CN104087547B - A kind of engineering bacteria and preparation (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester - Google Patents
A kind of engineering bacteria and preparation (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester Download PDFInfo
- Publication number
- CN104087547B CN104087547B CN201410314478.1A CN201410314478A CN104087547B CN 104087547 B CN104087547 B CN 104087547B CN 201410314478 A CN201410314478 A CN 201410314478A CN 104087547 B CN104087547 B CN 104087547B
- Authority
- CN
- China
- Prior art keywords
- cyano group
- hecanoic acid
- butyl ester
- dihydroxy hecanoic
- halohydrin dehalogenase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a kind of engineering bacteria and preparation (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester, this engineering bacteria includes host cell and proceeds to the genes of interest of host cell, and described genes of interest is halohydrin dehalogenase gene; The method includes culturing engineering bacterium and induces halohydrin dehalogenase gene expression, and centrifuging and taking cell is resuspended with buffer, it is thus achieved that resting cell suspension; In resting cell suspension, add chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of (3R, 5S) 6-and NaCN reacts, after having reacted, from reactant liquor, separate purification obtain product. The present invention catalytic action by this enzyme, simplifies (3R, 5R) 6-cyano group-3, the production technology of 5-dihydroxy hecanoic acid t-butyl ester, generates without a large amount of byproducts of reaction, reduce production cost.
Description
Technical field
The invention belongs to field of biological pharmacy, be specifically related to a kind of engineering bacteria and utilize this engineering bacteria to prepare (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester.
Background technology
Statins is the competitiveness enzyme inhibitor medicaments of class hydroxy-methyl-glutaryl coenzyme A (HMG-CoA) reductase, is also main blood lipid-lowering medicine. HMG-CoA reductase catalysis HMG-CoA is reduced into 3-methyl-3, the reaction of 5-dihydroxy-acid is the biosynthesis pathway of cholesterol, statins is by suppressing the synthesis of HMG-CoA reductase, the synthesis of internal cholesterol can be suppressed, thus reducing cell free cholesterol levels, feedback raises cell surface Expression of LDL Receptor, promote the removing of the residual grain of C-VLDL and low density lipoprotein, LDL in blood circulation, the level of T-CHOL and low density lipoprotein, LDL in final reduction serum, the generation of effective atherosclerosis and coronary heart disease. structurally, statins is generally by the rigid planar structure parent nucleus of hydrophobicity and (3R, 5S/R)-bis-hydroxycaproic esters composition with double, two chiral centre. wherein, the medicine atorvastatin for the treatment of cardiovascular and cerebrovascular disease is exactly the one in statins, and (3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester is then the key intermediate of atorvastatin.
(3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester is the important intermediate that statin side chain is cut down in synthesis, and its chemical constitution is:
At present, in medical industry produces, preparing (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester is a lot, is broadly divided into chemical method and biological enzyme.Wherein, publication number has been the patent disclosure of WO2004094243A1, and one prepares (3R with (5R)-6-cyano group-5-hydroxyl-3-oxo hecanoic acid t-butyl ester for raw material, 5R) 6-cyano group-3, the method of 5-dihydroxy hecanoic acid t-butyl ester, the method needs just can react under low temperature and borine and sodium borohydride effect, the safety causing whole technique preparation process is difficult to control to, and industrialization cost is also higher, it is impossible to spread produces.
Comparatively speaking, the gentleer environmental protection of the reaction condition of biological enzyme. It is a kind of with (5R)-6-cyano group-5-hydroxyl-3-oxo hecanoic acid t-butyl ester for substrate that such as publication number has been the patent disclosure of WO2008042876A2, by the catalytic action of enzyme, (3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester can be obtained under room temperature. The problem that but this preparation method exists complex operation step, cost is high.
