CN104087517B - One strain can be degraded phthalic acid ester and the fungus of pesticide and application thereof simultaneously - Google Patents
One strain can be degraded phthalic acid ester and the fungus of pesticide and application thereof simultaneously Download PDFInfo
- Publication number
- CN104087517B CN104087517B CN201410317731.9A CN201410317731A CN104087517B CN 104087517 B CN104087517 B CN 104087517B CN 201410317731 A CN201410317731 A CN 201410317731A CN 104087517 B CN104087517 B CN 104087517B
- Authority
- CN
- China
- Prior art keywords
- pesticide
- geotrichum
- soil
- phthalic acid
- fungus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Processing Of Solid Wastes (AREA)
Abstract
The invention discloses a strain can degrade phthalic acid ester and the fungus of pesticide and application thereof simultaneously.This strain name was Geotrichum DY4 (Geotrichum sp.DY4), was preserved in the China typical culture collection center being positioned at Wuhan, China Wuhan University on May 11st, 2014, and deposit number is CCTCC NO:M2014194.This bacterial strain can be degraded phthalic acid ester and pesticide simultaneously, can be used for degrading multiple PAEs and pesticide combination pollutes, repair for geobiont, and the mechanism of degradation research for PAEs in soil and pesticide provides a kind of new germ plasm resource.
Description
Technical field
The invention belongs to environmental organic pollutant biologic treating technique field, can degrade particularly to a strain simultaneously
Phthalic acid ester and the fungus of pesticide and application thereof.
Background technology
The mankind, in order to meet growing various material requisites, use mulch film in agricultural production in a large number, have
The agricultural chemicals such as machine pesticide, chemical fertilizer, cause the gas chromatography combined pollution to soil.In agricultural land soil
Covering with plastic film has the effect of heat and moisture preserving to crops, especially in booth vegetable and the planting process of fruit
In play very important effect.But plasticizer-phthalic acid ester (the phthalic acid in mulch film
Esters, PAEs) it is difficult to strong bonded with plastics itself, stability is relatively poor, and PAEs is easily from plastics ground
Film oozes out, causes Soil Environmental Pollution.PAEs pollutes the growth not only affecting agricultural land soil quality and plant,
Affecting the Quantityanddiversity of soil microorganism, its estrogen effect having and bioaccumulation effect, to people
Class health also has potential risks.China's priority pollutant blacklist is listed 3 kinds of PAEs, is adjacent respectively
Dimethyl phthalate (DMP), dibutyl phthalate (DBP) and dioctyl phthalate (DOP).
Pesticide is also important capital goods in the agricultural sector, for prevention and elimination of disease and pests, goes to cut weeds, regulate crops
Growth has important effect.But in recent years, produce along with a large amount of of pesticide and use, pollution by pesticides thing
Part frequently occurs, and endangers the most increasingly severe.Pesticide, while killing harmful organism, also can destroy farmland
Bio-diversity and ecological balance, pesticide contaminated soil and water body, grain, veterinary antibiotics etc. and the mankind
Life, produce closely-related product, person poultry poisoning can be caused.Chlopyrifos (chlorpyrifos) is a kind of
Broad-spectrum high efficacy, the organophosphor insecticidal/acaricidal agent of low-residual, be classified as the high poison of replacement by National Development and Reform Committee and the Ministry of Agriculture
The important kind of pesticide, occupies first of organophosphorus insecticide market.Pyrethroid pesticide
(pyrethroids) it is the broad spectrum insecticide of an analoglike natural pyrethrum bio-mimetic syntheses, containing multiple benzene
Ring structure, high-efficiency low-toxicity, insecticidal toxicity than older generation's insecticide such as organochlorine, organophosphorus pesticide improve 10～
100 times, it is widely used.Pyrethroid pesticide principal item has decis, cypermethrin, fluorine chlorine
50 multiple products such as Cyano chrysanthemate, fenvalerate, Fenpropathrin and Biphenthrin, its kind number and usage amount are only
Inferior to organophosphorus pesticide, occupy the second of biocides market, most common of which for fenvalerate.
