CN104099356B - A kind of high expressed amount lipase gene obtained by molecular modification propetide and application thereof - Google Patents
A kind of high expressed amount lipase gene obtained by molecular modification propetide and application thereof Download PDFInfo
- Publication number
- CN104099356B CN104099356B CN201410280742.4A CN201410280742A CN104099356B CN 104099356 B CN104099356 B CN 104099356B CN 201410280742 A CN201410280742 A CN 201410280742A CN 104099356 B CN104099356 B CN 104099356B
- Authority
- CN
- China
- Prior art keywords
- lipase
- gene
- expression
- expression vector
- lipase gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention is a kind of high expressed amount lipase gene obtained by molecular modification propetide and application thereof, discloses the lipase gene of a kind of high expressed amount, its DNA sequence following 1) or 2) shown in；1) DNA sequence is nucleotide sequence shown in SEQ ID NO:2；2) the DNA sequence hybridization limited with (1) under strict conditions and coding have the protein DNA molecule of lipase active.Lipase gene after the truncate that the present invention specifically provides, the relatively parent's rhizopus chinensis lipase of the expression in pichia pastoris phaff is improved, and after expressing, is remarkably improved space-time yield.
Description
Technical field
The present invention relates to a kind of lipase gene, the lipase gene of a kind of high expressed amount, pass through molecular biosciences
Learn a skill and lipase gene sequence is carried out transformation acquisition, to realize lipase gene high efficient expression in pichia pastoris phaff
Method.
Background technology
Lipase (EC3.1.1.3) can not only catalyzing oil hydrolysis, also can be catalyzed in nonaqueous phase Lipase absobed, transesterification,
Acidolysis etc. are reacted, and are widely used in chemistry, food, pharmacy and detergent or bioenergy industry.Microorganism is industry
One important sources of lipase, and rhizopus is the important production bacterium of microbial lipase.Nowadays, more than 30 kinds of rhizopus
Lipase achieves merchandized handling.
On lipase reagent market, the volume of industrial production of lipase is directly connected to the market competitiveness.Improve host thin
In born of the same parents, the approach of external source gene expression amount mainly has two kinds, Host Strains aspect: by the fermentation optimization of Host Strains, superior strain
The structures of mutagenesis screening and Deficient In Extracellular Proteases expression strain etc. improve bacterial strain for the expression of foreign protein and secretion；External source base
Because of aspect: by the selection of promoter, the side such as control of codon optimized, the structure of fusion gene, orthogenesis, gene dosage
Method improves expression and secretion level (the Shu Zheng-Yu et al.J Mol Catal B:Enzym2010,62 of exogenous gene
(1):1-8)。
A lot of protein are to synthesize with the form of precursor in vivo, and propetide is one section of peptide chain of protein N terminal, it is possible to auxiliary
Helping folding and the processing of albumen, after protein folding maturation, propetide is then by corresponding protease identification, excision.The merit of propetide
Can be broadly divided into two classes, I class is primarily involved in the extension of polypeptide chain and correct folding, such as subtilin (Subtilisin), α water
Proteolytic enzyme (α Lytic protease) etc.；The function of II class is primarily involved in albumen in the transhipment of intracellular and location, the most directly
Connect the folding participating in protein, such as Somat II (somatostatin II), verdoperoxidase
(myeloperoxidase) etc., propetide contains the information of protein sorting, the correct secretion of pilot protein matter.It addition,
Propetide suffers from impact to aspects such as the stability of mature protein, substrate selectives.Document is had to report, by 1,3-1,4-β-D-
After the peptide chain C end truncate of glucanase, its Rate activity improve 4-5 times (Wen Tuan-Nan et al.Biochemistry,
2005.44(25):9197-9205.).But by truncate 5 ' end group because improving the expression of lipase, the most then without report.