Publication number is that the patent of WO2008/042876A2 also discloses that and utilizes genes of brewing yeast engineered ketoreductase that 6-cyano group-(5R)-hydroxyl-3-oxo hecanoic acid t-butyl ester catalysis is obtained (3R, 5R) 6-cyano group-3, the technique of 5-dihydroxy hecanoic acid t-butyl ester, and utilize a kind of glucose dehydrogenase to complete the regenerative response of coenzyme, (the 3R that stereoisomerism is pure can be obtained by this process route, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester. But this technique needs two kinds of enzyme synergy just can complete coenzyme circulation, causes production cost to raise. Meanwhile, the gluconic acid produced in reaction can change the pH value of reaction system, it is necessary to is controlled by by adding aqueous slkali, adds the difficulty that reaction condition controls, is dissolved in the gluconic acid in reactant liquor and also can be greatly increased the difficulty of post processing.
Therefore, how can simplify preparation technology, only can be achieved with (3R by a kind of catalyst, 5R) 6-cyano group-3, the preparation of 5-dihydroxy hecanoic acid t-butyl ester, without a large amount of byproducts of reaction, and obtain (the 3R that stereoisomerism is pure, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester, is that we have major issue to be solved.
Summary of the invention
Present invention aims to above-mentioned deficiency of the prior art, it is provided that a kind of utilizing works bacterium prepares (3R, 5R) 6-cyano group-3, a step preparation method of 5-dihydroxy hecanoic acid t-butyl ester simplifies preparation technology, reduces production cost.
A kind of engineering bacteria, including host cell and the genes of interest proceeding to host cell, it is characterised in that described genes of interest is halohydrin dehalogenase gene.
The base sequence of described halohydrin dehalogenase gene is such as shown in SEQIDNO.3. Described engineering bacteria contain expression vector pET-30a with halohydrin dehalogenase gene (+). As preferably, halohydrin dehalogenase gene is hhdh gene, and this gene is complete synthesis gene, and is connected on pMD18-HHDH plasmid.
Host cell is escherichia coli, it is preferred to e. coli bl21 (DE3) bacterial strain.
Described halohydrin dehalogenase gene is expressed in e. coli bl21 (DE3), makes engineering bacteria secretion halohydrin dehalogenase, and the reaction equation of the present invention is:
As shown in above-mentioned reaction equation, in whole course of reaction, chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of halohydrin dehalogenase catalysis (3R, 5S) 6-and NaCN occur substitution reaction to obtain (3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester. Above-mentioned halohydrin dehalogenase is a kind of lyase, the intramolecular nucleophilic substitution reaction of its energy catalysis neighbour's halogenohydrin, forms epoxide, it is also possible to highly selective catalysis accepts a series of non-natural nucleopilic reagent beyond halogen ion and halogen ion, such as CN-、N3、NO2、OCN-、SCN-、HCOO-.At present, halohydrin dehalogenase is mainly used in chloro-3 3-hydroxyethyl butyrates of catalysis 4-and cyanalation reaction occurs, prepare key intermediate (the R)-4-cyano-3-hydroxy ethyl n-butyrate. of another kind of atorvastatin, but at (3R, 5R) 6-cyano group-3, adopt halohydrin dehalogenase also not have been reported that in the preparation of 5-dihydroxy hecanoic acid t-butyl ester.
A kind of engineering bacteria utilized described in claim 1～3 prepares (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester, including:
(1) culturing engineering bacterium induce halohydrin dehalogenase gene expression, centrifuging and taking cell, resuspended with buffer, it is thus achieved that resting cell suspension;
(2) in resting cell suspension, add chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of (3R, 5S) 6-and NaCN reacts, after having reacted, from reactant liquor, separate purification obtain (3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester.
The liquid medium formula of described culturing engineering bacterium is: peptone 10g/L, and yeast extract 5g/L, NaCl10g/L, pH are 7.0.
The temperature of described culturing engineering bacterium is 35～40 DEG C, and rotating speed is 180～220rpm.
In culture fluid, the amount of engineering bacteria can affect the amount of halohydrin dehalogenase in reaction system, and too low engineering bacteria quantity can cause enzyme deficiency, substrate excessive; And excessive engineering bacteria can cause halohydrin dehalogenase superfluous, cause the waste of resource. Inducer concentrations is also the key factor determining engineering bacterium expression halohydrin dehalogenase amount and matter with inducing temperature and time. As preferably, the method for described induction halohydrin dehalogenase gene expression is: to the OD of culture fluid600Reach 0.8～1.2, add 0.4～0.8mMIPTG, induce 20 hours at 16～22 DEG C of temperature.