Microbial degradation is the main path of organic contaminants in soil mineralising.Biological restoration is considered as current
Remove organic most economical effective method in environment.In recent years, about PAEs and the bacterial degradation of pesticide
It is widely studied, but the report about fungus degrading is less.Its microbial degradation research is also both for
Single pollutant or same type pollutant, but for actual soil environment, Organic Pollution is often
Being the simultaneous combined pollution of gas chromatography, PAEs and pesticide are most common organic contaminations in agricultural land soil
Thing, filters out and can degrade both fungal bacterial strain simultaneously and carry out the research of degradation process and mechanism, will have
Help improve PAEs and the degradation efficiency of pesticide in soil, be preferably applied for PAEs and pesticide Organic substance is multiple
Close the biological restoration of polluted farmland soil.
Summary of the invention
The primary and foremost purpose of the present invention is to overcome prior art PAEs and pesticide combined pollution agricultural land soil biological
Present in recovery technique not enough, it is provided that a strain can be degraded the fungus of phthalic acid ester and pesticide simultaneously.
The another object of present aspect is to provide the fungus of described can simultaneously degrade phthalic acid ester and pesticide
Application.
The purpose of the present invention is achieved through the following technical solutions: a strain can be degraded phthalic acid ester and agriculture simultaneously
The fungus of medicine, entitled Geotrichum DY4 (Geotrichum sp.DY4), protected on May 11st, 2014
Being hidden in the China typical culture collection center being positioned at Wuhan, China Wuhan University, deposit number is CCTCC
NO:M2014194.
Described phthalic acid ester includes dimethyl phthalate (DMP), dibutyl phthalate
And phthalic acid two (2-ethyl hexyl) ester (DEHP) (DBP)；
Described pesticide is more than one in chlopyrifos and pyrethroid pesticide；
Described pyrethroid pesticide is preferably at least one in fenvalerate and decis；
The fungus of described can simultaneously degrade phthalic acid ester and pesticide can be used for processing by phthalic acid ester
With the soil of pollution by pesticides, carry out environmental pollution reparation.
The present invention has such advantages as relative to prior art and effect: the fungus that the present invention provides is in pure training
Dimethyl terephthalate (DMP) in 7 days under the conditions of Yanging, dibutyl phthalate (DBP), adjacent
The total degradation rate of the mixed system of phthalic acid two (2-ethyl hexyl) ester (DEHP) three kinds of PAEs be 63.5%～
90.9%, to the total degradation rate of the mixed system of chlopyrifos, fenvalerate and three kinds of pesticide of decis be
31.6～37.1%；In the mixed system of DBP and fenvalerate, DY4 is to DBP and the fall of fenvalerate
Solution rate is up to 65.4% and 55.8%；In 30 days, DY4 is by 100mg kg in sterile soil-1DBP
67.3% and 57.5% is degraded respectively with fenvalerate, lab simulation field soil organic matter degradation, manually contaminate,
Comparison does not carry out sterilization treatment, and DY4 all has good degradation effect to DBP in soil and fenvalerate.This
Invention bacterial strain can be used for degrade multiple PAEs and pesticide combination pollution, repairs for geobiont, and is soil
In earth, the mechanism of degradation research of PAEs and pesticide provides a kind of new germ plasm resource.
Accompanying drawing explanation
Fig. 1 is that Geotrichum DY4 is to the degradation effect figure of DBP and fenvalerate in liquid mixing system.
Fig. 2 is that Geotrichum DY4 is to the degradation effect figure of DBP in sterile soil.
Fig. 3 is that Geotrichum DY4 is to the degradation effect figure of fenvalerate in sterile soil.
Fig. 4 is that Geotrichum DY4 is to the degradation effect figure of DBP in natural soils medium.
Fig. 5 is that Geotrichum DY4 is to the degradation effect figure of fenvalerate in natural soils medium.
Detailed description of the invention
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but the embodiment party of the present invention
Formula is not limited to this.