Inventor's success in early-stage Study screens a plant height yielding lipase from the distillers yeast of brewing aroma type yeast wine
Rhizopus chinensis (Rhizopus chinensis) CCTCC M201021 bacterial strain, and from this bacterial strain first clone obtain lipase
Gene order, it is achieved that this lipase high-level secretory expression (Yu in pichia pastoris phaff (Pichia pastoris)
Xiao-Wei et al.J Mol Catal B:Enzym, 2009,57:304-311), and by building constitutive expression matter
Grain, it is achieved that this lipase is at the constitutive and secretive expression of pichia pastoris phaff.The present invention with rhizopus chinensis lipase gene is
Template, utilizes Protocols in Molecular Biology to carry out propeptide sequence shearing modification, it is thus achieved that the lipase gene that expression improves.
Definition:
Aminoacid and the nomenclature of DNA nucleotide sequence
Use the generally acknowledged IUPAC nomenclature of amino acid residue, use three-letter codes form.DNA nucleotide sequence uses generally acknowledges
IUPAC nomenclature.
The name of lipase gene
Parent lipase's unnamed gene is proRCLC, and the lipase gene after 5 ' end propeptide sequence truncates is respectively DFQ,
TTG, NKS, DTE, mRCLC.
Summary of the invention
It is an object of the invention to provide the lipase gene of a kind of high expressed amount, its DNA sequence following 1) or 2) institute
Show；
1) DNA sequence is nucleotide sequence shown in SEQ ID NO:2；
2) the DNA sequence hybridization limited with (1) under strict conditions and coding have the protein DNA of lipase active
Molecule.
The lipase gene of described high expressed amount is by truncate parent lipase propetide gene order step by step, thus obtains
The lipase gene sequence that in Pichia sp., expression improves.
Expression vector containing lipase gene described in claim 1 is also the scope of protection of present invention.
The preferred excretion vector of described expression vector.
Transgenic cell line/genetic engineering bacterium containing described lipase gene and/or expression vector is also wanted for the present invention
Seek the scope of protection.
Described lipase gene or expression vector application in enzyme preparation produces fall within protection scope of the present invention.
Technical scheme:
Rhizopus chinensis lipase parental gene sequence is SEQ ID NO:1.
The truncated gene that lipase expression improves, it is characterised in that to coding parent rhizopus chinensis (Rhizopus
Chinensis) the N end propeptide sequence on the gene (SEQ ID NO:1) of CCTCC M201021 lipase carries out Partial Shear,
Obtain the truncated gene DFQ (SEQ ID NO:2) that expression improves.
SEQ ID NO:1
Rhizopus chinensis (Rhizopus chinensis) CCTCC M201021 lipase parental gene sequence
SEQ ID NO:2
Rhizopus chinensis (Rhizopus chinensis) the CCTCC M201021 lipase gene sequence of propeptide sequence truncate
DFQ
A kind of method that the invention also discloses high efficient expression lipase, step by step peptide gene sequence before truncate parent lipase
Row, after being cloned into expression vector, convert host and express.
It is pGAPKW for expressing the expression vector of described lipase, needed for construction expression plasmid pGAPKW-proRCLC
Plasmid be pGAPK-proRCL (Zhu Shanshan etc. Pichia sp. constitutive expression lipase and high-throughput screening method thereof. microorganism
Learn and circulate a notice of, 2012.39 (6): 873-881.) and pPIC9K-proRCL (Yu Xiao-Wei et al.J Mol Catal B:
Enzym,2009,57:304-311)。
The microbial host cell converted for described expression vector is pichia pastoris phaff.
Beneficial effects of the present invention: use the N end on molecular biology method rizolipase to China parental gene to carry out
Partial Shear, improves rhizopus chinensis lipase expression in pichia pastoris phaff.
Accompanying drawing explanation
In order to describe the result of the present invention in detail, using corresponding accompanying drawing as reference:
Fig. 1 pichia pastoris phaff expression plasmid pGAPKW-proRCLC is as shown in the figure.
The extracellular enzyme of Fig. 2 lipase curve alive.
Fig. 3 SDS-PAGE electrophoresis detection lipase expression, the band of 37KD size is target enzyme albumen, band 1 to
The expression plasmid of 7 correspondences is followed successively by: pGAPKW-proRCLC, pGAPKW-DFQ, pGAPKW-TTG, pGAPKW-NKS, pGAPKW-
DTE、pGAPKW-mRCLC、pGAPKW。
Detailed description of the invention
The culture medium and the agent prescription that relate in embodiment are as follows:
10 × YNB mother solution (w/v): YNB (without aminoacid, without ammonium sulfate) 13.4%, filtration sterilization, 4 DEG C of preservations；
LB fluid medium (w/v): Trypton 1%, Yeast Extract 0.5%, NaCl 1%, pH7.0,
LB solid medium (w/v): Trypton 1%, Yeast Extract 0.5%, NaCl 1%, pH7.0,
Agar2%, ampicillin 50mg mL-1, pH7.0；
YPD culture medium (w/v): Yeast Extract 1%, Trypton 2%, Dextrose 2%.If making flat board,
The most separately add Agar 2%.
MD solid medium (w/v): Dextrose 2%, 1 × YNB, Agar 2%.Add during for screening G418 resistance
G418 to final concentration of 0.25mg mL-1, i.e. YPD-G418 flat board.
The parental gene constitutive expression plasmid of embodiment 1:PCR method construction expression lipase.
(1) acquisition of constitutive promoter pGAP: with plasmid pGAPK-proRCL (Zhu Shanshan etc. Pichia sp. composing type
Express lipase and high-throughput screening method thereof. microbiology is circulated a notice of, and 2012.39 (6): 873-881.) it is template, BF/BWR is
Primer PCR amplifies pGAP and S fragment (pGAP-S), and this fragment does not contains BglII restriction enzyme site, and BamHI enzyme action position is contained in upstream
Point, SnaBI restriction enzyme site is contained in downstream.Primer BF and BWR sequence are as follows:
BF:5 '-CGGATCCGATCTTTTTTGTAGAAATGTCTTGGTGTCC-3 ' (underscore is BamHI restriction enzyme site)
BWR:5 '-TTACGTA(underscore is SnaBI enzyme action position to AGCTTCAGCCTCTCTTTTCTCGAGAGATACC3 '
Point)
(2) acquisition of lipase gene: with plasmid pPIC9K-proRCL (Yu Xiao-Wei et al.J Mol Catal
B:Enzym, 2009,57:304-311) it is template, 50bpFNEW/ProRCLCR is that primer PCR amplifies genes of interest fragment
ProRCLC, this upstream region of gene contains SnaBI restriction enzyme site, and His label and NotI site are contained in downstream.
Primer and sequence are as follows:
50bpFNEW:5'-AAAGAAGAAGGGGTATCTCTC-3'
ProRCLCR:5'AATTCCAGTGCGGCCGCTTA
AGAAGAACCCAAACAGCTTCCTTCGTTAATACC (underscore is NotI restriction enzyme site, and thickened portion is His label)
(3) structure of constitutive expression plasmid: BamHI and SnaBI double digestion fragment pGAP-S, the double enzyme of SnaBI and NotI
Cut gene proRCLC, BamHI and NotI double digestion carrier pGAPK-proRCL and reclaim large fragment, connecting above-mentioned 3 fragment structures
Build up expression plasmid pGAPKW-proRCLC.
(4) structure of blank carrier pGAPKW: contain an EcoRI site in proRCLC upstream and gene respectively,
Plasmid pGAPK-proRCL EcoRI is carried out enzyme action, after connecting, constitutes pGAPKW.
The constitutive expression plasmid of embodiment 2:PCR method construction expression truncate lipase gene.
Express the plasmid pGAPKW-proRCLC of parent lipase's gene as shown in Figure 1.Peptide gene before rhizopus chinensis lipase
94 aminoacid sequences of sequential coding.Structure prediction shows that aminoacid D17 position to E35 position is αhelix, and this structure may
Propetide is played molecular chaperone function there is important function, clip 16 aminoacid (DFQ) of N end and investigate front 16 aminoacid to front
The impact of peptide function；Clip 36 aminoacid (TTG) of N end and investigate the αhelix impact on propetide function；Amino acid N 48
It is one of prediction glycosylation site on propetide, clips 47 aminoacid (NKS) of N end and investigate this site shadow to propetide function
Ring；K66R67 is Kex2 protease cutting site, clips what 67 aminoacid (DTE) investigations of N end were cut off by host cell processing
The impact on propetide function of 67 amino acid chains；Clip propetide (mRCLC) completely and then investigate the effect of whole section of propetide.
With pGAPKW-proRCLC as template, according to the different parts of propeptide sequence on proRCLC gene, design 5 on
Trip primer (underscore is SnaBI restriction enzyme site) and 1 downstream primer.
DFQ F:5 '-CATATGTACGTAGACTTCCAACTCCCTCCTCT-3′
TTG F:5 '-CATATGTACGTAACCACAGGTGATCCCGATG-3′
NKS F:5 '-CATATGTACGTAAACAAGAGCGTTCAATGGTAC-3′
DTE F:5 '-CATATGTACGTAGATACTGAAACCGTCGG-3′
MRCLC F:5 '-CATATGTACGTATCTGATTCAGGTGAAGTTGTC-3′
50bpRNEW:5 '-CCCAACTTGAACTGAGGAAC-3 '
With DFQ F and 50bpRNEW as pair of primers, PCR amplifies the lipase gene fragment after propeptide sequence truncate
DFQ。
Fragment DFQ PCR system
The PCR amplification program of fragment DFQ: 98 DEG C of 1min；98 DEG C of 10s, 55 DEG C of 15s, 72 DEG C of 90min, totally 30 are followed
Ring；72 DEG C extend 10min.
By identical PCR condition, respectively with primer TTG F/50bpRNEW, NKS F/50bpRNEW, DTE F/
50bpRNEW, MRCLC F/50bpRNEW, amplifies lipase gene fragment TTG of different truncate propeptide sequence respectively, NKS,
DTE, mRCLC.
By DFQ, TTG, NKS, DTE, mRCLC fragment is connected to pMD19-T simple carrier, with limiting after sequence verification
Property restriction endonuclease BamHI, SnaBI enzyme action, glue reclaim genetic fragment；The same terms enzyme action pGAPKW-proRCLC, reclaims carrier-pellet
Section, is connected with said gene fragment, constitutes the lipase expression plasmid pGAPKW-proRCLC of different truncate propeptide sequence,
PGAPKW-DFQ, pGAPKW-TTG, pGAPKW-NKS, pGAPKW-DTE, pGAPKW-mRCLC.
Embodiment 3: express the structure of the pichia pastoris phaff genetic engineering bacterium of lipase
By expression plasmid pGAPKW-proRCLC, pGAPKW-DFQ, pGAPKW-TTG, pGAPKW-NKS, pGAPKW-DTE,
PGAPKW-mRCLC and pGAPKW converts E. coli competent, cultivates positive colony, extract in positive colony in LB culture medium
Plasmid, through restricted enzyme BglII enzyme action, reclaim test kit with glue and reclaim large fragment linearization plasmid.Electricity converts GS115
MD is coated (containing 0.25mg mL after competence-1G418) flat board, cultivates 3d for 30 DEG C.Choose monoclonal and be inoculated in YPD test tube, cultivate
16h, extracts genome, and PCR carries out positive transformant qualification.
Embodiment 4: the qualification of expression strain lipase gene copy number
Extracting expression strain genome, fluorescence quantitative PCR detection result shows, each expression strain lipase gene copy number
It is a copy.
Embodiment 5: the enzyme activity determination of lipase
The assay method of lipase activity is pNPP method (Pencreach G et al.Enzyme and Microbial
Technol.1996,18:417-422.).The definition that enzyme is lived is pH8.0, reacts generation 1 μm ol p-nitrophenyl per minute at 40 DEG C
The enzyme amount of phenol is lipase hydrolysis enzyme iu alive.
Embodiment 6: the shake flask fermentation of lipase expression strain
Recombinant bacterial strain is seeded in 4mL YPD test tube, 30 DEG C of 200r min-1Shaken cultivation 12h, draws 1mL bacterium and turns
It is connected in 100mL YPD culture medium, 30 DEG C of 200r min-1Shake-flask culture.
Embodiment 7: the expression identification of lipase
Measure the enzyme activity of the fermented supernatant fluid of different fermentations time, as in figure 2 it is shown, expressed truncate fat when the 5th day
The enzyme activity of enzyme gene DFQ reaches the highest (4870U gDCW -1), secondly it is the enzyme activity of parent lipase's gene expression
(4300U·gDCW -1), expression efficiency significantly improves.And when second day, expressed the enzyme activity of truncate lipase gene DFQ
Through having reached 4000U gDCW -1, far above enzyme activity (the 2600U g of parent lipase's gene expressionDCW -1), space-time yield is bright
Aobvious raising.
Take the shake flask fermentation supernatant of the 4th day and carry out SDS-PAGE detection.SDS-PAGE analyze: the preparation of albumin glue and
Electrophoresis method reference " protein techniques handbook " (Wang Jiazheng etc. DNA techniques handbook. Beijing: Science Press, 2000:77-
91.), concentrate glue and resolving gel concentration is respectively 5% and 12%.
As it is shown on figure 3, converted plasmid pGAPKW-proRCLC, pGAPKW-DFQ, pGAPKW-TTG, pGAPKW-NKS
Pichia yeast genetic engineering bacteria can secreting, expressing lipase, in SDS-PAGE, the lipase of the expression of arrow indication is front peptiolipid
Product after fat cleavage, molecular size range is about 37KD, and converted plasmid pGAPKW-DTE, pGAPKW-mRCLC,
The pichia yeast genetic engineering bacteria of pGAPKW can not secreting, expressing lipase.From SDS-PAGE, protein band can be seen that table
The extracellular lipase protein content reaching truncate lipase gene DFQ is the highest, and enzyme is lived the highest corresponding therewith.
Finally, it remain to be noted that, it is above-mentioned that enumerate is only several embodiments of the present invention.Obviously, the present invention is not
It is limited to above example.
Claims (9)
1. a lipase gene for high expressed amount, its DNA sequence is nucleotide sequence shown in SEQ ID NO:2.
2. the preparation method of the lipase gene of the high expressed amount described in claim 1, it is characterised in that truncate parent lipase
Propetide gene order is classified as the gene order shown in SEQ ID NO:2 to obtaining nucleotides sequence, thus obtains in Pichia sp.
The lipase gene sequence that expression improves.
3. contain the expression vector of lipase gene described in claim 1.
Expression vector the most according to claim 3, it is characterised in that described expression vector is excretion vector.
5. contain the transgenic cell line of expression vector described in lipase gene described in claim 1 or claim 3.
6. contain the genetic engineering bacterium of expression vector described in lipase gene described in claim 1 or claim 3.
7. the application in enzyme preparation produces of the expression vector described in lipase gene described in claim 1 or claim 3.
8. the method improving lipase expression, it is characterised in that truncate parent lipase propetide gene order step by step, directly
It is classified as the gene order shown in SEQ ID NO:2 to obtaining nucleotides sequence, after being then cloned into expression vector, converts host
Express.
9. the method described in claim 8, it is characterised in that described expression vector is secreted expression carrier, the preferred Bath of host
Moral Pichia sp..
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410280742.4A CN104099356B (en) | 2014-06-20 | 2014-06-20 | A kind of high expressed amount lipase gene obtained by molecular modification propetide and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410280742.4A CN104099356B (en) | 2014-06-20 | 2014-06-20 | A kind of high expressed amount lipase gene obtained by molecular modification propetide and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104099356A CN104099356A (en) | 2014-10-15 |
| CN104099356B true CN104099356B (en) | 2016-08-24 |
Family
ID=51667896
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410280742.4A Active CN104099356B (en) | 2014-06-20 | 2014-06-20 | A kind of high expressed amount lipase gene obtained by molecular modification propetide and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104099356B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102080092A (en) * | 2010-12-08 | 2011-06-01 | 江南大学 | High expression lipase gene and secretory expression vector and application thereof |
| CN102653741A (en) * | 2010-08-13 | 2012-09-05 | 江南大学 | High-thermal stability rhizopuschinensis lipase |
-
2014
- 2014-06-20 CN CN201410280742.4A patent/CN104099356B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102653741A (en) * | 2010-08-13 | 2012-09-05 | 江南大学 | High-thermal stability rhizopuschinensis lipase |
| CN102080092A (en) * | 2010-12-08 | 2011-06-01 | 江南大学 | High expression lipase gene and secretory expression vector and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Function of the prosequence for in vivo folding and secretion of active Rhizopus oryzae lipase in Saccharomyces cerevisiae;S. Takahashi et al.;《Appl Microbiol Biotechnol》;20011231;全文 * |
| 华根霉（Rhizopus chinensis）中的克隆表达和酶学性质研究;李飏;《中国优秀硕士学位论文全文数据(电子期刊)基础科学辑》;20090315;全文 * |
| 华根霉前导肽和成熟肽脂肪酶基因的克隆表达及性质研究;李飏 等;《生物技术通报》;20091231;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104099356A (en) | 2014-10-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10988791B2 (en) | Multiple proteases deficient filamentous fungal cells and methods of use thereof | |
| Nevalainen et al. | Making recombinant proteins in filamentous fungi-are we expecting too much? | |
| JP5662370B2 (en) | Protein fusion factor library for recombinant protein production and protein fusion factor obtained from the same | |
| CN104762277B (en) | Glycosylation engineered method, mutant enzyme and its application for improving fatty expression of enzymes | |
| Cui et al. | Direct conversion of inulin into single cell protein by the engineered Yarrowia lipolytica carrying inulinase gene | |
| Safder et al. | Pichia pastoris expression system: a potential candidate to express protein in industrial and biopharmaceutical domains | |
| US10619164B2 (en) | Yeast promoters from Pichia pastoris | |
| CN102414323A (en) | Process for production of recombinant polypeptide of interest | |
| CN105358706A (en) | Yeast promoters for protein expression | |
| JP5932766B2 (en) | Method for producing heterologous protein using yeast in which VPS gene is disrupted | |
| CN104136622A (en) | Methods and materials for reducing degradation of recombinant proteins | |
| Kour et al. | Disruption of protease genes in microbes for production of heterologous proteins | |
| CN106701813A (en) | Expression vector as well as construction method and application thereof | |
| CN112920280B (en) | Method for efficiently expressing acid protease and application thereof | |
| Nevalainen et al. | Heterologous expression of proteins in Trichoderma | |
| CN104099356B (en) | A kind of high expressed amount lipase gene obtained by molecular modification propetide and application thereof | |
| JP2023523925A (en) | Compositions and methods for enhancing protein production in filamentous fungal cells | |
| CN108603181B (en) | Phytase and use thereof | |
| CN104004760A (en) | Foreign protein expression device used for secretory expression in Aspergillus oryzae cells and Aspergillus oryzae genetically engineered bacteria | |
| CN109355274B (en) | Beta-glucosidase with improved resistance to trypsin and pepsin | |
| CN108949602B (en) | High-yield xylanase saccharomyces cerevisiae and application thereof | |
| Nevalainen | Strain improvement in filamentous fungi-an overview | |
| CN104099261A (en) | Pichia yeast engineering bacteria producing aspergillus-niger glucose oxidase and application thereof | |
| US20220267783A1 (en) | Filamentous fungal expression system | |
| US20210079369A1 (en) | A polypeptide having xylanase activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200720 Address after: Room 806-1, building 1, No. 800, Jiuxin Road, Jiuting Town, Songjiang District, Shanghai, 201600 Patentee after: SHANGHAI CUTSEQ BIO-MEDICAL TECHNOLOGY Co.,Ltd. Address before: 1800 No. 214122 Jiangsu city of Wuxi Province Li Lake Avenue Patentee before: Jiangnan University |
|
| TR01 | Transfer of patent right |