Suitable reaction temperature and reacting solution pH value are conducive to the carrying out of reaction, and the temperature of described reaction is 25～35 DEG C, and pH is 7.0～9.0. If temperature is too high, pH value meta-acid easily causes the inactivation of halohydrin dehalogenase in course of reaction, it is more highly preferred to, the temperature of described reaction is 25～35 DEG C, when pH is 7.0～7.5, under this reaction condition, enzyme catalytic efficiency is best, the productivity of chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of (3R, 5S) 6-is the highest.
The engineering bacteria of halohydrin dehalogenase channel genes constructing host cell can be expressed halohydrin dehalogenase by the present invention, can realize from (3R by the catalytic action of this enzyme, 5S) chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of 6-are to (3R, 5R) 6-cyano group-3, one stepization of 5-dihydroxy hecanoic acid t-butyl ester produces, simplify (3R, 5R) 6-cyano group-3, the production technology of 5-dihydroxy hecanoic acid t-butyl ester, generate without a large amount of byproducts of reaction, reduce production cost.
Accompanying drawing explanation
Fig. 1 is the collection of illustrative plates of plasmid pMD18-HHDH.
Fig. 2 is the electrophoretogram of gene hhdh;
M: nucleic acid Marker, 1 and 2: gene hhdh sample.
Fig. 3 is the collection of illustrative plates of plasmid pET30-HHDH.
Fig. 4 is the protein S DS-PAGE electrophoretogram of genetic engineering bacterium EcoH abduction delivering;
M: protein Marker, 1:pET-30a (+) the broken born of the same parents' supernatant of empty plasmid comparison, 2: the genetic engineering bacterium EcoH broken born of the same parents' supernatant of induction thalline, 3:pET-30a (+) the broken born of the same parents' supernatant of empty plasmid comparison, 4: the genetic engineering bacterium EcoH broken born of the same parents' precipitation of induction thalline.
Fig. 5 is (4R-cis)-6-chloromethyl-2, the gas phase analysis standard diagram of 2-dimethyl-1,3-dioxane-4-tert-butyl acetate.
Fig. 6 is (4R-cis)-6-cyanogen methyl-2, the gas phase analysis standard diagram of 2-dimethyl-1,3-dioxane-4-tert-butyl acetate;
Analysis condition is as follows: chromatographic column: SE54CapillaryColumn60m × 0.54mm × l μm; Carrier gas: N2; Column temperature: 120 DEG C of 5min, 30 DEG C/min, 260 DEG C of 5min; Detector 280 DEG C; Injector 280 DEG C; Injector 1.0 μ L.
Fig. 7 is (4R-cis)-6-chloromethyl-2,2-dimethyl-1,3-dioxane-4-tert-butyl acetate1HNMR spectrogram.
Fig. 8 is (4R-cis)-6-chloromethyl-2,2-dimethyl-1,3-dioxane-4-tert-butyl acetate13CNMR spectrogram.
Fig. 9 is (4R-cis)-6-cyanogen methyl-2,2-dimethyl-1,3-dioxane-4-tert-butyl acetate1HNMR spectrogram.
Figure 10 is (4R-cis)-6-cyanogen methyl-2,2-dimethyl-1,3-dioxane-4-tert-butyl acetate13CNMR spectrogram.
Detailed description of the invention
Below in conjunction with the drawings and specific embodiments, the present invention is described in further detail.
The enzyme activity unit that the present invention adopts is defined as: catalytic substrate per minute reaction produces 1 μm of ol product.
Chloro-3, the 5-dihydroxy hecanoic acid t-butyl ester analysis detections of (3R, 5S) 6-are by derivatization reaction, are derivatized to (4R-cis)-6-chloromethyl-2, and 2-dimethyl-1,3-dioxane-4-tert-butyl acetate then detects. Reaction equation is as follows:
(3R, 5S) 6-chloro-3, the operation of 5-dihydroxy hecanoic acid t-butyl ester derivatization reaction is as follows: 1mL is containing (3R, 5S) 6-chloro-3, the extract of 5-dihydroxy hecanoic acid t-butyl ester, is sequentially added into 100 μ L acetone, 0.006g (about 10 μ L) 2,2-dimethylpropane, 0.001g p-methyl benzenesulfonic acid. 30 DEG C of concussion reaction 8h, add the 100 saturated NaHCO of μ L3Solution, anhydrous sodium sulfate dewaters, standby to be measured. Derivative product is (4R-cis)-6-chloromethyl-2,2-dimethyl-1,3-dioxane-4-tert-butyl acetate.