The screening and separating of embodiment 1 Geotrichum (Geotrichum sp.) DY4 and PAEs and pesticide are dropped
Solve performance
(1) screening and separating of Geotrichum (Geotrichum sp.) DY4
From somewhere, Guangdong Province by the topsoil in PAEs and pollution by pesticides farmland (0～20cm) soil sampling.Weigh soil
Sample 10g, is incorporated with the 250mL triangular flask of 90mL deionized water, 4～5 beades, 28 DEG C, 180
Rpm vibrates 30min, stands 30min.Take 10mL supernatant, supernatant adds 140mL containing multiple
[minimal medium composition is as follows: (NH for the minimal medium of conjunction PAEs and pesticide4)2SO41.0g/L、
KH2PO41.0g/L、MgSO4·7H2O0.2g/L、CaCl20.1g/L、FeCl30.01g/L, regulates pH value
Be 7.0,121 DEG C of high pressure steam sterilization 20min, lower with] in carry out 3 subgradient domestications.Each gradient 3
Plant PAEs (DMP, DBP and DEHP, lower same) and 3 kinds of pesticide (chlopyrifos, fenvalerate and bromine cyanogen
Chrysanthemum ester, lower with) concentration be respectively 100,200 and 400mg/L (total concentration be 600,1200 and 2400
Mg/L), take 10mL bacterium solution every time and proceed to the fresh inorganic salt cultivation containing compound PAEs and pesticide of 140mL
In base, 28 DEG C, 120rpm cultivate 7d, add chloromycetin (final concentration of mass volume ratio 0.02%) and press down
Bacterial growth processed.Finally taking 1mL bacterium solution spread plate, plating medium is Ma Dingshi culture medium [glucose
10g/L, peptone 5g/L, KH2PO41.0g/L、MgSO4·7H2O0.5g/L, regulation pH value is 7.0,
It is cooled to 55～60 DEG C after 115 DEG C of high pressure steam sterilization 20min, adds chloromycetin (final concentration of quality
Volume ratio 0.02%), solid medium need to add agar (final concentration of mass percent 1.5～2.0%)],
Cultivate 7d, the bacterium colony of different shape is rule respectively on Ma Dingshi culture medium flat plate solid medium for 28 DEG C
To single bacterium colony, inclined-plane preserves.More than operate and the most aseptically carry out.
The fungus that inoculating loop picking screens, is respectively connected to Ma Dingshi fluid medium, shaking table 28 DEG C, 120
Rpm cultivates 48h inducing spore and sprouts and mycelial growth.OD under spectrophotometric determination bacterium solution 660nm
Value, suitably dilution make its concentration consistent.10mL bacterium solution is separately added into the training of 90mL composite pesticide inorganic salt
Supporting base (concentration of 3 kinds of pesticide is 50mg/L, total concentration 150mg/L), 28 DEG C, 120rpm cultivates
7d, compares with the composite pesticide minimal medium do not inoculated for non-biodegradation.Detection degradation of pesticide rate and
Mycelium dry weight.Bacterium is resurveyed and determines employing dry weight method, after bacterium solution filter paper filtering, claims after lyophilization 24h
Weight.Same method detection PAEs degradation rate and mycelium dry weight.Result of the test is shown in Tables 1 and 2.
Table 1 four fungal strain degradation rate to pesticide
Note 1): same hurdle is with the different letter representation significant differences (P < 0.05) of string
Table 2 four fungal strain degradation rate to PAEs
Note 2): same hurdle is with the different letter representation significant differences (P < 0.05) of string
In four fungal strains, DY4 is best to the degradation effect of 3 kinds of pesticide and 3 kinds of PAEs.The fungus that will obtain
Bacterial strain DY4 carries out taxonomy qualification:
1. by DY4 in Ma Dingshi fluid medium, 28 DEG C, 120rpm shaken cultivation 24h, culture fluid
Muddiness, forms floccule, and surface forms film；
2. DY4 is rule on Ma Dingshi culture medium flat plate, carries out morphologic observation: bacterium colony becomes flat board to spread,
Growth is fast, milky, and fine hair shape band powdery, umbo have radiation strain line；
3. using microscope to observe, DY4 has fungus every mycelia and arthrospore, without going out sprout cell；Under Electronic Speculum
Observing mycelia fragmentation is cylindrical or columnar arthrospore, is formed with barrier film fungal filament, and the y-bend that has having divides
Branch, without ascospore；
4. physiological property is detected by Guangdong Microbes Inst by sending, and examining report is as follows:
A, glucose fermentation are tested: be inoculated in glucose fermentation tube respectively with fresh cultured thing, 26 DEG C of cultivations,
Every day observed result, if can glucose fermentation time, then the Du Shi pipe inside test tube has gas to produce；Knot
Fruit is negative, i.e. produce without gas in Du Shi pipe；
B, nitrate are tested: be inoculated in potassium nitrate assimilation culture medium with fresh cultured thing, cultivate 1～3 for 26 DEG C
My god, observe whether it assimilates potassium nitrate every day；Result is negative, and i.e. potassium nitrate content is almost without decline；
C, urea decomposition test: be inoculated in urea medium with fresh cultured thing, cultivate for 26 DEG C and observe after 1 day,
Culture medium such as takes on a red color, then be that urase is positive；Do not take on a red color then for feminine gender；Result is negative, does not i.e. have urea
Enzyme produces.
5. use fungal genomic DNA to extract test kit and extract the genome of this bacterial strain, then pass through universal primer
Amplify 26S rDNA (sequence is as follows), this sequence is carried out on NCBI BLAST.Result shows,
The 26S rDNA sequence of this bacterial strain and the homology of Geotrichum (Geotrichum) reach 99.8%.
TGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAG
GTCGAGTTGTAATTTGTAGATTGTACCTTGAGAGCAGATCAAAGTCTGTTGGAACACAG
CGCCTTAGAGGGTGACAGCCCCGTAGGATCTTTTCTCATTGTAAGGTACTTTCGAAGAGT
CGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAAATTCCTTCTAAAGCTAAATATTG
ACGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAA
GAGAGTGAAAAAGTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACGTGGTG
CTGTTGTTCAGCTTTGCTTCGGCATGGTGTACTCAACAGTACTAGGCCAAGGTGGGGTG
TTTGGGAGTGAAAAAGAAATAGGAATGTGGCTCTTCGGAGTGTTATAACCTATTTTCATA
ACTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACTTTGGCATAATGATTCTATACC
GCCCGTCTTG。
In conjunction with above taxonomy morphological characteristic, physiological and biochemical property and the comparison result of 26S rDNA sequence, will
This Strain Designation is Geotrichum DY4 (Geotrichum sp.DY4), is preserved on May 11st, 2014
Being positioned at the China typical culture collection center of Wuhan, China Wuhan University, deposit number is CCTCC NO:
M2014194。
(2) DBP and fenvalerate degradation property are detected by DY4
The fungus DY4 that inoculating loop picking screens, accesses Ma Dingshi fluid medium, 28 DEG C, 120rpm
Shaking table shaken cultivation 36h inducing spore is sprouted and mycelial growth.Under spectrophotometric determination bacterium solution 660nm
OD value, suitably dilution make consistent (the sprouting spore concentration about 10 of its concentration7/L)。
Select respectively 3 kinds of PAEs and 3 kinds of pesticide pollute most common, in crops and food, residual quantity is relatively
Height, and DY4 Organic substance preferable to its degradation effect be combined with each other (respectively DBP and fenvalerate),
The Degradation of the fungus that institute screens organic pollution dissimilar to both.90mL is contained
The DBP of variable concentrations gradient and the minimal medium of fenvalerate add in 250mL conical flask, arrange
DBP and the Concentraton gradient of fenvalerate is respectively 0,25,50,75,100mg/L, 1M NaOH molten
Liquid regulation pH value is to 7.Draw 10mL bacterium solution to be added thereto, 28 DEG C, under the conditions of 120rpm, cultivate 7d,
Observe DBP and the degraded situation of fenvalerate.Result of the test is as shown in Figure 1.
In conjunction with table 1,2 and the result of Fig. 1, it is seen then that under the conditions of pure culture, DY4 is in liquid 3 kinds of PAEs
63.5%～90.9% and 31.6～37.1% is respectively reached with the degradation rate of 3 kinds of pesticide；To DBP and cyanogen penta chrysanthemum
Under the mixed system of ester, both degradation rates are up to 65.4% and 55.8% (at 25mg L-1Time degraded
Rate is the highest, and degradation rule is all 25mg L-1>75mg·L-1>50mg·L-1>100mg·L-1)；In mixing
In system, the degradation rate of DBP is all higher than fenvalerate, but well below PAEs single component, pesticide is described
DY4 is had a certain impact, is allowed to the degradation function to PAEs and declines；But, Geotrichum (Geotrichum
Sp.) DY4 can tolerate high concentration agricultural chemical.
This example demonstrates that, Geotrichum (Geotrichum sp.) DY4 of resulting separation is to 3 kinds of PAEs
All there is well degraded with 3 kinds of pesticide, and DBP and fenvalerate hybrid system are had energy of preferably degrading
Power.
Embodiment 2: the somatomedin impact on Geotrichum (Geotrichum sp.) DY4 degradation effect
Choose additional carbon (glucose), organic pollution (for DBP and fenvalerate) concentration and pH
As factor of influence, orthogonal design (as shown in table 3) carries out the degradation condition optimization of DBP and fenvalerate.
Use minimal medium, every bottle of 100mL, table 3 is the concentration value that respectively reaches of 2 kinds of organic pollutions.
The amplification culture reference example 1 of strain.It is 1mol L by adding concentration-1NaOH solution regulation pH
Value, 28 DEG C/120rpm cultivates 7d, is comparison with nonvaccinated minimal medium.Measure content of organics
With bacterium solution pH value, calculate degradation rate and find out optimum degradation condition.
Using range analysis method, the result of table 4～7 shows: Geotrichum (Geotrichum sp.) DY4
Optimum test condition be without additional carbon, organic pollution initial concentration is 25mg L-1, optimal pH is
7.5。
This example demonstrates that, Geotrichum (Geotrichum sp.) DY4 of the present invention is to DBP and fenvalerate
There is stronger tolerance and the wider pH scope of application (3.1～7.8).
Table 3 somatomedin affects Orthogonal Experiment and Design to Geotrichum (Geotrichum sp.) DY4 degradation effect
Table 4 Geotrichum (Geotrichum sp.) DY4 is at different conditions to DBP and the degradation effect of fenvalerate
K, k and R value that table 5 is calculated by the varying level of additional carbon
Note: calculate K value, k value and R value (extreme difference) by the degradation rate of DBP and fenvalerate.Wherein, K is same
The result of the test sum of the one each level of factor, k is the meansigma methods of K value, and R is that in same factor, k maximum subtracts k minimum
Value.The impact of R value this factors on test of the biggest explanation is the biggest, otherwise the least.The biggest explanation of K value this level in same factor
Impact on test is the biggest, otherwise the least.
K, k and R value that table 6 is calculated by the varying level of organic concentration
K, k and R value that table 7 is calculated by the varying level of pH value
Embodiment 3: Geotrichum (Geotrichum sp.) DY4 is to DBP in sterile soil and fenvalerate
Degradation effect
Test cleaning soil used takes from the arable layer in Agricultural University Of South China's rice test field 0～20cm, soil
Indices is as follows: organic matter 2.20%, total nitrogen 0.10%, alkali-hydrolyzable nitrogen 130mg kg-1, available phosphorus 114
mg·kg-1, available potassium 284mg kg-1, pH value is 6.08, for medium loam.Through air-drying, soil grinder grinds
After mill, cross 100 mesh sieves, obtain foundation soil.DBP and fenvalerate are arranged 5 Concentraton gradient, point
Be not 0,25,50,75,100mg kg-1, make an addition in foundation soil, soil of manually being contaminated.Often
Individual artificial contamination pedotheque 40g, if 3 parallel, loads in cleaned glass culture dish, all samples one
They interior 121 DEG C of high pressure steam sterilizations 2 times, each 20min.Strain Ma Dingshi fluid medium amplification culture
After 48h, by the OD value of bacterium solution under spectrophotometric determination 660nm, dilute bacterium solution, keep OD value to exist
About 0.5.Bacterium solution accesses each culture dish by 5% inoculum concentration (adding 5mL bacterium solution in every 100g soil),
1M NaOH solution regulation pH value to 7.0～7.5, with respective concentration do not inoculate soil for comparison, add
Appropriate amounts of sterilized water, makes water content remain at about 30%, and culture dish is put into the training of constant incubator lucifuge
Support.Respectively 0,15,30d time sampling, measure degradation rate and the quantity of inoculation bacterium of pesticide.
From Fig. 2～3 and table 8 it can be seen that before the degraded of DBP and fenvalerate occurs mostly in cultivation
Phase (0～15d), add DBP and the degraded of fenvalerate in the artificially contaminated soil after bacterial strain DY430d
Rate is respectively 64.6%～89.2% and 68.8%～89.6%, and compares the fall of sterilizing group DBP and fenvalerate
Solution rate is 10.1%～16.7% and 14.4%～24.0%.
This example demonstrates that, bacterial strain DY4 is respectively provided with certain degraded to the DBP in soil media and fenvalerate
Ability, and be significant contributor.
DBP and the total degradation rate of fenvalerate in soil after table 8 30d
Embodiment 4: Geotrichum (Geotrichum sp.) DY4 is to DBP in Indoor Natural soil and cyanogen penta chrysanthemum
The degradation effect of ester
Test soil sources used, type and fundamental property are same with embodiment 3.Manually contaminate soil, make DBP
It is 0,40 and 80mg kg with the concentration of fenvalerate-1, each sample 1.5kg, if 3 are parallel, load
In clean pottery pot, bacterium solution is inoculated in pottery pot soil by 5% (mass ratio).In process of the test, constantly
Ground adds appropriate amounts of sterilized water, makes soil moisture content remain at 20%～about 30%, and growth cabinet is cultivated.
Mending strain once during test 20d, rate of after culture is identical with inoculum concentration.Respectively at 0,5,10,15,20 and
Sample during 30d, detection DBP and the degradation rate of fenvalerate.
From Fig. 4～5 and table 9 it can be seen that DY4 inoculation process DBP and fenvalerate total degradation rate
Higher than not inoculating process, concentration is 40mg kg-1With 80mg kg-1Time, the total degradation rate that inoculation processes is divided
Not Gao Yu inoculate process 27.0% and 16.6%.
This example demonstrates that, inoculation DY4 can improve the degraded effect of DBP and fenvalerate in natural soils
Rate.
DBP and the total degradation rate of fenvalerate in natural soils after table 9 30d
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not by above-mentioned enforcement
The restriction of example, the change made, modifies, replaces under other any spirit without departing from the present invention and principle
In generation, combine, simplify, all should be the substitute mode of equivalence, within being included in protection scope of the present invention.
Claims (2)
1. a strain can be degraded the fungus of phthalic acid ester and pesticide simultaneously, it is characterised in that: entitledly mould
Belong to DY4 (Geotrichum sp.DY4), be preserved on May 11st, 2014 that to be positioned at Wuhan, China Wuhan big
China typical culture collection center in, deposit number is CCTCC NO:M 2014194；
Described pesticide is more than one in organophosphor insecticidal/acaricidal agent and pyrethroid pesticide.
2. the application of the fungus of can simultaneously degrade phthalic acid ester and the pesticide described in claim 1, it is special
Levy and be: described fungus, for processing by phthalic acid ester and the soil of pollution by pesticides, carries out environmental pollution
Repair；
Described pesticide is more than one in organophosphor insecticidal/acaricidal agent and pyrethroid pesticide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410317731.9A CN104087517B (en) | 2014-07-03 | 2014-07-03 | One strain can be degraded phthalic acid ester and the fungus of pesticide and application thereof simultaneously |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410317731.9A CN104087517B (en) | 2014-07-03 | 2014-07-03 | One strain can be degraded phthalic acid ester and the fungus of pesticide and application thereof simultaneously |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104087517A CN104087517A (en) | 2014-10-08 |
| CN104087517B true CN104087517B (en) | 2016-08-24 |
Family
ID=51635279
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410317731.9A Expired - Fee Related CN104087517B (en) | 2014-07-03 | 2014-07-03 | One strain can be degraded phthalic acid ester and the fungus of pesticide and application thereof simultaneously |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104087517B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105602855B (en) * | 2015-11-09 | 2018-10-26 | 武汉大学 | A kind of aspergillus sydowii with broad-spectrum pesticide degradation characteristic |
| CN106493162A (en) * | 2016-12-22 | 2017-03-15 | 常州大学 | A kind of method that PAEs contaminated soils repaired by microwave reinforced calper calcium peroxide |
| CN108949626A (en) * | 2018-07-22 | 2018-12-07 | 扬州市泽惠环境工程有限公司 | A method of phthalic acid ester pollutant effluents is handled using composite flora |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4122428B2 (en) * | 2003-02-28 | 2008-07-23 | 独立行政法人産業技術総合研究所 | Novel xyloglucan-degrading enzyme, gene encoding the same, and method for producing the enzyme |
| KR20100085752A (en) * | 2009-01-21 | 2010-07-29 | 칭하이 유니버시티 | Fungus strain geotrichum sp. degrading polysaccharides and a method for degrading polysaccharides using the same fungus |
| CN101838612B (en) * | 2009-03-06 | 2012-06-13 | 青海大学 | New geotrichum and application thereof in degradation of single-cell seaweed polysaccharide |
| CN103664261A (en) * | 2013-12-12 | 2014-03-26 | 环境保护部华南环境科学研究所 | Method for treating phthalic acid esters (PAEs) in agricultural wastes |
-
2014
- 2014-07-03 CN CN201410317731.9A patent/CN104087517B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104087517A (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105132336B (en) | One bacillus amyloliquefaciens and its microbial inoculum and application | |
| CN101124915B (en) | Biocontrol bacteria compound agent for preventing and controlling crop soil-infectious diseases and preparation method | |
| CN111117910B (en) | Enterobacter ludwigii PN6 and application thereof | |
| CN105602855B (en) | A kind of aspergillus sydowii with broad-spectrum pesticide degradation characteristic | |
| CN104762223A (en) | Bacillus amyloliquefaciense BA-KA3 and application thereof | |
| CN104286032B (en) | The preparation method of a kind of yellow basket bacterium spore powder, yellow basket bacterium wettable powder and preparation method thereof | |
| CN106734188A (en) | A kind of nitrate nitrogen contamination method of heavy metals in farmland pollution | |
| CN105018366A (en) | Bacillus methylotrophicus and application thereof | |
| Aamir et al. | Fungal endophytes: Classification, diversity, ecological role, and their relevance in sustainable agriculture | |
| CN105432381B (en) | A kind of preventing control method of capsicum epidemic disease | |
| RU2595405C1 (en) | STRAINS OF BACTERIA Bacillus, Pseudomonas, Rahnella, Serratia HAVING PHYTOPROTECTIVE AND GROWTH-STIMULATING ACTIVITY, AND PREPARATION BASED ON SAID STRAINS | |
| Tian et al. | Synergistic effect of dazomet soil fumigation and Clonostachys rosea against cucumber Fusarium wilt | |
| CN106119155A (en) | For preventing and treating bacterial strain WXX 2 and the microbial inoculum of Roots of Peanut maize ear rot | |
| CN104152383A (en) | Composite sporeformer agent and preparation method and application of composite sporeformer agent | |
| CN104342388B (en) | Streptomycete bacterial strain and prevent and treat tomato wilt use in conjunction | |
| CN102021122A (en) | High-efficiency insecticidal fungus and applications thereof | |
| CN105039184A (en) | Beauveria bassiana strain having pathogenicity on cyclophragma undans and application thereof | |
| CN103361294A (en) | Phytophthora-resistant actinomyces and application thereof | |
| CN104087517B (en) | One strain can be degraded phthalic acid ester and the fungus of pesticide and application thereof simultaneously | |
| CN106434452A (en) | Preparation method of cypermethrin degrading bacterium powder and application of cypermethrin degrading bacterium powder in soil | |
| CN105567600A (en) | Pathogen verticillium antagonistic bacterium and application thereof | |
| CN1785989A (en) | Pyronone antibiotic its preparation method and application | |
| CN109593687A (en) | One pseudomonas and its application in oil degradation | |
| CN102409000B (en) | Fungus for degrading phthalate ester and application thereof | |
| CN105018393A (en) | Bacillus megaterium strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160824 Termination date: 20180703 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |