrifugal 2min of 12000rpm, outwells the waste liquid in collecting pipe, and adsorption column is placed in to room temperature number minute, thoroughly to dry;

10) adsorption column is placed in one new for RNase centrifuge tube, add 50 μ lRNase-Free Water to the middle part of adsorption column, room temperature is placed 1min, the centrifugal 1min of 12000rpm collects RNA solution, preserves RNA for-70 DEG C, prevents degraded;

11) RNA extracting is utilized ultraviolet spectrophotometer carry out quantitatively, according to formula RNA concentration (μ g/mL)=OD260 value × extension rate × 40, calculate RNA concentration;

12) utilize DNase I to digest the RNA extracting, pollute to remove the genomic DNA that may exist in total RNA, prepare 10 μ l reaction systems (as shown in table 1), being placed in 37 DEG C of constant incubators placed after 30 minutes, add 1 μ l200mM EDTA to it, hatch 10 minutes for 65 DEG C, make DNase I inactivation, cessation reaction, RNA after treatment can be used for RT-PCR and detects.

Table 1DNase I is processed total RNA system

2.1.2 reverse transcriptional PCR reaction (RT-PCR reaction)

Carry out reverse transcriptional PCR reaction with the RT-PCR test kit of Takara, concrete steps are as follows:

1) first degeneration, the annealing reaction liquid of preparing 10 μ l systems as shown in table 2 in EP pipe;

Table 2 degeneration, annealing reaction liquid system

2) on PCR instrument, carry out degeneration, annealing reaction, reaction condition is: 65 DEG C of 5min;

3) centrifugal 30 seconds of 12000rpm, makes reactant liquor be gathered in EP pipe bottom;

4) in above-mentioned EP pipe, prepare the inverse transcription reaction liquid of 20 μ l systems as shown in table 3;

Table 3 reverse transcription reaction system

On PCR instrument, carry out reverse transcription reaction, reaction condition is: 30 DEG C of 10min, 45 DEG C of 25min, 95 DEG C of 5min, 4 DEG C of interim preservations;

5) PCR reaction: carry out pcr amplification with the Auele Specific Primer of hSPRY2 gene, taking GAPDH gene as internal reference, primer sequence is as follows:

HSPRY2 specific primer sequence:

hSPRY2F：5’-GAGGCCAGAGCTCAGTGGCAAC-3’

hSPRY2R：5’-TGTTGGTTTTTCAAAGTTCCTAGG-3’；

Internal reference GAPDH specific primer sequence:

GAPDH?F：5’-TCCACCACCCTGTTGCTGTA-3’

GAPDH?R：5’-ACCACAGTCCATGCCATCAC-3’；

Prepare the PCR reactant liquor of 50 μ l systems as shown in table 4:

Table 4PCR reaction system

PCR reaction condition: 94 DEG C of denaturation 5min; 94 DEG C of degeneration 30s, 55 DEG C of 30s, 72 DEG C are extended 1min, totally 30 circulations; 72 DEG C are continued to extend 5min, 4 DEG C of short-term preservations.

6) after reaction finishes, RT-PCR amplified production is carried out to 1% agarose gel electrophoresis, judge the expression of RT-PCR product hSPRY2 gene mRNA level according to band brightness power.

As shown in Figure 1, collector FLS cell, extracts total RNA (FLS cell in Figure 1A swimming lane 1,2: two holes to result; M1Marker (5000,3000,2000,1500,800,500,300bp)), carry out RT-PCR amplification with people SPRY2 special primer, obtain the object band of 950bp size, consistent with expection size (948bp), simultaneously with the positive contrast of house-keeping gene GAPDH (the FLS cell in Figure 1B swimming lane 1,2: two holes; M2Marker (2000,1000,750,500,250,100bp)); For further clearly this object band be SPRY2 molecule, reclaimed purification rear clone and entered pMD18-T carrier, recombinant vector is carried out to double digestion qualification (Fig. 1 C swimming lane 3: recombinant vector pMD18-T/hSPRY2 with EcoR I and BamH I; Swimming lane 4: the pMD18-T/hSPRY2 after double digestion; M1Marker (5000,3000,2000,1500,800,500,300bp)), after enzyme action qualification is correct, check order, result shows that the SPRY2 gene order (NM_011897) in this sequence and Genebank data base is in full accord.Above result shows that SPRY2 gene exists natural expression in hFL S cell.

2.2Western Blot detects the natural expression of hSPRY2 gene in hFL S cell

Get the cell in exponential phase hFL S, with 2 × 10 ⁵individual/hole is inoculated in 6 orifice plates, be respectively 0 with MOI, 12.5, 25, 50 recombinant adenovirus Ad5-SPRY2 (construction method is shown in step 4) infect hFL S cell, after 48h, collect FLS cell, be suspended from LaemmLi albumen buffer, boil centrifugal collection supernatant after 5min, carry out quantitatively with BCA protein quantification test kit, 30 μ g total proteins after 100g/L protein electrophoresis electrotransfer to nitrocellulose filter, spend the night with the sealing of 50g/L defatted milk powder, TBST washes the anti-His antibody of mice that adds respectively 1:1000 to dilute after film, the anti-SPRY2 antibody of mice or the anti-β-actin of mice antibody, hatch 1h for 37 DEG C, after washing film, add the anti-mice two of rabbit of HRP labelling to resist (1:2000), room temperature effect 50min, finally develop the color with ECL.

Result is as shown in Fig. 2 (swimming lane 1-4: the MOI of hFL S cell infection recombinant adenovirus Ad5-SPRY2 is respectively 0,12.5,25,50), utilize anti-His tag antibody and anti-SPRY2 antibody SPRY2 destination protein band all clearly to be detected by Western blot method, molecular weight is 36-38kDa, in the same size with expection.Show to exist in FLS the natural expression of SPRY2 molecule, and identified that recombinant adenovirus AdSPRY2 can be at cellular expression simultaneously.

Three, the cell proliferation of SPRY2 gene in FLS cell detects with survival

In RA pathogenesis, tumor necrosis factor α (TNF-α) is considered to one of most important proinflammatory cytokine, can promote the abnormality proliferation of the inflammatory cells such as synovial cell, and can participate in the pathological processes such as articular cartilage damage directly.

When 3.1TNF α irritaiting concentration raises, SPRY2 is in the situation of change of FLS cells level

Stimulate at TNF α the biological action that may bring into play in the process of FLS cell proliferation for observing SPRY2 molecule, 0,1,10ng/mL choose 3 TNF α concentration:, stimulate FLS cell 24 hours, collecting cell, RT-PCR amplification SPRY2 gene, carry out agarose gel electrophoresis and quantitative analysis, concrete grammar comprises the following steps:

1) get the cell in the FLS of exponential phase, with after trypsinization with 1.5 × 10 ⁵/ hole is inoculated in 6 orifice plates, is placed in 37 DEG C, 5%CO ₂constant incubator is cultivated 24h;

0,1,10ng/mL 2) choose 5 TNF α concentration:, stimulate FLS cell 24 hours;

3) collecting cell, extracts cell RNA, and method is shown in step 2;

4) SPRY2 gene is carried out to RT-PCR amplification, taking GAPDH gene as internal reference, method is shown in step 2, but in this process, should be noted and stimulate lower RNA to utilize ultraviolet spectrophotometer to carry out quantitatively the each concentration of extracting, the concentration (0.204ug/ul) after quantitative according to RNA, get 0.5 μ gRNA (2.45ul) sample for every group and carry out reverse transcription, in operating process, the unification of moment guaranteed discharge, in the hope of the final quantitative analysis realizing for object product;

5) finally PCR product is carried out to 1% agarose gel electrophoresis, and result is carried out to quantitative analysis;

6) analyze the result of first electrophoresis, after the brightness of internal reference GAPDH being compared with sky energy analysis software, by the amount of unified internal reference GAPDH, after semi-quantitative analysis, each group adds corresponding amount to re-start agarose gel electrophoresis, observe the brightness power of SPRY2 band under the consistent condition of internal reference GAPDH brightness, stimulate the expression of SPRY2 under FLS cell proliferation condition with this preliminary analysis at variable concentrations TNF-α.

Result as shown in Figure 3, agarose gel electrophoresis and quantitative analysis results show, compared with during with cell normal growth while being 0ng/mL (be TNF-α irritaiting concentration), the mRNA transcriptional level of SPRY2 in FLS cell expressed and reduced with the increase of TNF α concentration, and compared with when in FLS abnormality proliferation situation, SPRY2mRNA transcriptional level is with normal growth, in low expression.

3.2TNF-α stimulates the variation of FLS cell proliferation different time points SPRY2 expression

For further determining that SPRY2 molecule stimulates at TNF α the inhibitory action that may bring into play in the process of FLS cell proliferation, we select 10ng/mL TNF-α to stimulate FLS cell different time points: 0min, 30min, 60min, 4h, 24h, collecting cell, RT-PCR amplification SPRY2 gene, carry out agarose gel electrophoresis and quantitative analysis, concrete grammar comprises the following steps:

2) (TNF-α stimulates respectively FLS cell 0min, 30min, 60min, 4h and 24h to utilize 10ng/mL;

3) collect respectively the FLS cell that stimulates different time points, extract cell RNA, method is shown in step 2;

4) SPRY2 gene is carried out to RT-PCR amplification, taking GAPDH gene as internal reference, method is shown in step 2, but in this process, should be noted and stimulate lower RNA to utilize ultraviolet spectrophotometer to carry out quantitatively the each concentration of extracting, the concentration (0.220ug/ul) after quantitative according to RNA, get 0.5 μ gRNA (2.27ul) sample for every group and carry out reverse transcription reverse transcription, in operating process, the unification of moment guaranteed discharge, in the hope of the final quantitative analysis realizing for object product;

6) analyze the result of first electrophoresis, after the brightness of internal reference GAPDH being compared with sky energy analysis software, by the amount of unified internal reference GAPDH, after semi-quantitative analysis, each group adds corresponding amount to re-start agarose gel electrophoresis, observe the brightness power of SPRY2 band under the consistent condition of internal reference GAPDH brightness, stimulate under FLS cell different time points condition the expression of SPRY2 with this preliminary analysis at TNF-α.

As shown in Figure 4, the expression of SPRY2mRNA in FLS cell weakens with the growth of TNF α stimulation time result, disclosed at FLS and occurred after abnormality proliferation, and the expression of SPRY2 gene is lowered.

Four, cross and express the impact of SPRY2 molecule on FLS cell proliferation

According to above result,, in the time that abnormality proliferation occurs FLS, SPRY2 gene mRNA transcriptional level is lowered and is expressed, and we infer: divide the period of the day from 11 p.m. to 1 a.m when cross expression SPRY2 in FLS, likely can suppress the propagation of FLS cell.For verifying this deduction, we have packed recombinant adenovirus Ad5-SPRY2, by the external expression SPRY2 molecule of crossing in FLS cell, utilize Brdu experiment to detect cell proliferation situation.Stimulating under these two kinds of conditions of FLS abnormality proliferation without TNF-α stimulation and 10ng/mL TNF-α, experiment is divided into three groups: uninfecting virus group, infection recombinant adenovirus Ad5-EGFP group (negative control), infection recombinant adenovirus AdSPRY2 group, viral infection FLS cell 48h, stimulating group is used 10ng/mL TNF-α irritation cell 48h again, finally observe by Brdu cell proliferation experiment the inhibitory action to FLS abnormal cell proliferation that SPRY2 may exist, concrete grammar comprises the following steps:

1) experimental design: stimulating under these two kinds of conditions of 48h without TNF-α stimulation and 10ng/mL TNF-α, experiment is divided into uninfecting virus group, infects recombinant adenovirus AdEGFP group and infects recombinant adenovirus AdSPRY2 group;

2) get the cell in the FLS of exponential phase, with after trypsinization with 2 × 10 ⁴/ hole is inoculated in 96 orifice plates, and every group of 5 repeating holes, are placed in 37 DEG C, 5%CO ²constant incubator is cultivated 24h,

3) the recombinant adenovirus AdSPRY2 and the AdEGFP infection cell 48h that are 100 by viral infection plural number MOI value;

4) adding working concentration to each group of cell under TNF-α incentive condition is the TNF-α of 10ng/mL, irritation cell 48h;

5) finally use Brdu cell proliferation reagent box, detect cell proliferation situation, judge the impact on FLS cell proliferation that SPRY2 may exist.

Wherein, step 1) in the preparation method of recombinant adenovirus Ad5-SPRY2 be: the cDNA (GenBank:AF039843.1 that first chooses encoding human SPRY2 (hSPRY2), its nucleotide sequence is as shown in sequence in sequence table 1), design hSPRY2 Auele Specific Primer, the restriction enzyme site of introducing by pcr amplification genes of interest fragment utilization carries out double digestion, purification is connected in the pDC315 of identical enzyme action processing carrier after reclaiming, be built into carrier pDC315/hSPRY2, and confirm by order-checking; By pDC315-hSPRY2 plasmid and 5 type adenovirus skeleton plasmid pBHGlox (delta) E1,3Cre cotransfection is to HEK293 cell, in HEK293, utilize the effect of Cre/loxP recombinase to realize homologous recombination, be packaged into 5 type adenovirus vector pAd5-hSPRY2, collect and purification of Recombinant adenovirus AdSPRY2, concrete grammar comprises the following steps:

1.1) build recombinant vector pDC315/hSPRY2

1.1.1) pcr amplification of hSPRY2 gene

The cDNA of encoding human SPRY2 (hSPRY2) is purchased from Origene company, and gene order number is NM_005842.Application upstream and downstream primer amplification hSPRY2 gene, in forward primer, underscore part is the EcoR I restriction enzyme site inserting, downstream primer underscore part is BamH I restriction enzyme site, has introduced respectively 6 × His label and Flag label in upstream and downstream primer.

The upstream and downstream primer sequence of pcr amplification hSPRY2 gene is as follows:

hSPRY2F:

5’-CCG GAATTCGCCGCCACCATGCATCACCATCACCATCACGAGGCCAGAGCTCACAGT-3’

hSPRY2R：

5’-CGC GGATCCTTACTTATCGTCGTCATCCTTGTTGTAATCTGTTGGTTTTTCAAGTTCCT-3’。

50 μ l PCR reaction systems are as shown in table 5:

The pcr amplification system of table 5hSPRY2 gene

PCR reaction condition is: 95 DEG C of denaturation 4min; 95 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C are extended 1min, 30 circulations; 72 DEG C are continued to extend 5min;

After PCR reaction finishes, get PCR product 5 μ l and carry out 1.2% agarose DNA gel electrophoretic analysis.

Result is as shown in a width of Fig. 5 (the hSPRY2 gene of swimming lane 1:PCR amplification), taking people SPRY2cDNA as template, obtained the hSPRY2 gene of 1000bp through pcr amplification with special primer, its N end carries Kozak sequence and 6 × His label, C hold with Flag label.

1.1.2) double digestion reaction

The hSPRY2 fragment of pcr amplification and pDC315 carrier are all carried out to double digestion reaction with EcoR I and BamH I, be placed in 37 DEG C of thermostat water bath 2h, enzyme action system is as shown in table 6:

The double digestion system of table 6hSPRY2 fragment and pDC315 carrier

Title	(μ l) for volume
		HSPRY2 fragment/pDC315 carrier	5.0
10×NEBuffer2	1.0
		EcoR?I	1.0
BamH?I	1.0
		ddH ₂O	3.0
Cumulative volume	10.0

1.1.3) recovery of enzyme action product, purification and connection

The EcoR I of hSPRY2 fragment and pDC315 carrier and BamH I double digestion product are carried out to 1% agarose gel electrophoresis, are that ShiJi Co., Ltd's DNA gel recovery test kit carries out retrieve and purification by health.The hSPRY2 fragment of purification is connected in the pDC315 of same enzyme double digestion carrier, obtains recombinant vector pDC315/hSPRY2.The EcoR I of recombinant vector pDC315/hSPRY2 and BamH I double digestion qualification result are as the b width of Fig. 5 (swimming lane 2: through the recombinant vector pDC315/hSPRY2 of EcoR I and BamH I double digestion; Swimming lane 3: recombiant plasmid pDC315/hSPRY2) shown in, result has obtained the hSPRY2 fragment of 1000bp and the carrier segments of 3913bp, and double digestion qualification result has shown to obtain all correct recombinant vector pDC315/hSPRY2 of sequence and on position.

1.2) build recombinant adenoviral vector pAd5-hSPRY2

Subsequently by pDC315-hSPRY2 plasmid and 5 type adenovirus skeleton plasmid pBHGlox (delta) E1,3Cre (its physical map as shown in Figure 5A) cotransfection is to HEK293 cell, in HEK293, utilize the effect of Cre/loxP recombinase to realize homologous recombination, be packaged into restructuring 5 type adenovirus vector pAd5-hSPRY2 (or pAd-hSPRY2).

1.2.1) utilize shuttle plasmid pDC315-hSPRY2 and adenovirus skeleton plasmid pBHGlox (delta) E1,3Cre cotransfection HEK293 cell, in HEK293 cell, homologous recombination produces replication defective sexual gland virus carrier;

1.2.2) select positive colony with PCR method, as c width (swimming lane 4: negative control in Fig. 5; Swimming lane 5: with the hSPRY2 gene of recombinant vector AdSPRY2PCR amplification) shown in, through the positive clone of pcr amplification acquisition 1000bp DNA fragmentation, 5 type adenovirus vector pAd5-hSPRY2 recombinate.

1.3) packaging of recombinant adenoviral vector

1.3.1) large quantity extracting plasmid pAd-SPRY2;

1.3.2) plasmid pAd5-hSPRY2 transfected HEK 293

A large amount of extraction after pAd5-hSPRY2 plasmids, ethanol precipitation reclaims, and linearization plasmid is transfected into HEK293 cell with Lipofectamine2000;

1.3.3) collection virus and purification

In the time there is pathological changes in cell, collecting cell and culture fluid, centrifugal collection supernatant after multigelation cracking, as elementary virus liquid, for a large amount of virus amplification subsequently; Infect a large amount of cells with elementary virus liquid, the complete pathological changes of 46 hour cell, results sick cell and culture fluid, the centrifugal supernatant of abandoning, centrifugal collection recombinant adenovirus AdSPRY2 after multigelation; Again with density－gradient centrifuga－tion method purified virus, with dialysis solution (10mM TrisHCl pH8.0, the 2mMMgCl of 200 times of volumes ₂, 4% sucrose (sucrose)) and obtain the recombinant adenovirus AdSPRY2 solution of purification after dialysing;

1.3.4) virus titer mensuration

Adopt TCID50 method to measure virus titer: HEK293 cell is inoculated in to 96 orifice plates, and every porocyte number is 10000; The inferior daily virus of the DMEM serial dilution containing 5%FBS solution (10 ^-6, 10 ^-7, 10 ^-8, 10 ^-9, 10 ^-10, 10 ^-11, 10 ^-12, 10 ^-13), infection cell, reserved two holes of each dilution factor infection group and viral infection group are not done and are infected as negative control simultaneously, and cell continues to cultivate 10 days; Under the 10th day inverted microscope, observe, calculate the hole count that occurs cytopathic effect (CPE) in each row, calculate according to this recombinant adenovirus titre.The titre of result recombinant adenovirus AdSPRY2 is 1 × 10 ¹¹pFU/mL.With above-mentioned same method obtain can expressing green fluorescent protein gene recombinant adenovirus AdEGFP, titre is 1 × 10 ¹¹pFU/mL.

Brdu cell proliferation reagent box detecting step is as follows:

1) preparation Brdu solution: every 100ul culture medium+20ul Brdu liquid, in every hole, add this mixed liquor of 120ul, be placed in 37 DEG C, 5%CO ₂constant incubator is cultivated 2-24h;

2) next day, inhale and abandon supernatant, in every hole, add 200ul Fixing Solution, room temperature is placed 30min;

3) suck solution, utilize 1 × cleaning mixture to clean cell plates three times, on paper, pat dry;

4) in every hole, add the anti-Brdu antibody that in 100ul test kit, process is diluted, room temperature is placed 1h;

5) utilize 1 × cleaning mixture to clean cell plates three times, on paper, pat dry;

6) add the HRP goat anti-mouse antibody after dilution, every hole 100ul, room temperature is placed 30min;

7) utilize 1 × cleaning mixture to clean cell plates three times, wash plate with distilled water for the last time, on paper, pat dry;

8) in every hole, add 100ul TMB nitrite ion, room temperature lucifuge colour developing 30min (cell is more, and color is more blue);

9) in every hole, add 100ul stop buffer, survey OD450 value by microplate reader immediately.

Cross express the impact of SPRY2 molecule on FLS cell proliferation testing result as shown in Figure 6, when without TNF-α incentive condition, when FLS cell normal growth, cross expression SPRY2 molecule, do not affect the normal growth (A of Fig. 6) of FLS cell; Stimulate at 10ng/mL TNF-α under the condition of FLS abnormality proliferation, compared with matched group, in hFL S, cross the propagation (B of Fig. 6) that expression SPRY2 molecule can significantly suppress the alpha mediated FLS of TNF-(p < 0.05).Therefore, disclose SPRY2 and can effectively suppress to stimulate by TNF-α the FLS abnormal cell proliferation causing, this gene therapy to RA provides new thinking.

Embodiment 2, recombinant adenovirus AdSPRY2 suppress the arthritis of rat adjuvant induction

One, build arthritis (AIA) animal model of rat adjuvant induction

Adjuvant induction arthritis (AIA) is a kind of autoimmunity arthritis, be often used as RA animal model and for RA immunopathogenesis Mechanism Study and anti-inflammatory drug screening.

1, prepare adjuvant

Select through heat-inactivated tubercule bacillus H37Ra bacterial strain (purchased from Difco company), be prepared into the suspension that whole mass concentration is 5mg/mL with mineral oil (purchased from Sigma company), concrete grammar is: take tubercule bacillus H37Ra bacterial strain powder, under aseptic condition, fully grind, until its color is bleached by ash, add mineral oil three times to its point, limit edged continues to grind makes it to become pasty state suspension, draw suspension with glass syringe again, push back and beat, it is fully mixed, obtain adjuvant.

2, set up AIA animal model

Choose 16 of SPF level female Lewis rats in 6 week age, body weight is about 110g, purchased from Beijing Vital River Experimental Animals Technology Co., Ltd. [SCXK (capital) 2012-0001].The centre injection adjuvant at 1-2cm place above Lewis rat root of the tail portion, 110 μ l/ only.Within the 11st day, start to observe rat disease symptom from immunity, record rat body weight, ankle swelling size and joint scoring.Animal feeding and experiment are carried out [SYXK-(army) 2007-004] in the Experimental Animal Center SPF of Military Medical Science Institute level barrier animal facility, experiment is through the examination & verification approval of laboratory animal Ethics Committee of Military Medical Science Institute, meet the Chinese zooperal welfare codes of ethics, and the 3R principle using by laboratory animal gives human care.

As Fig. 7, (a is normal hind leg to result; B and c are the carpal joint of serious rubescent and swelling; D is the rear solid end of serious rubescent and swelling) shown in, be prepared into adjuvant with heat-inactivated tubercule bacillus and mineral oil, root of the tail portion Intradermal single immunization Lewis rat carries out animal model, successfully induce arthritic generation: animal disease is 100%, serious symptom mainly occurs in ankle joint, and disease time after immunity the 11st day mostly, inflammation can occur in extremity, comprises metacarpophalangeal joints, metatarsophalangeal joints, toe/interphalangeal joint, ankle/carpal joint; 17-19 days time, morbidity peaks, after this, forelimb comprises that articulations digitorum manus and carpal redness can have and to a certain degree disappears or disappear completely, serious symptom mainly occurs in hind leg, relate to especially ankle joint of whole pawl, if do not given effective treatment, ankle joint becomes deformity by about the 20th day after immunity, can not bending and walking, and this damage is irreversible.

Two, recombinant adenovirus AdSPRY2 suppresses the arthritis of rat adjuvant induction

1, experimental program

Experiment is divided into negative control group (AIA induction group) and treatment group, every group of 8 Lewis rats, control rats is carried out the preparation of AIA animal model, treatment group is behind a week of rat modeling immunity (the 0th day) (the 7th day), to joint cavity injection recombinant adenovirus AdSPRY2, virus is with PBS dilution, and every side joint virus injection volume is 5 × 10 ¹⁰vg (viral genomes, viral genome), the virus injection total amount of every animal is 1 × 10 ¹¹vg, starts to observe rat disease symptom on the 11st day from immunity, records rat body weight, ankle swelling size and joint scoring.

2, rat AIA clinical indices is observed and is measured

Carrying out joint index scoring for the 1st, 7,11,14,17,21 and 23 days, measure ankle joint thickness and weighing the weight of animals respectively at modeling immunity.The arthritic order of severity can be assessed according to 0-4 point of point system by the swelling degree of observing hind leg and ankle joint: 0, without red and swollen (natural joint); 1, one place, joint or many places redness between toe or toe joint or toe (bone); 2, ankle joint is slightly red and swollen; 3, ankle joint moderate redness, but can bending and walking; 4, ankle joint severe redness, can not bending and walking.Two hind leg scorings of a rat are added, and possible the highest joint index is 8.With electronics vernier caliper measurement ankle joint diameter from inside to outside, as the quantitative target of ankle joint thickness, use electronic scale to weigh rat weight.

Result is as Fig. 8 (A) joint index; B) ankle joint thickness; C) body weight n=8, Data are represented as mean ± SEM.*p<0.05.) shown in, after the measurement result analysis of rat clinical parameter, find, within the 11st day, finish (the 23rd day) to observing from immunity, the ankle joint thickness for the treatment of group and the scoring of joint index are all starkly lower than matched group (p < 0.05, from the 14th day to the 23rd day, Fig. 8 A, 8B); Negative control group rat is along with the increase of modeling time, aggravation, thereby body weight increase slowly, and treatment group rat disease is lighter, and body weight increases rapidly, statistical analysis shows, treatment group body weight is apparently higher than matched group (Fig. 8 C, p < 0.05), and this mental status and weather of having reacted treatment group rat is good, show that inflammation is lighter, relatively little on the impact such as appetite, activity.These results are from the development of the effective inhibition rat kind of clinical observation angle explanation SPRY2 molecular energy rheumatic arthritis.

3, histological observation

Within the 26th day, observe and finish rear execution rat, cut ankle joint, fix with 4% formalin solution, 10%EDTA solution carries out decalcification processing, paraffin embedding, make 5 μ m frozen sections, hematoxylin & Yihong (H & E) dyeing, this part transfers to Xuebang, Beijing company to complete.Carry out respectively histological score (0-3 divides) according to synovial hyperplasia and inflammatory cell infiltration degree: 0, normal; 1, hypertrophy that synovial membrane is slight; Only have a small amount of inflammatory cell to invade profit to articular cavity and synovial membrane 2, synovial membrane moderate hypertrophy also starts to intrude into articular cavity; Moderate inflammatory cell invasion; 3, severe synovial hyperplasia generates with pannus, corrodes to cartilage and bone; Inflammatory cell is extensively invaded profit to articular cavity and synovial membrane.

Ankle joint after separation rat, decalcification is longitudinally cut and is carried out paraffin embedding after processing, making tissue slice, H & E dyeing, micro-Microscopic observation, mainly observes the histology such as synovial hyperplasia and inflammatory cell infiltration performance.Natural joint synovial membrane is smoothly complete, and the clear free from admixture of articular cavity has no synovial tissue's hypertrophy and inflammatory cell infiltration (Fig. 9 a and 9b, a, b) the H & E dyeing of normal ankle joint); And the articulation structure of negative control group is coarse, obviously be damaged, hyperplasia obviously and irregular arrangement, pannus generates in a large number, the synovial cell of a large amount of hypertrophy invades articular cavity makes joint space stenosis little, and corrode articular cartilage and bone, visible massive inflammatory cells infiltrated in the synovial tissue of hypertrophy (Fig. 9 e and 9f, e, f) the H & E dyeing picture of AIA induction arthritis negative control group); Compared with negative control group, the synovial hyperplasia degree of AdSPRY2 treatment group is slighter, only see the inflammatory cell of a small amount of infiltration, the structural integrity of articular cartilage and bone be not damaged (Fig. 9 c and 9d, c, d) the H & E dyeing of Ad5-SPRY2 treatment group rat ankle joint).Above histological observation result shows, AdSPRY2 can effectively suppress rat arthritis.

4, the expression of proinflammatory cytokine detects

4.1 tissue homogenate

4.1.1) prepare clean plate, little shears, pincet, homogenizer, mortar;

4.1.2) put to death rat, cut ankle joint, first cut off the unnecessary fur of joint, tissue with shears, cut clean as far as possible;

4.1.3) prepare lysate: every 490 μ l lysates add 10 μ l protease inhibitor, and each joint adds this cracking mixed liquor of 500 μ l;

4.1.4) contain and get a little liquid nitrogen with container, the ankle joint that multigelation cuts is organized repeatedly, and bone is more easily shredded;

4.1.5) with in the present plate of shears, joint being shredded to (more broken better), then put it into mortar, after continuing to smash to pieces, respectively add above-mentioned cracking mixed liquor 500 μ l to each joint, pour in 5mLEP pipe, utilize homogenizer homogenate, be prepared into tissue homogenate;

4.1.6) tissue homogenate is placed in to 4 DEG C of centrifuges, the centrifugal 10min of 12000rpm;

4.1.7) carefully draw supernatant, subpackage, is placed in 20 DEG C of preservations of ﹣.

4.2ELISA detects expression of proinflammatory cytokines level

The cytokine ELISA test kit for supernatant (being purchased from Xin Bosheng bio tech ltd) of collecting is detected to the expression of proinflammatory cytokine (pro-inflammatory cytokine of detection comprises: human TNF alpha, IL-1 β, IL-6, IFN γ), with standard substance testing result production standard curve, calculate destination protein content in cytokine protein expression concentration or constant weight total protein.

According to test kit description, ELISA detecting step is as follows:

4.2.1) from balance to the sealing bag of room temperature, take out the required lath of test;

4.2.2) blank well adds standard substance and specimen universal diluent, adds the standard substance (100 μ l/ hole) of specimen or variable concentrations in all the other respective aperture, seals reacting hole with shrouding gummed paper, hatches 90 minutes for 36 DEG C;

4.2.3) within 20 minutes in advance, prepare biotinylated antibody working solution: by when time needed amount of test, 30 × concentrated biological elementization antibody dilution is become to 1 × working solution, use on the same day with biotinylated antibody diluent;

4.2.4) wash plate 5 times;

4.2.5) blank well adds biotinylated antibody diluent, and all the other holes add biotinylated antibody working solution (100 μ l/ hole);

4.2.6) seal reacting hole with new shrouding gummed paper, hatch 60min for 36 DEG C;

4.2.7) in advance 20min prepares enzyme in conjunction with working solution: by when time test institute expense, utilize enzyme combination diluent that 30 × concentrated enzyme conjugates is diluted to 1 × working solution, used the same day, and lucifuge room temperature is placed;

4.2.8) wash plate 5 times;

4.2.9) blank well adds enzyme combination diluent, and all the other holes add enzyme conjugates working solution (100 μ l/ hole), seals reacting hole with new shrouding gummed paper, and 36 DEG C of lucifuges are hatched 30min;

4.2.10) open microplate reader power supply, pre-thermal instrument, sets trace routine;

4.2.11) wash plate 5 times;

4.2.12) add chromogenic substrate (TMB) 100 μ l/ holes, 36 DEG C of lucifuges are hatched 15min;

4.2.13) add stop buffer 100 μ l/ holes, after mixing, at once measure OD450 value (in 3 minutes).

Execution rat is got its ankle joint and carries out the expression analysis of proinflammatory cytokine, expression by detecting pro-inflammatory cytokine IL1 β and TNF-α (as shown in figure 10, * P < 0.05), as can be seen from the results, in AdSPRY2 treatment group, the expression of pro-inflammatory cytokine IL-1 β, TNF-α is all lower than negative control group, and the expression for the treatment of group IL-1 β is starkly lower than matched group (p < 0.05), illustrate that SPRY2 molecule can suppress the development of rheumatoid arthritis feelings in vivo.

Therefore, by In vitro cell experiment and interior animal experiment, we have obtained consistent result, and SPRY2 molecule expression in the human synovial cell of abnormality proliferation reduces, and express but cross the abnormality proliferation that SPRY2 molecule can effectively suppress hFL S cell; Zoopery shows, SPRY2 molecule can effectively suppress the development of the rat RA state of an illness, but this concrete inhibition mechanism also requires further study.This gene therapy that is rheumatoid arthritis provides a new direction.

List of references

[1]Oslen?NJ，Stein?CM.New?drugs?for?rheumatoid?arthritis[J].N?Engl?J?Med，2004，350(21):2167－2179.

[2]Park?KS，Park?MJ，Cho?MJ，et?al.Type?II?collagen?oral?tolerance；mechanism?and?role?in?collagen-induced?arthritis?and?rheumatoid?arthritis[J].Mod?Rheumatol，2009，19(6):581－589.

[3]Van?Eden?W，Waksman?BH.Immune?regulation?in?adjuvant-induced?arthritis:possible?implications?for?innovative?therapeutic?strategies?in?arthritis[J].Arthritis?Rheum，2003，48(7):1788－1796.

[4]Harris?ED?Jr.Rhrumatoid?arthritis:pathophysiology?and?implications?for?therapy[J].N?Engl?J?Med，1990，322(18):1277－1289.

[5]Firestein?GS.Invasive?fibroblast-like?synoviocytes?in?rheumatoid?arthritis.Passive?responders?or?transformed?aggressors？[J].Arthritis?rheum，1996，39(11):1781－1790.

[6]Ryan?L，Brooks?P.Disease?modifying?antirheumatic?drugs.Curr?Opin?Rheuma，?1999，11:161-166.

[7]Goekoop?YP,Allaart?CF，Breedveld?FC，et?al.Combination?therapy?in?rheumatoid?arthritis.Curr?Opin?Rheumatol，2001，13:177-183.

[8]Landewe?RBM,Boers?M,Verhoeven?AC,et?al.COBRA?combination?therapy?in?patients?with?early?rheumatoid?arthritis?long?term?structural?benefits?of?a?brief?intervention.Arthritis?Rheum,2002,46:347-356

[9]George?JA.Gene?therapy?progress?and?prospects:adenoviral?vectors[J].Gene?Ther,2003,10(6):1135-1141.

[10]Mukherjee?P,Yang?SY,Wu?B,et?al.Tumour?necros?is?factor?receptor?gene?therapy?affects?cellular?immune?responses?in?collagen?induced?arthritis?in?mice.Ann?Rheum?Dis2005；64:1550-1556

[11]Ghivizzani?SC,Oligino?TJ,Glorioso?JC,et?al.Direct?gene?delivery?strategies?for?the?treatment?of?rheumatoid?arthritis.DDT2001；6(5):259-267

[12]Evans?CH,Ghivizzani?SC,Oligino?TA,et?al.Future?of?adenoviruses?in?the?gene?therapy?of?arthritis.Arthritis?Res2001；3(3):142-146

[13]Selvarangan?P,Gandham?M,Sanjay?K,et?al.Adeno-associated?virus2-mediated?antiangiogenic?Cancer?gene?therapy:long-term?efficacy?of?a?vector?encoding?angiostatin?and?endostatin?over?vectors?encoding?a?single?factor.Cancer?Res2004；64:1781-1787

[14]Hacohen?N,Kramer?S,Sutherland?D,et?al.sprouty?encodes?a?novel?antagonist?of?FGF?signaling?that?patterns?apical?branching?of?the?Drosophila?airways[J].Cell,1998,92(2):253-263.

[15]Casci?T,Vinós?J,Freeman?M.Sprouty,an?intracellular?inhibitor?of?Ras?signaling[J].Cell,1999,96(5):655-665.

[16]Guy?G?R,Wong?ES,Yusoff?P,et?al.Sprouty:how?does?the?branch?managerwork？[J].J?Cel?l?Sc,i2003,116(Pt15):3061-3068.

[17]Tefft?D,LeeM,Smith?S,et?al.mSprouty2inhibits?FG?F10-activated?MAP?kinase?by?differentially?binding?to?up?stream?target?proteins[J].Am?J?Physio?l?Lung?Cel?l?Mol?Phys?iol,2002,283(4):700-706.

[18]Lin?J,Yusoff?P,Wong?E?S,et?al.The?cysteine-rich?sprouty?translocation?domain?targets?mitogen-activated?protein?kinase?inhib-itory?proteins?to?phosphatidylinositol4,5-b?isphosphate?in?plasma-embranes[J].Mol?Cell?Biol,2002,22(22):7953-7966.

[19]Guy?GR,Jackson?RA,Yusoff?P,et?al.Sprouty?proteins:modified?modulators,matchm-akers?or?missing?links.Endocrinol,2009,203:191-202.

[20]Felfly?H,Klein?OD.Sprouty?genes?regulate?proliferation?and?survival?of?human?embryonic?stem?cells[J].Sci?Rep,2013,3:2277.

[21]Lao?DH,Chandramouli?S,Yusoff?P,et?al.A?Srchomology3-binding?sequence?on?the?Cterminus?of?Sprouty2is?necessary?for?inhibition?of?the?Ras/ERK?pathway?downstream?of?fibroblast?growth?factor?receptor?stimulat?ion[J].J?Biol?Chem,2006,281(40):29993-30000.

[22]Martinez?N,Gareia?Domingnez?CA,Damingo?B,et?al.Sprouty2binds?Grb2at?two?different?proline-rich?regions,and?the?mechanism?of?ERK?inhibition?is?independent?of?this?interaction.Cell?Signal,2007,19:2277-2285.

[23]Greenhalgh?CJ,Miller?ME,Hilton?DJ,Lund?PK.Suppressors?of?cytokine?signaling:Relevance?to?gastrointestinal?function?and?disease.Gastroenterology.2002；123(6):2064-2081.

[24]C?Zhang,D?Chaturvedi,L?Jaggar,D?Magnuson,JM?Lee,TB?Patel.Regulation?of?vascular?smooth?muscle?cell?proliferation?and?migration?by?human?sprouty2,Arterioscler.Thromb.Vasc.Biol.2005；25(21)；533–538.

[25]T.Casci,J.Vinos,M.Freeman,Sprouty,an?intracellular?inhibitor?of?Ras?signaling,Cell；1999；96(5)；655–665.

[26]G.Minowada,L.A.Jarvis,C.L.Chi,A.Neubuser,X.Sun,N.Hacohen,Krasnow?MA,Martin?GR.Vertebrate?Sprouty?genes?are?induced?by?FGF?signaling?and?can?cause?chondrodysplasia?when?overexpressed,Development,1999；126(20):4465–4475.

[27]Lo?TL,Yusoff?P,Fong?CW,Guo?K,McCaw?BJ,Phillips?WA,Yang?H,Wong?ES,Leong?HF,Zeng?Q,Putti?TC,Guy?GR.The?ras/mitogen-activated?protein?kinase?pathway?inhibitor?and?likely?tumor?suppressor?proteins,sprouty1and?sprouty2are?deregulated?in?breast?cancer.Cancer?Res.2004；64(17):6127–6136.

[28]K?Ozaki,R?Kadomoto,K?Asato,S?Tanimura,N?Itoh,M?Kohno.ERK?pathway?positively?regulates?the?expression?of?Sprouty?genes,Biochem.Biophys.Res.Commun.2001；285(34)1084–1088.

[29]Sasaki?A,Taketomi?T,Kato?R,Saeki?K,Nonami?A,Sasaki?M,Kuriyama?M,?Saito?N,Shibuya?M,Yoshimura?A.Mammalian?Sprouty4suppresses?Rasindependent?ERK?activation?by?binding?to?Raf1,Nat.Cell?Biol.2003；5(3)427–432.

[30]M.A.Impagnatiello,S.Weitzer,G.Gannon,A.Compagni,M.Cotton,G.Christofori,Mammalian?sprouty-1and-2are?membrane-anchored?phosphoprotein?inhibitors?of?growth?factor?signalling?in?endothelial?cells,J.Cell?Biol.2001；152(17)1087–1098.

[31]Lee?CC,Putnam?AJ,Miranti?CK,Gustafson?M,Wang?LM,Vande?Woude?GF,Gao?CF.Overexpression?of?sprouty2inhibits?HGF/SF-mediated?cell?growth,invasion,migration,and?cytokinesis,Oncogene2004；23(12)5193–5202.

[32]Tsavachidou?D,Coleman?ML,Athanasiadis?G.SPRY2is?an?inhibitor?of?the?ras/extracellular?signal-regulated?kinase?pathway?in?melanocytes?and?melanoma?cells?with?wild-type?BRAF?but?not?with?the?V599E?mutant.Cancer?Res.2004；64:5556-5559

[33]Sutterlüty?H,Mayer?CE,Setinek?U,Attems?J,Ovtcharov?S,Mikula?M,Mikulits?W,Micksche?M,Berger?W.Down-regulation?of?Sprouty2in?non-small?cell?lung?cancer?contributes?to?tumor?malignancy?via?extracellular?signal-regulated?kinase?pathway-dependent?and–independent?mechanisms.Mol?Cancer?Res.2007；5(5):509-520.

[34]M.A.Cabrita,F.? ,S.P.Widjaja,G.Christofori,A?functional?interaction?between?sprouty?proteins?and?caveolin-1,J.Biol.Chem.2006；281:29201-29212.

[35]B.Kwabi-Addo,J.Wang,H.Erdem,A.Vaid,P.Castro,G.Ayala.The?expression?of?Sprouty2,an?inhibitor?of?fibroblast?growth?factor?signal?transduction,is?decreased?in?human?prostate?cancer,Cancer?Res.2004(21):4728–4735.

[36]McKie?AB,Douglas?DA,Olijslagers?S,Graham?J,Omar?MM,Heer?R,Gnanapragasam?VJ,Robson?CN,Leung?HY.Epigenetic?inactivation?of?the?human?sprouty2(hSPRY2)homologue?in?prostate?cancer,Oncogene.2005；24(14):2166–2174.

[37]Fong?CW,Chua?MS,McKie?AB,Ling?SH,Mason?V,Li?R,Yusoff?P,LoTL,Leung?HY,So?SK,Guy?GR.Sprouty2,an?inhibitor?of?mitogen-activated?protein?kinase?signaling,is?down-regulated?in?hepatocellular?carcinoma.Cancer Res.2006；66(4):2048-2058.

[38]Miyoshi?K,Wakioka?T,Nishinakamura?H,Kamio?M,Yang?L,Inoue?M,Hasegawa?M,Yonemitsu?Y,Komiya?S,Yoshimura?A.The?Sprouty-related?protein,Spred,inhibits?cell?motility,metastasis,and?Rho-mediated?actin?reorganization,Oncogene.2004；23(17):5567–5576.

[39]Patel?R,Gao?M,Ahmad?I,et?al.Sprouty2,PTEN,and?PP2A?interact?to?regulate?prostate?cancer?progression[J].J?Clin?Invest,2013,123(3):1157-1175.

[40]Moghaddam?SM,Amini?A,Wei?AQ,et?al.Initial?report?on?differential?expression?of?sprouty?proteins1and2in?human?epithelial?ovarian?cancer?cell?lines[J].J?Oncol,2012,2012:373826.

[41]Song?K,Gao?Q,Zhou?J,et?al.Prognostic?significance?and?clinical?relevance?of?Sprouty2protein?expression?in?human?hepatocellular?carcinoma[J].Hepatobiliary?Pancreat?Dis?Int,2012,11(2):177-184.

[42]Schutzman?JL,Martin?GR.Sprouty?genes?function?in?suppression?of?prostate?tumorigenesis[J].Proc?Natl?Acad?Sci?USA,2012,109(49):20023-20028.

[43]Edwin?F,Singh?R,Endersby?R,et?al.The?tumor?suppressor?PTEN?is?necessary?for?human?Sprouty2-mediated?inhibition?of?cell?proliferation[J].J?Biol?Chem,2006,281(8):4816-4822。

Claims

1. cross the recombinant adenoviral vector of expressing SPRY2 in the application of preparing in prevention and treatment rheumatoid arthritis (RA) medicine.

2. application according to claim 1, is characterized in that: with adenovirus vector, for the carrier that sets out imports, SPRY2 is gene constructed to be obtained the recombinant adenoviral vector that described mistake is expressed SPRY2, called after pAd5-hSPRY2.

3. application according to claim 2, is characterized in that: cross the construction method of the recombinant adenoviral vector pAd5-hSPRY2 that expresses SPRY2, can comprise the following steps:

4) pDC315-hSPRY2 plasmid and 5 type adenovirus skeleton plasmid pBHGlox (delta) E1,3Cre cotransfection is to HEK293 cell, in HEK293, utilize the effect of Cre/loxP recombinase to realize homologous recombination, be packaged into 5 type adenovirus vector pAd5-hSPRY2.

4. mistake is expressed a recombinant adenovirus of SPRY2, is in human embryo kidney 293 cells (HEK293) cell, to carry out recombinant adenovirus packaging and a large amount of amplification purification and obtain crossing the recombinant adenoviral vector pAd5-hSPRY2 that expresses SPRY2 described in claim 2 or 3.

5. described in claim 4, cross the recombinant adenovirus of expressing SPRY2 in the application of preparing in prevention and treatment rheumatoid arthritis (RA) medicine.