(3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester analysis detection is by derivatization reaction, is derivatized to (4R-cis)-6-cyanogen methyl-2, and 2-dimethyl-1,3-dioxane-4-tert-butyl acetate then detects. Reaction equation is as follows:
(3R, 5R) 6-cyano group-3, the operation of 5-dihydroxy hecanoic acid t-butyl ester derivatization reaction is as follows: 1mL is containing 6-cyano group-3, the extract of 5-dihydroxy hecanoic acid t-butyl ester, is sequentially added into 100 μ L acetone, 0.006g (about 10 μ L) 2,2-dimethylpropane, 0.001g p-methyl benzenesulfonic acid. 30 DEG C of concussion reaction 8h, add the 100 saturated NaHCO of μ L3Solution, anhydrous sodium sulfate dewaters, standby to be measured. Derivative product is 6-cyanogen methyl-2,2-dimethyl-1,3-dioxane-4-tert-butyl acetate.
(4R-cis)-6-chloromethyl-2, the analysis result of 2-dimethyl-1,3-dioxane-4-tert-butyl acetate is shown in Fig. 9. (4R-cis)-6-cyanogen methyl-2, the analysis result of 2-dimethyl-1,3-dioxane-4-tert-butyl acetate is shown in Figure 10.
Conversion ratio, productivity computing formula as follows:
Substrate conversion efficiency (%)=(initial substrate concentration one remains concentration of substrate)/initial substrate concentration × 100%
Products collection efficiency (%)=production concentration/theoretical product Cmax × 100%
The structure of embodiment 1 plasmid pET30-HHDH
Clone hhdh gene with primers F _ HHDH/R_HHDH, obtain the hhdh gene that length is 765bp. Nucleic acid electrophoresis checking gene size, such as Fig. 2.
The sequence of primers F _ HHDH is:
5 '-CGCGGATCCATGTCAACCGCAATTGTAAC-3 ';
The sequence of primer R_HHDH is:
5’-CCGCTCGAGCTACTCTGGCATACCAGG-3’。
Hhdh gene order is as follows:
ATGTCAACCGCAATTGTAACAAACGTTAAGCATTTTGGGGGAATGGGGTCTGCACTTCGTCTCTCGGAAGCAGGACATACAGTGGCTTGCCACGATGAAAGCTTCAAACACCAAGACGAACTTGAAGCCTTTGCCGAAACCTATCCACAACTCATCCCAATGTCGGAACAAGAACCAGCGGAACTCATCGAGGCAGTTACCTCCGCTCTCGGTCACGTTGATGTACTTGTGAGCAACGACATCGCTCCGGTCGAGTGGCGCCCAATCGATAAATACGCTGTAGAGGACTATCGCGATACTGTCGAGGCGCTCCAAATTAAGCCATTTGCACTGGTCAACGCCGTTGCAAGTCAAATGAAGAAGCGCAAAAGCGGACATATTATCTTTATTACCTCTGCTGCTCCAGTTGGGCCTTGGAAGGAACTTTCTACCTACTCGTCAGCCCGTGCAGGTGCATCTGCTTTGGCAAATGCCCTTTCGAAGGAACTCGGTGAATACAACATTCCGGTGTTCGCAATCGCTCCAAATTATCTTCACAGTGGGGATAGTCCATACTACTACCCATCGGAACCGTGGAAAACGTCGCCAGAACACGTTGCCCATGTCCGTAAAGTCACTGCGCTCCAGCGGTTAGGTACACAGAAAGAATTGGGAGAACTCGTCACTTTTCTCGCGTCTGGTAGTTGTGACTATCTGACCGGCCAGGTGTTCTGGTTGGCCGGCGGATTCCCAGTGATCGAGCGTTTTCCTGGTATGCCAGAGTAG
BamHI and XhoI double digestion hhdh gene, reclaim the gene band after enzyme action, BamHI and XhoI double digestion pET-30a (+) plasmid, reclaim the plasmid band after enzyme action, by the hhdh gene after enzyme action and the pET-30a after enzyme action (+) plasmid, connect with ligase, transformed clone host EscherichiacoliDH5 α.Carry out bacterium colony PCR checking with primers F _ HHDH/R_HHDH and convert recon, then extract recombiant plasmid, check order. Sequencing result shows errorless recombiant plasmid, is recombiant plasmid pET30-HHDH, and plasmid map is as it is shown on figure 3 ,-20 DEG C save backup.
The structure of embodiment 2 genetic engineering bacterium and abduction delivering
With the plasmid pET30-HHDH built in example 1, convert expressive host EscherichiacoliBL21 (DE3). Bacterium colony PCR, the recon that checking converts is done with primers F _ HHDH/R_HHDH. Verify that errorless genetic engineering bacterium is EcoH. Being inoculated in fermentation medium by EcoH isothermal vibration and cultivate 16h, condition of culture is 35 DEG C, 180rpm. Treat that cell concentration grows to OD600When=0.8, add 0.4mMIPTG (final concentration), 16 DEG C of induction 20h.
The structure of embodiment 3 genetic engineering bacterium and abduction delivering
With the plasmid pET30-HHDH built in example 1, convert expressive host EscherichiacoliBL21 (DE3). Bacterium colony PCR, the recon that checking converts is done with primers F _ HHDH/R_HHDH. Verify that errorless genetic engineering bacterium is EcoH. Being inoculated in fermentation medium by EcoH isothermal vibration and cultivate 16h, condition of culture is 40 DEG C, 220rpm. Treat that cell concentration grows to OD600When=1.2, add 0.8mMIPTG (final concentration), 22 DEG C of induction 20h.
The structure of embodiment 4 genetic engineering bacterium and abduction delivering
With the plasmid pET30-HHDH built in example 1, convert expressive host EscherichiacoliBL21 (DE3). Bacterium colony PCR, the recon that checking converts is done with primers F _ HHDH/R_HHDH. Verify that errorless genetic engineering bacterium is EcoH. Being inoculated in fermentation medium by EcoH isothermal vibration and cultivate 16h, condition of culture is 37 DEG C, 200rpm. Treat that cell concentration grows to OD600When=1.0, add 0.6mMIPTG (final concentration), 16 DEG C of induction 20h.
Embodiment 5 (3R, 5R) 6-cyano group-3, the preparation of 5-dihydroxy hecanoic acid t-butyl ester
Taking a certain amount of embodiment 4 engineering bacteria EcoH fermentation liquid, 5000rpm is centrifugal collects thalline, then resuspended with 100mMHEPES buffer, obtains the resting cell suspension of EcoH. Controlling cell loading amount is 2g stem cell/L. Putting into chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of (3R, 5S) 6-and the 100mM isopropanol of 10mM, by automatically adding the NaCN of 5%, controlling pH is 7.5, and controlling temperature is 30 DEG C. After reaction 8h, 5000rpm is centrifuged, and takes supernatant. Add NaCl to saturated, then be extracted with ethyl acetate 3 times, merge organic facies extract. Anhydrous sodium sulfate dewaters, sucking filtration, concentrating under reduced pressure, can obtain (3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester. Conversion ratio is more than 99%, and productivity is more than 94%.
Embodiment 6 (3R, 5R) 6-cyano group-3, the preparation of the 5-hydroxycaproic acid tert-butyl ester
Taking a certain amount of embodiment 2 engineering bacteria EcoH fermentation liquid, 5000rpm is centrifugal collects thalline, then resuspended with 100mMHEPES buffer, obtains the resting cell suspension of EcoH. Controlling cell loading amount is 2g stem cell/L. Putting into chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of (3R, 5S) 6-and the 100mM isopropanol of 15mM, by automatically adding the NaCN of 5%, controlling pH is 8.0, and controlling temperature is 25 DEG C. After reaction 12h, 5000rpm is centrifuged, and takes supernatant. Add NaCl to saturated, then be extracted with ethyl acetate 3 times, merge organic facies extract. Anhydrous sodium sulfate dewaters, sucking filtration, concentrating under reduced pressure, can obtain (3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester.Conversion ratio more than 99%, productivity about 88%.
Embodiment 7 (3R, 5R) 6-cyano group-3, the preparation of 5-dihydroxy hecanoic acid t-butyl ester
Taking a certain amount of embodiment 3 engineering bacteria EcoH fermentation liquid, 5000rpm is centrifugal collects thalline, then resuspended with 100mMHEPES buffer, obtains the resting cell suspension of EcoH. Controlling cell loading amount is 2g stem cell/L. Putting into chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of (3R, 5S) 6-and the 100mM isopropanol of 20mM, by automatically adding the NaCN of 5%, controlling pH is 8.5, and controlling temperature is 35 DEG C. After reaction 16h, 5000rpm is centrifuged, and takes supernatant. Add NaCl to saturated, then be extracted with ethyl acetate 3 times, merge organic facies extract. Anhydrous sodium sulfate dewaters, sucking filtration, concentrating under reduced pressure, can obtain (3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester. Conversion ratio is more than 99%, and productivity is about 62%.
Claims (5)
1. prepare (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester, including:
(1) culturing engineering bacterium induce halohydrin dehalogenase gene expression, centrifuging and taking cell, resuspended with buffer, it is thus achieved that resting cell suspension;
Described engineering bacteria includes host cell and proceeds to the genes of interest of host cell, and described genes of interest is the base sequence such as halohydrin dehalogenase gene shown in SEQIDNO.3; Described host cell is e. coli bl21 (DE3);
Described engineering bacteria contain expression vector pET-30a (+), described halohydrin dehalogenase gene be connected to expression vector pET-30a (+) on;
(2) in resting cell suspension, add chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of (3R, 5S) 6-and NaCN reacts, after having reacted, from reactant liquor, separate purification obtain (3R, 5R) 6-cyano group-3,5-dihydroxy hecanoic acid t-butyl ester.
2. the method for claim 1, it is characterised in that the liquid medium formula of described culturing engineering bacterium is: peptone 10g/L, and yeast extract 5g/L, NaCl10g/L, pH are 7.0.
3. the method for claim 1, it is characterised in that the temperature of described culturing engineering bacterium is 35～40 DEG C, rotating speed is 180～220rpm.
4. the method for claim 1, it is characterised in that the method for induction halohydrin dehalogenase gene expression is: to the OD of culture fluid600Reach 0.8～1.2, add 0.4～0.8mMIPTG, induce 20 hours at 16～22 DEG C of temperature.
5. the method for claim 1, it is characterised in that the temperature of described reaction is 25～35 DEG C, pH is 7.0～9.0.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314478.1A CN104087547B (en) | 2014-07-03 | 2014-07-03 | A kind of engineering bacteria and preparation (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314478.1A CN104087547B (en) | 2014-07-03 | 2014-07-03 | A kind of engineering bacteria and preparation (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104087547A CN104087547A (en) | 2014-10-08 |
| CN104087547B true CN104087547B (en) | 2016-06-15 |
Family
ID=51635309
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410314478.1A Active CN104087547B (en) | 2014-07-03 | 2014-07-03 | A kind of engineering bacteria and preparation (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104087547B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567655B (en) * | 2014-10-14 | 2020-11-20 | 上海弈柯莱生物医药科技有限公司 | Halogen alcohol dehalogenase and application thereof in synthesis of statin drug intermediate |
| CN104630125B (en) * | 2015-01-12 | 2018-04-10 | 浙江大学 | Engineering bacteria and its application in the dihydroxy hecanoic acid t-butyl ester of (3R, 5S) 6 chlorine 3,5 is prepared |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101528917A (en) * | 2006-10-02 | 2009-09-09 | 科德克希思公司 | Compositions and methods for producing stereoisomerically pure statins and synthetic intermediates therefor |
| CN102978193B (en) * | 2012-11-13 | 2014-07-02 | 浙江工业大学 | Halogenohydrin dehalogenation enzyme and encoding gene and vector and bacterial strain and application |
-
2014
- 2014-07-03 CN CN201410314478.1A patent/CN104087547B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101528917A (en) * | 2006-10-02 | 2009-09-09 | 科德克希思公司 | Compositions and methods for producing stereoisomerically pure statins and synthetic intermediates therefor |
| CN102978193B (en) * | 2012-11-13 | 2014-07-02 | 浙江工业大学 | Halogenohydrin dehalogenation enzyme and encoding gene and vector and bacterial strain and application |
Non-Patent Citations (1)
| Title |
|---|
| Enhancing the recombinant protein expression of halohydrin dehalogenase HheA in Escherichia coli by applying a codon optimization strategy;Lixia Tang等;《Enzyme and Microbial Technology》;20110910;第49卷(第4期);395-401 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104087547A (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104087546B (en) | A kind of method of engineering bacteria and preparation chloro-3, the 5-dihydroxy hecanoic acid t-butyl esters of (3R, 5S) 6- | |
| CN101591681B (en) | Method for producing dihydroxyacetone through microbial transformation | |
| CN106148256B (en) | The genetic engineering bacterium and its construction method of production alpha-arbutin and application | |
| CN101230363A (en) | Method for preparing (R)-styrene glycol by employing asymmetric conversion of recombinant strain | |
| CN104388373A (en) | Construction of escherichia coli system with coexpression of carbonyl reductase Sys1 and glucose dehydrogenase Sygdh | |
| CN104988133B (en) | A kind of embedding common immobilization method of aldehyde ketone reductase and glucose dehydrogenase | |
| CN104988132A (en) | Microwave-assisted co-immobilization method of aldehyde ketone reductase and glucose dehydrogenase | |
| CN104152506A (en) | Method catalytically synthesizing (S)-N, N-dimethyl-3-hydroxy-(2-thiofuran)-1-propylamine((S)-DHTP) by aldehyde ketone reductase recombinant strain crude enzyme system | |
| CN104087547B (en) | A kind of engineering bacteria and preparation (3R, 5R) 6-cyano group-3, the method for 5-dihydroxy hecanoic acid t-butyl ester | |
| CN106047950A (en) | Biological preparation method of (S)-1-(2,6-dichloro-3-fluorophenyl)ethanol | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN102827853B (en) | Halogenohydrin dehalogenation enzyme gene mutant and application thereof | |
| CN104630125B (en) | Engineering bacteria and its application in the dihydroxy hecanoic acid t-butyl ester of (3R, 5S) 6 chlorine 3,5 is prepared | |
| CN104152500A (en) | New method of biologically synthesizing (R)-3-hydroxylglutarate monoester | |
| CN106244569A (en) | A kind of esterase EstC10 and encoding gene thereof and application | |
| Deregnaucourt et al. | Enzymatic Transformations 63. High‐Concentration Two Liquid‐Liquid Phase Aspergillus niger Epoxide Hydrolase‐Catalysed Resolution: Application to Trifluoromethyl‐Substituted Aromatic Epoxides | |
| CN104928224B (en) | A kind of ferulic acid production engineering bacterial strain, construction method and bioconversion method | |
| CN108285908B (en) | Method for catalytic synthesis of (S) -1- (2, 6-dichloro-3-fluoro-phenyl) ethanol by using immobilized double enzymes | |
| CN104651290B (en) | Engineering bacteria and its application in Atorvastatin pharmaceutical intermediate is prepared | |
| Li et al. | Cell surface engineering of a β-galactosidase for galactooligosaccharide synthesis | |
| CN104673733B (en) | Engineering bacteria and its preparing（R）Application in the carbonyl hecanoic acid t-butyl ester of 6 cyano group, 5 hydroxyl 3 | |
| CN104531627A (en) | Carbonyl reductase, engineering strain and application of carbonyl reductase | |
| CN104830744A (en) | Method for preparing (R)-phenylglycol from SD-AS sequence coupled (R)-carbonyl reductase and glucose dehydrogenase | |
| CN101974579A (en) | Method for preparing paroxetine intermediate by enzymatic selective hydrolysis in ionic liquid | |
| CN104878031B (en) | A kind of alginate lyase SHA-2 genes and its expression vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |