CN104086636B - Derive from the resisting verticillium albumen of sea island cotton and encoding gene thereof and application - Google Patents
Derive from the resisting verticillium albumen of sea island cotton and encoding gene thereof and application Download PDFInfo
- Publication number
- CN104086636B CN104086636B CN201410312015.1A CN201410312015A CN104086636B CN 104086636 B CN104086636 B CN 104086636B CN 201410312015 A CN201410312015 A CN 201410312015A CN 104086636 B CN104086636 B CN 104086636B
- Authority
- CN
- China
- Prior art keywords
- plant
- gbat11
- verticillium
- cotton
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention disclose a kind of derive from sea island cotton resisting verticillium albumen and encoding gene and application. Protein provided by the present invention, be following a) or b): protein a) being made up of the aminoacid sequence shown in sequence in sequence table 1; B) by the aminoacid sequence of protein that a) limits through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation, and the protein relevant to vegetable verticillium wilt resistance. Experiment proves, withered by the Huang resistance of bacterium of GbAt11 transgene cotton and GbAt11 transgenic arabidopsis is extremely significantly better than not genetically modified wild-type, the qualification of verticillium garden, field also proves that most of transgenic line resisting verticillium phenotype is significantly better than wild-type, and after finding transgenosis, output also increases simultaneously. Visible, GbAt11 gene provided by the present invention has vital role in vegetable verticillium wilt resistance, and the present invention, for cultivation verticillium high-resistance plant new variety, has very high using value.
Description
Technical field
The invention belongs to genetically engineered field, it relates to a kind of derive from sea island cotton resisting verticillium albumen and encoding gene and application.
Background technology
Cotton belongs to high mallow order Gossypium, mainly contains four cultivars: Asiatic cotton (short stapled cotton), african cotton, upland cotton (fine fleece is cotton), sea island cotton (long stapled cotton). 95% and the 2% of whole world output of cotton is accounted for respectively according to the ultimate production of international cotton council statistics upland cotton and sea island cotton.
Upland cotton because of as far back as American continent plantation also referred to as U.S. cotton, be kind the most important in four big culture of cotton kinds in the world. The feature of upland cotton is wide adaptability, output height, fiber is longer, quality is better, but Huang is withered by it, the disease resistance of bacterium is poor, mostly is susceptible or resistance to sick kind at present. The cotton variety overwhelming majority planted due to China is upland cotton (G.hirsutum), is produced raw cotton about 99% for upland cotton, so verticillium is very severe to the threat of Cotton in China output. When Huang withers after bacterium infects upland cotton, diseased plant blade starts form irregular yellow scab and upwards expands by lower blade, cause except main vein keep green except, whole blade is brown palmate scab, is also referred to as " Watermelon rind " shape spot. More serious defoliation symptom then shows as most or whole strain blade and wilts sagging, after turn into brown and upwards curling, come off very soon. Verticillium generally there will be diseased plant in sowing after 1 month, and the optimum temperuture of verticillium morbidity is 25 DEG C to 28 DEG C. Generally entering morbidity appropriate stage in squaring period, the state of an illness develops rapidly; The harm reaching onset peak cotton verticillium wilt to seven August flowering and boll-setting periods is mainly manifested in the middle and later periods, and diseased plant blade turns yellow, drying up comes off, and knot bell is little, expulsion rate height.Since nineteen ninety-three the harm of cotton is increased the weight of by verticillium year by year, annual loss gined cotton about 7.5 to 10 ten thousand tons. And sea island cotton (Gossypiumbarbadense) is although output is low, but disease resistance is good, so the disease-resistant mechanism of research sea island cotton is significant for the long term growth of Cotton in China industry.
Summary of the invention
It is an object of the invention to provide a kind of derive from sea island cotton resisting verticillium albumen and encoding gene and application.
Albumen provided by the present invention, derives from sea island cotton (Gossypiumbarbadense), called after GbAt11, is specially following (a) or (b):
A protein that () is made up of the aminoacid sequence shown in sequence in sequence table 1;
The aminoacid sequence of b protein that (a) is limited by () is through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation, and the protein relevant to vegetable verticillium wilt resistance.
For the ease of the purifying of GbAt11 albumen, the N-terminal of the protein that the amino acid residue sequence of sequence 1 forms or C-terminal label as shown in the table can be connected in by sequence table.
Table: the sequence of label
| Poly-Arg | 5-6 (is generally 5) | RRRRR |
| Poly-His | 2-10 (is generally 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK 1 --> |
| c-myc | 10 | EQKLISEEDL |
Protein in above-mentioned (b) can synthetic, it is possible to first synthesize its encoding gene, then carries out biological expression and obtain. The encoding gene of the protein in above-mentioned (b) is by the codon by lacking one or several amino-acid residue in the DNA sequence dna shown in sequence in sequence table 2, and/or carries out the missense mutation of one or several base pair.
Described protein specifically can be the fusion rotein formed after the carboxyl terminal of albumen shown in sequence 1 connects flag label.
The nucleic acid molecule of code for said proteins also belongs to protection scope of the present invention.
Described nucleic acid molecule can be DNA, such as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can also be RNA, such as mRNA, hnRNA or tRNA etc.
In one embodiment of the invention, described nucleic acid molecule is specially the gene (called after GbAt11) encoding described GbAt11 albumen; Described GbAt11 gene is following 1) to 3) in arbitrary described DNA molecular:
1) encoding sequence is the DNA molecular shown in sequence 2 in sequence table;
2) under strict conditions with 1) DNA molecule hybridize that limits and the DNA molecular encoding described GbAt11 albumen;
3) with 1) or 2) DNA molecular that limits has more than 90% homology and encode the DNA molecular of described GbAt11 albumen.
Above-mentioned stringent condition can be with the solution of 6 �� SSC, 0.5%SDS, hybridizes at 65 DEG C, and then with 2 �� SSC, 0.1%SDS and 1 �� SSC, 0.1%SDS respectively washes film once.
Wherein, sequence 2 is made up of 768 Nucleotide, and whole sequence 2 is ORF, the protein shown in sequence 1 in polynucleotide.
Recombinant vectors containing above-mentioned nucleic acid molecule, expression cassette, transgenic cell line or restructuring bacterium also belong to protection scope of the present invention.
Described recombinant vectors can be recombinant expression vector, it is possible to is recombinant cloning vector.
Described recombinant expression vector can use existing plant expression vector construction. Described plant expression vector comprises two unit's agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or other derivative plant expression vector. Described plant expression vector also can comprise the 3 ' of foreign gene and hold non-translation region, namely comprises polyadenylic acid signal and other DNA fragmentation participating in mRNA processing or genetic expression any.The described bootable polyadenylic acid of polyadenylic acid signal joins 3 ' end of mRNA precursor. When using described gene constructed recombinant expression vector, any a kind of enhancement type, composing type, organizing specific type or inducible promoter can be added before its transcription initiation Nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiquitin promotor (pUbi), stress induced promoter rd29A etc., they can be used alone or are combined with other plant promoter; In addition, when using the gene constructed recombinant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser regions can be ATG initiation codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to ensure the correct translation of whole sequence. The source of described translation control signal and initiator codon is widely, it is possible to be natural, it is also possible to be synthesis. Translation initiation region can from transcription initiation region or structure gene. For the ease of transgenic plant cells or plant being identified and screen, recombinant expression vector used can be processed, enzyme or the gene of luminophor, the antibiotic marker thing with resistance or the chemical resistance reagent marker gene etc. of color change can be produced as added the coding can expressed in plant. Also can not add any selected marker, directly screen transformed plant with adverse circumstance.
In the present invention, the promotor starting described GbAt11 genetic transcription in described recombinant expression vector is specially Super promotor.
More specifically, described recombinant expression vector is following (I) or (II):
(I) in the restriction enzyme site of pSPT-02 carrier, insert the recombinant plasmid that described GbAt11 gene obtains. Described restriction enzyme site is specially SalI and KpnI.
(II) in the restriction enzyme site of super1300-MYC carrier, insert the recombinant plasmid that described GbAt11 gene obtains. Described restriction enzyme site is specially SalI and KpnI.
Described expression cassette is by the promotor that can start described GbAt11 genetic expression, described GbAt11 gene, and transcription termination sequence composition.
Described GbAt11 albumen, or described nucleic acid molecule, or the application in arbitrary as follows of described recombinant expression vector, expression cassette or restructuring bacterium also belongs to protection scope of the present invention:
(a1) regulating plant is to the resistance of verticillium;
(a2) plant variety that the resistance of verticillium is strengthened by seed selection;
(a3) output of regulating plant;
(a4) plant variety of seed selection output increased.
In the present invention, described in (a1), the resistance of verticillium is embodied in by regulating plant: in described plant materials, if the expression amount of described GbAt11 gene is more high, then described plant is more strong to the resistance of verticillium. (a3) output of regulating plant described in is embodied in: in described plant materials, if the expression amount of described GbAt11 gene is more high, then the output of described plant is more strong.
In the present invention, (a2) plant of seed selection described in is to the method for the plant variety that the resistance of verticillium strengthens, and the method for the plant variety of seed selection output increased described in (a4), all specifically can comprise the step carrying out plant higher for described GbAt11 gene expression amount as parent hybridizing.
It is a further object to provide a kind of cultivation strengthens or/and the method for transgenic plant of output increased to the resistance of verticillium.
The resistance enhancing of verticillium or/and the method for the transgenic plant of output increased, specifically can be comprised the steps: by cultivation provided by the present invention
A) in object plant, import the encoding gene of described GbAt11 albumen, obtain expressing the transgenic plant of described encoding gene;
B) obtain from step a) gained transgenic plant compared with described object plant, the resistance of verticillium is strengthened or/and the transgenic plant of output increased.
The expression amount of described GbAt11 albumen in described transgenic plant is higher than described object plant; The gene (i.e. GbAt11 gene) encoding described GbAt11 albumen is described gene is following 1) to 3) in arbitrary described DNA molecular:
1) encoding sequence is the DNA molecular shown in sequence 2 in sequence table;
2) under strict conditions with 1) DNA molecule hybridize that limits and the DNA molecular encoding described GbAt11 albumen;
3) with 1) or 2) DNA molecular that limits has more than 90% homology and encode the DNA molecular of described GbAt11 albumen.
Above-mentioned stringent condition can be with the solution of 6 �� SSC, 0.5%SDS, hybridizes at 65 DEG C, and then with 2 �� SSC, 0.1%SDS and 1 �� SSC, 0.1%SDS respectively washes film once.
Described GbAt11 gene specifically imports in described object plant by above-mentioned arbitrary described recombinant expression vector, obtains described transgenic plant. Specifically by using the routine biological methods such as pollen tube importings, Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated, particle gun by described recombinant expression vector transformed plant cells or tissue, and the plant tissue of conversion is cultivated into plant.
In above-mentioned application or method, the pathogenic bacteria of described verticillium can be Huang and withers bacterium.
In one embodiment of the invention, the pathogenic bacteria of described verticillium is specially Huang and withers bacterium V991.
In the present invention, the above " resistance to verticillium ", be embodied in following at least one: to verticillium pathogenic bacteria (as Huang withers bacterium, specifically as Huang withers bacterium V991) resistance, verticillium toxin albumen VdALP991 that Huang is withered resistance.
In above-mentioned application or method, described plant can be dicotyledons, it is possible to is monocotyledons.
In one embodiment of the invention, described plant is cotton, is upland cotton further, is more specially cotton variety Ji cotton 169; In another embodiment of the present invention, described plant is Arabidopis thaliana, is specially Col type Arabidopis thaliana further.
In one embodiment of the invention, output described in above-mentioned application or method is embodied on the knot bell number of cotton.
Experiment proves, withered by the Huang resistance of bacterium of GbAt11 transgene cotton is extremely significantly better than not genetically modified wild type cotton kind, the qualification of verticillium garden, field also demonstrates most of transgenic line resisting verticillium phenotype and is significantly better than wild-type, after finding transgenosis, yield traits does not only reduce simultaneously, increases on the contrary. In addition, withered by the Huang disease resistance of bacterium of GbAt11 transgenic arabidopsis also increases. Visible, GbAt11 gene provided by the present invention has vital role in vegetable verticillium wilt resistance, and the present invention, for cultivation verticillium high-resistance plant new variety, has very high using value.
Accompanying drawing explanation
Fig. 1 is the PCR electrophorogram of GbAt11 gene. M:DNA molecular weight standard; 1:GbAt11 gene.
Fig. 2 is SalI and the KpnI double digestion electrophorogram of recombinant expression vector pSPT-02-GbAt11. M:DNA molecular weight standard; 1 and 2:SalI and KpnI double digestion recombinant expression vector pSPT-02-GbAt11.
Fig. 3 is the PCR electrophorogram of recombinational agrobacterium GV3101/pSPT-02-GbAt11. M:DNA molecular weight standard; CK+, CK-is respectively with the positive control of GbAt11 gene and water alternate template and negative control;All the other swimming lanes are recombinational agrobacterium to be measured, amplify the positive strain that size is about 768bp object band.
Fig. 4 be taking T1 for the DNA of GbAt11 transgene cotton as the PCR result of template amplification screening-gene TFDA. M:DNA molecular weight standard; 1 and 2: wild type control; 3-16 is that 14 T1 to be identified are for GbAt11 transgenic resistance cotton.
Fig. 5 is the transcriptional level qualification result of T2 for GbAt11 transgene cotton.
Fig. 6 is the protein level Westernblot qualification result of T2 for GbAt11 transgene cotton.
Fig. 7 is the disease resistance detected result of T2 for GbAt11 transgene cotton. A: Huang withers bacterium V991Each plant forms after spore suspension process 24h; B: Huang withers bacterium V991The disease index of each plant after spore suspension process 24h; C: the Huang verticillium toxin albumen VdALP991 that withers processes the leaf morphology of each plant after 48h.
Fig. 8 is that T2 is for GbAt11 transgene cotton field proterties statistics. A: the strain high statistics of each plant; B: the knot bell number statistics of each plant; C: each plant terminate in Huang withers bacterium sick soil after phenotype.
Fig. 9 is the PCR qualification result of recombinant expression vector super1300-MYC-GbAt11. M:DNA molecular weight standard; 1-10:10 recombinant vectors to be measured, what amplify 768bp object band is the positive; CK+��CK-Respectively with the positive control of GbAt11 gene and water alternate template and negative control.
Figure 10 is the disease resistance qualification result of T2 for GbAt11 transgenic arabidopsis. Huang withers, and (spore concentration is 1 �� 10 to bacterium V991 spore suspension6/ mL) soak and turn GbAt11 gene masculine and plant Different L ine and wild-type, plant phenotype after 24 hours.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Cotton (GossypiumhirsutumL.) kind Ji cotton 169: buy from Ji, Hebei Mian Jingzuo Science and Technology Ltd..
Cotton (GossypiumhirsutumL.) kind is planted cotton No. 2: Shandong gold autumn Zhong Ye company limited.
Col type Arabidopis thaliana: SALKInstitute.
Huang withers bacterium V991: be recorded in " Qi Junsheng, Li Huaifang. a kind of cotton Huang that detects withers the novel method blade acupuncture streak method of verticillium toxin to withering property. Cotton Science, 2016,18 (4): 228-232 " literary composition, the public can obtain from China Agricultural University.
PMD18-T carrier: purchased from great bio tech ltd, Shanghai.
Agriculture bacillus GV3101: nine divisions of China in remote antiquity, Beijing Science and Technology Ltd. of Tianrui.
The acquisition of embodiment 1, GbAt11 gene
1, Huang withers bacterium V991Induction sea island cotton blade
Huang withers bacterium V991Czapek's solution is cultivated 15d, by filtered through gauze, by filtrate under the microscope with tally counting, then adjusts spore concentration and reach 1 �� 106/ mL. Get sea island cotton 7124 plant young leaflet tablet, soak in 1 �� 106In/mLV991 spore suspension, record starts to soak time of blade, and respectively 0h, 3h, 6h, 12h and 24h after steeping time take out blade, wrap with masking foil be stored in after liquid nitrogen freezing in-80 DEG C of refrigerators stand-by.
2, the extraction of sea island cotton RNA
Sea island cotton RNA is extracted with EASYspin plant RNA rapid extraction test kit:
(1) 500 �� l lysate RLT (having added beta-mercaptoethanol) and 50 �� lPLANTaid is mixed even in 1.5ml centrifuge tube.
(2) sample is ground in liquid nitrogen, get about 50mg fine powder and proceed to the above-mentioned centrifuge tube that RLT and PLANTaid is housed, immediately with hand thermal agitation 20 seconds, abundant cracking.
(3) 56 DEG C of temperature are educated and are accelerated cracking in 1-3 minute, and by centrifugal for lysate 13000rpm 5-10 minute, centrifugal rear supernatant forwarded in a new centrifuge tube.
The dehydrated alcohol of (4) 0.5 volumes adds in the centrifuge tube that supernatant is housed, and piping and druming is mixed even immediately.
(5) being added by mixture in an adsorption column RA, centrifugal 60 seconds of (adsorption column puts into collection tube) 13000rpm, discards waste liquid.
(6) the �� l protein liquid removal RW1 that adds 700, room temperature places 30 seconds, and centrifugal 30 seconds of 12000rpm, discards waste liquid.
(7) adding 500 �� l rinsing liquid RW, centrifugal 30 seconds of 12000rpm, discards waste liquid. Repeat one time.
(8) putting back in sky collection tube by adsorption column RA, 13000rpm goes out rinsing liquid for centrifugal 2 minutes as far as possible. Take out adsorption column RA, put into a RNasefree centrifuge tube, centrifugal 1 minute of the �� lRNasefreewater that adds 30 at middle the position of adsorption film (shifts to an earlier date 65 DEG C of preheatings) 12000rpm.
3, the acquisition of GbAt11 gene
A. according to carrying out reverse transcription as follows:
The sea island cotton RNA that (1) 4 �� g step 2 obtains adds ddH2O is settled to 9.5 �� L, adds 0.5 �� LrDNase, I 37 DEG C of 20min;
(2) 70 DEG C of water-bath 10min deactivation rDNaseI;
(3) oligo (dT) the 2.5 �� L that concentration is 20 ��m is added, 70 DEG C of water-bath 10min;
(4) after mixture being placed 2min on ice, 1.5mL centrifuge tube is added according to following proportioning: 5 �� M-MLVBuffer4 �� L; M-MLV ThermoScript II 1 �� L; DNTP (2.5mM) 2 �� L; RRI (Rnaseinhibitor) 0.5 �� L.
(5) 42 DEG C of water-baths 1 hour; Deposit for-20 DEG C.
B. reverse transcription product PCR:
The cDNA of the different induction times obtained after above reverse transcription is mixed, taking gained mixture as template, adopts primer At11-Sal1 and primer At11-KpnI to carry out pcr amplification:
At11-Sal1:5 '-CGGTCGACATGTCGATCGCGTTGGAACG-3 ' (underscore part is the recognition sequence of restriction enzyme site SalI, and sequence thereafter is the 1-20 position of sequence 2);
At11-KpnI:5 '-CGGGTACCGTTATATTCACGTACATCAGCC-3 ' (underscore part is the recognition sequence of restriction enzyme site KpnI, the reverse complementary sequence of the 744-765 position of sequence nucleotide sequence 2 thereafter).
PCR system (20 �� L): cDNA (mixes) 1.0 �� L; 10 �� KODBuffer2.0 �� L; DNTP2.0 �� L; Mg2+0.5 �� L; KOD enzyme 0.4 �� L; Primer At11-F0.5 �� L; Primer At11-R0.5 �� L; DMSO0.2 �� L; ddH2O complements to 20.0 �� L.
PCR program: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30sec, 56 DEG C of annealing 30sec, 72 DEG C extend 45sec, 35 circulations; 72 DEG C extend 10min.
Gained PCR primer is carried out 1% agarose gel electrophoresis after terminating by reaction. Result shows, and gained PCR primer size is about 768bp (Fig. 1).
Gained PCR primer is connected with pMD18-T carrier, gained recombinant plasmid is checked order, by the recombinant plasmid called after pMD18-GbAt11 through the order-checking DNA fragmentation that shows to be connected in sequence table in pMD18-T carrier shown in sequence 2. Being GbAt11 by unnamed gene shown in sequence 2, whole sequence 2 is its open reading frame, the protein (called after GbAt11) shown in sequence 1 in polynucleotide.
The acquisition of embodiment 2, GbAt11 transgene cotton and functional analysis
One, the acquisition of GbAt11 transgene cotton and qualification
1, the acquisition of recombinant expression vector pSPT-02-GbAt11
Designing primer At11-Sal1 and At11-KpnI according to GbAt11cDNA sequence (sequence 2), sequence is as follows:
At11-Sal1:5'-CGGTCGACWhat ATGTCGATCGCGTTGGAACG-3'(underscore marked is SalI enzyme recognition site, and sequence thereafter is the 1st of sequence 2 to the 20th);
At11-KpnI:5'-CGGGTACCWhat GTTATATTCACGTACATCAGCC-3'(underscore marked is KpnI enzyme recognition site, and sequence thereafter is the reverse complementary sequence of the 744th to the 765th of sequence 2).
Taking the recombinant plasmid pMD18-GbAt11 of embodiment 1 gained as template, carry out pcr amplification with primer At11-Sal1 and At11-KpnI.
Gained PCR primer is carried out agarose gel electrophoresis after terminating by reaction. Result shows, and gained PCR primer size is about 768bp. The fragment SalI obtain amplification and KpnI double digestion, be inserted into the endonuclease bamhi obtained between SalI and the KpnI enzyme recognition site of pSPT-02 carrier, obtain recombinant vectors. Correctly through SalI and KpnI double digestion preliminary evaluation (size will be obtained and it will be about 768bp, see Fig. 2) recombinant vectors send sample to check order, be the recombinant vectors called after pSPT-02-GbAt11 of DNA fragmentation shown in the 1-765 position of sequence 2 by showing that small segment between by restriction enzyme site SalI and KpnI of pSPT-02 carrier is replaced through order-checking.
In recombinant expression vector pSPT-02-GbAt11, starting the promotor that described GbAt11 gene (sequence 2) transcribes is Supper promotor. It is connected with flag label in the downstream of GbAt11 gene.
Wherein, pSPT-02 carrier involved in above step 1 on this basis, obtains after transformation as follows at pCAMBIA1300-Super carrier (purchased from prosperous Bioisystech Co., Ltd of Beijing ancient cooking vessel state):
The acquisition of A.CaMV35S promotor
First, design primer obtains CaMV35S promotor, 5 ' end primer includes BstXI restriction enzyme site, 3 ' end primer include NcoI:BstXI-35S-5 ': 5 '-CCAACATGGTGGAGCACGACACTCTC-3 ' and 35S-NcoI-3 ': 5 '-CCATGGATCTCATTGCCCCCCCGGATCTG-3 ', obtains CaMV35S promotor (825bp) by template amplification of pCAMBIA1300 carrier (purchased from Jin Weike (China) biotechnology center).
The acquisition of B.tfdA gene
TfdA gene is obtained, with upstream primer 5 ' by template of pJP4 carrier (purchased from DSMZGmbH)CCATGGGTGAGCGTCGTCGCAAATC (5 ' end of primer adds NcoI restriction enzyme site), downstream primer is 5'-CTCGAGCTAGACGACGGCATCGTCCAGGGT (5 ' end of primer adds XhoI restriction enzyme site), carry out pcr amplification, result obtains the fragment of 888bp, it is that the 5 ' of AY365053.1 holds 36915-37778 position nucleotide sequence that order-checking shows that this fragment has GENBANKAccesionversionNumber, i.e. tfdA gene order.
The structure of C.pSPT-02 carrier
The tfdA gene that the CaMV35S promotor obtain steps A and step B obtain is connected with pMD18-T carrier (purchased from Hua Lvyuan Bioisystech Co., Ltd) respectively, the pMD18-T carrier containing tfdA gene is cut again with NcoI and SalI enzyme, reclaim tfdA fragment, then the skeleton large fragment of this tfdA fragment with the pMD18-T carrier containing CaMV35S promotor cut through NcoI and SalI enzyme is connected, it is connected on the pMD18-T carrier containing CaMV35S promotor by tfdA gene; Correct recombinant vectors called after pMD18-T-35S-tfdA is shown by cutting through enzyme and check order; In pMD18-T-35S-tfdA, CaMV35S promotor is connected to 5 ' end of tfdA gene.
PCAMBIA1300-Super carrier recovery carrier large fragment is cut with BstXI and XhoI enzyme, pMD18-T-35S-tfdA is cut with BstXI and SalI enzyme, reclaim CaMV35S-tfdA fragment, carrier large fragment and CaMV35S-tfdA T4 ligase enzyme acquisition recombinant vectors will be obtained, through the recombinant vectors called after pSPT01 containing CaMV35S gene and tfdA that sequence verification is correct.In pSPT01 carrier, 5 ' end of tfdA gene is connected with CaMV35S promotor, and 3 ' end is connected with the PolyA terminator of pCambia1300-Super carrier self.
Synthetic 5 ' is held and is held the Flag sequence label containing Hind III restriction enzyme site containing XbaI enzyme cutting site, 3 ': TCTAGAGATGGCGGATTACAAGGATGACGACGATAAGGACTATAAAGATGACGATG ACAAGTCTAGAAAGCTTCTGCAGGTCGACGATTCCAAGCTT, by XbaI and Hind III double digestion pSPT01 and above-mentioned synthetic fragment, connect with T4 ligase enzyme again, Flag sequence label is inserted after Super strong promoter, build and obtain recombinant vectors, cut through enzyme and check order and show correct carrier called after pSPT-02 carrier.
2, converting cotton
A. transformation Agrobacterium competent cell
(1) competence agriculture bacillus GV3101 (100 �� L), from-80 DEG C of taking-ups, is placed in ice chest.
(2) after agriculture bacillus is melted, adding 3 �� L recombinant expression vector pSPT-02-GbAt11 (about 400ng), vibration is mixed even gently, places 30min on ice.
(3) liquid nitrogen 5min is put into.
(4) 37 DEG C of heat place 2-5min on ice after hitting 5min.
(5) 900 �� LSOC nutrient solutions are added, 28 DEG C of shaking table concussion renewal cultivation 2-4h.
(6) by, after centrifugal for bacterium liquid collection, coating in super clean bench on the YEB flat board with Kan and Rif, wait and dry rear 28 DEG C of inversion cultivations 2-3 days.
(7) bacterium colony PCR identifies positive colony.
Pcr amplification qualification will be carried out through primer At11-Sal1 and At11-KpnI (sequence is the same) and show the recombinational agrobacterium called after GV3101/pSPT-02-GbAt11 containing GbAt11 gene (PCR object stripe size is about 768bp, sees Fig. 3).
The comparison proceeding to pSPT-02 empty carrier in agrobacterium strains GV3101 is set simultaneously. The recombinational agrobacterium called after GV3101/pSPT-02 of pSPT-02 empty carrier will be proceeded to.
B. pollen tube pathway converting cotton and positive plant screening
(1) being received by recombinational agrobacterium GV3101/pSPT-02-GbAt11 in YEB liquid nutrient medium that 5mL contains 50mg/L kantlex and rifomycin, 28 DEG C are shaken bacterium about 24h.
(2) the bacterium liquid shaken all is forwarded in the YEB liquid nutrient medium that 4L contains kantlex and rifomycin, shakes bacterium in a large number to OD600It is about 0.8.
(3) 6000rpm room temperature collection bacterium 10min.
(4) add 1L conversion fluid (400 �� lSilwet, are settled to 1L with ddH2O for conversion fluid (1L): 2.2gMS powder, 50g sucrose) suspension precipitation, load in watering can.
(5) being sprayed onto by conversion fluid on cotton 169 column caps in cotton (GossypiumhirsutumL.) the kind Ji growing to full-bloom stage (spray and do selfing the day before yesterday, selfing flower coloured silk rope mark), bagging processes three days; Spray continuously and continue to flowering period to terminate.
(6) cotton seeds is gathered in the crops, field sowing after lint process.
(7), before waiting to emerge and growing rough leaf, lower concentration 2,4-D is sprayed in little seedling leaf. After spraying, candidate GbAt11 transgenic positive plant should grow normal true leaf, and non-candidate GbAt11 transfer-gen plant should grow the shank shape true leaf of deformity (T1 generation).
Adopt same method recombinational agrobacterium GV3101/pSPT-02 converting cotton (GossypiumhirsutumL.) kind Ji cotton 169, obtain the cotton that candidate proceeds to pSPT-02 empty carrier.
3, the qualification of GbAt11 transgene cotton
(1) DNA level PCR identifies
A. test kit (Kang Wei ShiJi Co., Ltd product is extracted by cotton gene group, its catalog number is Cat:CW2088, Lot:1112J) DNA of candidate GbAt11 transgenic positive plant (T1 generation) that extraction step 2 obtains, specifically operates see test kit specification sheets.
B.PCR identifies positive plant
For the screening-gene TFDA carried on pSPT-02 carrier, design gene specific primer tfdA-F and tfdA-R.
TfdA-F:5'-ATGAGATCCATGGGTGAGCG-3';
TfdA-R:5'-AGAACGCAGCGGTTGTCC-3'.
Taking the cotton genomic dna of steps A acquisition as template, primer tfdA-F and tfdA-R is adopted to carry out pcr amplification. PCR system (20 �� L): 10 �� PCRBuffer2 �� L; Genomic dna 0.5 �� L; TfdA-F0.25 �� L; TfdA-R0.25 �� L; DNTP1 �� L; RTaq enzyme 0.25 �� L; ddH2O complements to 20 �� L. PCR program: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30sec, 56 DEG C of annealing 30sec, 72 DEG C extend 60sec, 35 circulations; 72 DEG C extend 10min.
Reaction carries out 1% agarose gel electrophoresis detection after terminating.
Experiment compares to proceed to the cotton of pSPT-02 empty carrier as zero load simultaneously, using not genetically modified cotton variety Ji cotton 169 as wild type control (WT), using pSPT-02 carrier as positive control.
As shown in Figure 4, for GbAt11 transfer-gen plant with for proceeding to the plant of pSPT-02 empty carrier, all identical with plasmid positive control to amplify the plant being greater than 750bp object band be the positive to result, and wild type control does not amplify object band. The GbAt11 transgenic line of wherein 10 qualification positives is numbered L179, L185, L191, L202, L203, L213, L214, L234, L241 and L252 respectively.
(2) rna level qualification
T2 generation will be obtained for the expansion of GbAt11 transfer-gen plant is numerous through 10 T1 that step (1) qualification is positive, with 2,4-D is screening transgenic positive plant again, it has been found that most of positive plant is by 3:1 separation, comprises 10 strains that step (1) qualification is positive.
For the total serum IgE of 10 GbAt11 transgenic lines and reverse transcription obtains cDNA to extract T2, carries out see A in embodiment 1 step 2 and step 3. Taking gained cDNA as template, with special primer F1 and R1, the cDNA of GbAt11 gene being carried out Real-TimePCR amplification, take UBQ7 as internal reference, primer is FC and RC.
F1:5 '-GCACTTGCTGTTGCAATGAGTGG-3 ' (the 532-554 position of sequence 2);
R1:5 '-CGCCAGTTAGAGAAATTCCGGCC-3 ' (reverse complementary sequence of the 709-731 position of sequence 2);
FC:5 '-CCTAGCCGCTGTACTTCTACTCCC-3 ';
RC:5 '-GAACCTTCCCGGACTCATCCACC-3 '.
Real-TimePCR reaction system: SYBRPremixExTaq10 �� L; The each 0.6 �� L of upstream and downstream primer; ROX0.4 �� L; CDNA1-2 �� L; ddH2O mends to 20 �� L. Wherein, SYBRPremixExTaq and ROX is TaKaRa company product, and its catalog number is Cat#RR420A, Lot#AK3702.
Real-TimePCR response procedures: 95 DEG C of denaturation 5min; 95 DEG C of sex change 10sec, 60 DEG C of annealing and extension 30sec, 40 circulations.
Data processing: the cycle number of Ct value for experiencing when fluorescent signal in PCR pipe reaches the thresholding of setting, �� Ct=Ct (GbAt11)-Ct (UBQ7), with 2-��CtValue weigh GbAt11 gene transcription level, analyze GbAt11 gene expression.
Experiment compares to proceed to the cotton of pSPT2 empty carrier as zero load simultaneously, and taking wild-type Ji, cotton 169 as compareing, using not genetically modified cotton variety Ji cotton 169 as wild type control (WT).
Experiment repeats three times, results averaged.
Result shows, and compared with wild-type, T2 significantly improves for GbAt11 gene expression amount in 10 GbAt11 transgenic lines.Wherein, in L202, GbAt11 gene expression amount is about 2 times of wild-type, and in L241, GbAt11 gene expression amount is about 3 times (Fig. 5) of wild-type.
(3) protein level qualification
Identify that positive T2 generation 10 GbAt11 transgenic line are experiment material with step (2), detect the expression of wherein GbAt11 albumen. Owing to being connected with flg label after GbAt11 gene, so doing Westernblot experiment with the antibody of flag, the expression of GbAt11 albumen in indirect detection transgenic line. Specific as follows:
A. extracting albumen from T2 for 10 GbAt11 transgenic lines as follows: 1) cotton seedling is cultivated in shading on MS, get the growth cotton seedling of 1 week, suck dry moisture, weighs, and shreds with scissors, is put in the middle of reagent bottle with a lid. 2) enough acetone ice bath extraction 12-24h chlorophyll and the removal of cotton phenol is added, middle every replacing in a 4-6 hour acetone, mixed once even every concussion in a hour, operate in stink cupboard. Sample is placed on enough ice cubes. 3) by the acetone evacuation of above-mentioned process, distilled water rinsing is then added, to remove the acetone of residual as far as possible. 4) the broken plant tissue of homogenate. With PBS (7.0), PMSF (proteinase inhibitor) 1mM, 0.1% Tween-80 be mixed into protein extraction Buffer. According to cotton seedling quality (g): extract Buffer (ml)=1:3, mixing, grinding cotton tissue. 5) centrifugal, 4 DEG C of centrifugal 15min of 13000rpm, collect supernatant. 6) repeating step 5).
B. purifying GbAt11 albumen as follows: 1) wash Flag pearl with protein extraction Buffer and activate Flag pearl for twice. 2) pearl of activation is joined in steps A in the cotton total protein extracted, it is placed in 4 DEG C and rotates about 2h. 3) 3000rpm, 2min collect pearl. 4) 5 times are washed with protein extraction Buffer, each 10min. 5) wash-out: �� L glycine 4 DEG C rotates 5min to add 300, then �� LTris rotation 5min, 3000rpm are centrifugal to add 1.5. 6) protein extract is added super filter tube protein concentrate and it is about 30min.
C. Westernblot is carried out as follows:
1) preparation of SDS polyacrylamide gel: first prepare 30%Acryl&Bis stock solution (100mL): Acryl29.2g, Bis0.8g, add water to 100mL and surely hold, keep in Dark Place. Then fix offset plate, add preparation of reagents 10% separation gel and 5% concentrated glue below from the bottom to top successively.
2) electrophoretic buffer (1L) is prepared: Tris3g, glycine 14.4g, SDS1g, add water and be settled to 1L. Front 15min, 100V, then just run voltage modulated 150V about plastic hole to sample and terminated.
3) transferring film agents useful for same is prepared
Transferring film liquid (1L): Tris3g, glycine 14.4g, methyl alcohol 200mL, is settled to 1L.
TBST (1L): 10 �� TBS100mL, Tween-20 (0.05%V/V) 0.5mL, ddH2O is settled to 1L.
10 �� TBS (100mL): ddH2O75mL adds NaCl8.8g after dissolving Tris1.212g, with dense HCl adjust pH to 8.0 after dissolving, and ddH2O is settled to 100mL.
4) prepare before film: band gloves cut the NC film of one piece of size same with glue and the filter paper of 4; NC film, filter paper, one piece, two sponges are immersed in transfer buffer at least 5min (it should be noted that sponge must be made to soak completely).
5) order during transferring film: (-) blackboard--2, sponge filter paper-blob of viscose-NC film-2 filter paper-sponges-red plate (+), it is ensured that eliminate bubble. 100V transferring film 1 hour, is placed in ice chest by trough.
6) taking out NC film, be immersed in 20mL confining liquid, shaking table is adjusted to 80rpm, shakes 1 hour under room temperature.
7) add primary antibodie (anti-flag, purchased from Sigma, catalog number: F3165-1MG) by 1:5000 multiple, NC film is added 37 DEG C of 80g in this mixed solution and shakes 1 hour. TBST washes 3 times, each 10min.
8) adding two anti-(GoatAnti-MouselgG-HRP, purchased from Sigma, Code:M210015, Lot:254466) by the dilution of 1:10000 multiple, under room temperature, shaking table is adjusted to 80g and shakes 1 hour. TBST washes 3 times, each 10min.
9) adding chromogenic substrate BCIP/NBT, at darkroom compressing tablet 1min-10min, colour developing is to occurring being wanted band. Film is put into clear water termination reaction.
Experiment compares to proceed to the cotton of pSPT-02 empty carrier as zero load simultaneously, using not genetically modified cotton variety Ji cotton 169 as wild type control (WT).
Result shows, and at T2 in 10 GbAt11 transgenic lines, the object band of 25KD detected, and does not occur in wild type control and unloaded comparison. This result is consistent with expected results. Wherein T2 for GbAt11 transgenic line L241 and wild type control (WT) Westernblot result as shown in Figure 6.
Two, the disease resistance qualification of GbAt11 transgene cotton
1, Huang wither bacterium spore liquid detection
10 T2 step one qualification growing 2 weeks obtained, for GbAt11 transgenic positive plant shoots, soak and wither bacterium V in Huang991(spore concentration dilution is 1 �� 10 to spore suspension6/ mL) in, observe plant forms after 24h and add up disease index (disease index=(1 �� I level strain number+2 �� II level strain number+3 �� III level strain number+4 �� IV level strain number)/(4 �� investigation strain number) �� 100, the grade scale of I level-IV level see " Zhu Heqin; Feng Zili; Li Zhifang etc. vermiculite sandy soil bottomless bowl of paper quantitatively dip in bacterium liquid method qualification cotton variety (being) greensickness-resistance. China cotton; 2010,37 (12) " one literary composition). Experiment compares to proceed to the cotton of pSPT-02 empty carrier as zero load simultaneously, using not genetically modified cotton variety Ji cotton 169 as wild type control (WT). Often organize Setup Experiments 30 parallel controls to observe.
Result shows, and after 24h, wild type seedlings is wilted very serious, and comparatively speaking, T2 relatively unfolds (in Fig. 7 A) for the seedling leaf in GbAt11 transfer-gen plant. The disease index statistics of each plant shows that the disease index of T2 for GbAt11 transfer-gen plant is significantly lower than wild type control (P < 0.05), as shown in B in Fig. 7. And the phenotype of unloaded comparison seedling and disease index are basically identical compared with wild-type, no difference of science of statistics. This result illustrates that GbAt11 transgene cotton improves the resistance of the bacterium that withered by Huang.
2, Huang withers verticillium toxin Protein Detection
Get 10 T2 that step one qualification obtains for GbAt11 transgenic positive plant, not genetically modified cotton variety Ji cotton 169 (wild type control, WT), proceed in the cotton (unloaded comparison) of pSPT-02 empty carrier and disease-resistant cotton variety and plant cotton No. 2 (disease-resistant comparison) close blades of size, soak simultaneously and wither in verticillium toxin albumen VdALP991 (concentration is 0.06 �� g/ �� L) solution in Huang, after 48h, observe leaf morphology. Often organize Setup Experiments 5 parallel controls.
Result shows, and finds that wild type cotton blade turns yellow from edge, and T2 is all still blackish green (in Fig. 7 C) for GbAt11 transgenic positive plant and disease-resistant comparison plant leaf after process 48h. And the phenotype of unloaded comparison seedling is basically identical compared with wild-type, no difference of science of statistics. This result illustrates that withered by the Huang toxin VdAL that withers that causes of bacterium of GbAt11 transgene cotton has certain resistibility.
Three, GbAt11 transgene cotton field proterties statistics
10 T2 obtained with step one qualification are for GbAt11 transgenic positive plant, not genetically modified cotton variety Ji cotton 169 (wild type control, WT) cotton (unloaded comparison) of pSPT-02 empty carrier, is proceeded to, and to plant cotton No. 2 (disease-resistant comparison, RCK) in disease-resistant cotton variety be experiment material. The bell later stage is tied, the strain height of the different strain of statistics and knot bell number in cotton. Statistics at least 30 strains of each strain.
Result is such as display, and the strain height of different GbAt11 transgenic line is slightly different, except L179 with L185 compared with wild-type slightly short, all the other basic consistent with wild-type height (in Fig. 8 A). Compared with wild-type, the knot bell number of GbAt11 transgenic line all significantly improves (P < 0.05), the knot bell number of L179 and L185 even than in plant cotton No. 2 (disease-resistant comparison) taller (in Fig. 8 B). In addition, the present inventor has also investigated and has withered the T2 of plantation in bacterium sick soil for GbAt11 transgene cotton phenotype (in Fig. 8 C) at Shandong Huang, and wild type cotton is that disease-resistant situation or velveteen output all will less than T2 for the output of cottons of GbAt11 transgenic and disease-resistant comparison.
In sum, GbAt11 gene is proceeded in upland cotton, not only increase upland cotton and Huang is withered the resistance of bacterium, and the output for cotton is also improved to some extent.
The acquisition of embodiment 3, GbAt11 transgenic arabidopsis and functional analysis
One, the acquisition of GbAt11 transgenic arabidopsis and qualification
1, the acquisition of recombinant expression vector super1300-MYC-GbAt11
Designing primer At11-Sal1 and At11-KpnI according to GbAt11cDNA sequence (sequence 2), sequence is as follows:
At11-Sal1:5'-CGGTCGACWhat ATGTCGATCGCGTTGGAACG-3'(underscore marked is SalI enzyme recognition site, and sequence thereafter is the 1st of sequence 2 to the 20th);
At11-KpnI:5'-CGGGTACCWhat GTTATATTCACGTACATCAGCC-3'(underscore marked is KpnI enzyme recognition site, and sequence thereafter is the reverse complementary sequence of the 744th to the 765th of sequence 2).
Taking the recombinant plasmid pMD18-GbAt11 of embodiment 1 gained as template, carry out pcr amplification with primer At11-Sal1 and At11-KpnI.
Gained PCR primer is carried out agarose gel electrophoresis after terminating by reaction. Result shows, and gained PCR primer size is about 768bp. The fragment SalI obtain amplification and KpnI double digestion, be inserted into the endonuclease bamhi obtained between SalI and the KpnI enzyme recognition site of super1300-MYC carrier, obtain recombinant vectors. Correctly (the object band that size is about 768bp will be obtained through adopting primer At11-Sal1 and At11-KpnI to carry out PCR preliminary evaluation, see Fig. 9) recombinant vectors send sample to check order, be the recombinant vectors called after super1300-MYC-GbAt11 of DNA fragmentation shown in the 1-765 position of sequence 2 by showing that small segment between by restriction enzyme site SalI and KpnI of super1300-MYC carrier is replaced through order-checking.
In recombinant expression vector super1300-MYC-GbAt11, starting the promotor that described GbAt11 gene (sequence 2) transcribes is Super promotor.
2, arabidopsis thaliana transformation
A. transformation Agrobacterium competent cell
Carry out described in A in embodiment 2 step one 2.
Pcr amplification qualification will be carried out through primer At11-Sal1 and At11-KpnI (sequence is the same) and show the recombinational agrobacterium called after GV3101/super1300-MYC-GbAt11 containing GbAt11 gene (PCR object stripe size is about 768bp).
The comparison proceeding to super1300-MYC empty carrier in agrobacterium strains GV3101 is set simultaneously. The recombinational agrobacterium called after GV3101/super1300-MYC of super1300-MYC empty carrier will be proceeded to.
B. pollen tube pathway arabidopsis thaliana transformation and positive plant screening
(1) being received by recombinational agrobacterium GV3101/super1300-MYC-GbAt11 in YEB liquid nutrient medium that 5mL contains 50mg/L kantlex and rifomycin, 28 DEG C of shaking table 180rpm shake about 24h.
(2) being switched in the YEB liquid nutrient medium that 500mL contains 50mg/L kantlex and rifomycin by the bacterium liquid shaken, shaking bacterium in a large number to OD600 is about 0.8.
(3) supercentrifuge 6000rpm room temperature collection bacterium 10min.
(4) 100mL conversion fluid (formula: 0.22gMS powder, 5g sucrose, 40 �� LSilwet-77, ddH is added respectively2O holds 100mL surely) suspend precipitation.
(5) disposable glove, culture dish and black plastic bag is got out, to, in greenhouse, being poured in culture dish by Agrobacterium suspension.
(6) the Col type Arabidopis thaliana inflorescence of bolting about 5-7 days is immersed in 30min in the bacteria suspension in culture dish, then puts moisturizing with disposable glove, finally put black plastic bag, under dark, cultivate 24h.
(7) removing black plastic bag, throw off disposable glove after normal CMC model 24h, normal CMC model is to gathering in the crops seed.
(8) because Super-1300-Myc carrier is with hygromycin resistance selection markers, so T1 generation and T2 are carried out the screening of positive seedling for planting seed in the MS culture dish containing 30mg/L Totomycin.
Adopt same method recombinational agrobacterium GV3101/super1300-MYC to transform Col type Arabidopis thaliana, obtain the Arabidopis thaliana proceeding to super1300-MYC empty carrier.
3, the qualification of GbAt11 transgenic arabidopsis
The T2 that extraction step 2 obtains is for the DNA of GbAt11 transgenic hygromycin-resistant plant. Taking gained DNA as template, carry out pcr amplification with primer At11-Sal1 and At11-KpnI (sequence is the same) for GbAt11 gene.
Reaction carries out 1% agarose gel electrophoresis detection after terminating.
Experiment compares to proceed to the hygromycin resistance Arabidopis thaliana of super1300-MYC empty carrier as zero load simultaneously, using not genetically modified Col type Arabidopis thaliana as wild type control (WT), using super1300-MYC carrier as positive control.
Result shows, and the T2 that step 2 obtains is for GbAt11 transgenic hygromycin-resistant plant, all identical with plasmid positive control, amplifies size and is about 768bp object band. And wild type control and unloaded comparison all do not amplify object band. From the GbAt11 transgenic arabidopsis that qualification is positive, choose two strains at random, it is designated as Atl1-Myc-1 and Atl1-Myc-3 respectively, detects for follow-up disease resistance.
Two, the disease resistance qualification of GbAt11 transgenic arabidopsis
T2 step one qualification growing 2 weeks obtained, for the seedling of GbAt11 transgenic positive plant Atl1-Myc-1 and Atl1-Myc-3, soaks and withers bacterium V in Huang991(spore concentration dilution is 1 �� 10 to spore suspension6/ mL) in, observe plant forms after 24h. Experiment compares to proceed to the Arabidopis thaliana of super1300-MYC empty carrier as zero load simultaneously, using not genetically modified Col type Arabidopis thaliana as wild type control (Col). Often organize Setup Experiments 3 parallel.
Result shows, and after 24h, wild type seedlings is wilted very serious, and comparatively speaking, T2 relatively unfolds (Figure 10) for the seedling leaf in GbAt11 transfer-gen plant.And the phenotype of unloaded comparison seedling is basically identical compared with wild-type. This result illustrates that GbAt11 transgenic arabidopsis improves the resistance of the bacterium that withered by Huang.
Claims (14)
1. protein, the protein being made up of the aminoacid sequence shown in sequence in sequence table 1.
2. encode the nucleic acid molecule of protein described in claim 1.
3. nucleic acid molecule according to claim 2, it is characterised in that: described nucleic acid molecule is the gene of protein described in coding claim 1; Described gene is encoding sequence is the DNA molecular shown in sequence 2 in sequence table.
4. contain the recombinant vectors of nucleic acid molecule described in Claims 2 or 3.
5. contain the expression cassette of nucleic acid molecule described in Claims 2 or 3.
6. contain the restructuring bacterium of nucleic acid molecule described in Claims 2 or 3.
7. recombinant vectors according to claim 4, it is characterised in that: described recombinant vectors is recombinant expression vector or recombinant cloning vector.
8. recombinant vectors according to claim 7, it is characterised in that: in described recombinant expression vector, the promotor transcribed starting described gene is Super promotor.
9. application in arbitrary as follows of the nucleic acid molecule described in protein according to claim 1 or Claims 2 or 3 or the recombinant vectors described in claim 4 or 7 or 8 or expression cassette according to claim 5 or restructuring bacterium according to claim 6:
(a1) regulating plant is to the resistance of verticillium;
(a2) plant variety that the resistance of verticillium is strengthened by seed selection;
(a3) output of regulating plant;
(a4) plant variety of seed selection output increased.
10. application according to claim 9, it is characterised in that: the pathogenic bacteria of described verticillium is that Huang withers bacterium.
11. application according to claim 9 or 10, it is characterised in that: described plant is dicotyledons or monocotyledons.
The resistance enhancing of verticillium or/and the method for the transgenic plant of output increased, is comprised the steps: by 12. cultivations
A) in object plant, import the encoding gene of protein described in claim 1, obtain expressing the transgenic plant of described encoding gene;
B) obtain from step a) gained transgenic plant compared with described object plant, the resistance of verticillium is strengthened or/and the transgenic plant of output increased.
13. methods according to claim 12, it is characterised in that: the pathogenic bacteria of described verticillium is that Huang withers bacterium.
14. methods according to claim 12 or 13, it is characterised in that: described plant is dicotyledons or monocotyledons.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410312015.1A CN104086636B (en) | 2014-07-02 | 2014-07-02 | Derive from the resisting verticillium albumen of sea island cotton and encoding gene thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410312015.1A CN104086636B (en) | 2014-07-02 | 2014-07-02 | Derive from the resisting verticillium albumen of sea island cotton and encoding gene thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104086636A CN104086636A (en) | 2014-10-08 |
| CN104086636B true CN104086636B (en) | 2016-06-08 |
Family
ID=51634420
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410312015.1A Active CN104086636B (en) | 2014-07-02 | 2014-07-02 | Derive from the resisting verticillium albumen of sea island cotton and encoding gene thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104086636B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105238789B (en) * | 2015-11-16 | 2017-12-29 | 河北农业大学 | Sea island cotton GbHyPRP1 gene promoters and its application |
| CN106011098B (en) * | 2016-05-24 | 2019-07-02 | 中国农业科学院棉花研究所 | A kind of cotton disease resistance GAP-associated protein GAP GaGSTF2 and its encoding gene and application |
| CN106282200B (en) * | 2016-08-19 | 2019-12-03 | 河南大学 | Application of the sea island cotton GbNAC1 in resisting verticillium |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004060051A2 (en) * | 2003-01-07 | 2004-07-22 | Hazera Genetics Ltd. | Hybrid cotton plants and seeds, and methods and systems of generating same |
| CN1740190A (en) * | 2005-09-05 | 2006-03-01 | 中国农业大学 | Gossypium barbadense lipoid transition protein and its coding gene and application |
| CN102154296A (en) * | 2011-02-22 | 2011-08-17 | 江苏省农业科学院 | Promoter efficiently expressing in cotton root and application thereof |
| CN102229938A (en) * | 2011-06-17 | 2011-11-02 | 江苏省农业科学院 | Gene Gbvdr5 giving verticillium resistance in plants and use thereof |
-
2014
- 2014-07-02 CN CN201410312015.1A patent/CN104086636B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004060051A2 (en) * | 2003-01-07 | 2004-07-22 | Hazera Genetics Ltd. | Hybrid cotton plants and seeds, and methods and systems of generating same |
| CN1740190A (en) * | 2005-09-05 | 2006-03-01 | 中国农业大学 | Gossypium barbadense lipoid transition protein and its coding gene and application |
| CN102154296A (en) * | 2011-02-22 | 2011-08-17 | 江苏省农业科学院 | Promoter efficiently expressing in cotton root and application thereof |
| CN102229938A (en) * | 2011-06-17 | 2011-11-02 | 江苏省农业科学院 | Gene Gbvdr5 giving verticillium resistance in plants and use thereof |
Non-Patent Citations (1)
| Title |
|---|
| Cloning and characterization of a Verticillium wilt resistance gene from Gossypium barbadense and functional analysis in Arabidopsis thaliana.;Zhang Y.等;《Plant Cell Rep.》;20111130;第30卷(第11期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104086636A (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101855355B (en) | There is the plant of the Correlated Yield Characters of raising and the method for preparing this plant | |
| CN102656270B (en) | Plants having enhanced yield-related traits and a method for making the same | |
| EP1941045B1 (en) | Use of a nucleic acid sequence for the generation of a transgenic plant having enhanced drought tolerance | |
| ES2440265T3 (en) | Plants that have an increase in performance-related characteristics and a method for making them | |
| CN101173002B (en) | Plants stress tolerance correlation transcription factor GmWRKY54, encoding gene and application thereof | |
| CN102803291B (en) | There is the plant of the Correlated Yield Characters of enhancing and/or the abiotic stress tolerance of enhancing and prepare its method | |
| AU1767101A (en) | Yield-related genes | |
| CN103261422A (en) | Drought tolerant plants and related constructs and methods involving genes encoding dtp6 polypeptides | |
| MX2010010735A (en) | Plants having enhanced yield-related traits and a method for making the same. | |
| CN101952443B (en) | Drought tolerant plants and related constructs and methods involving genes encoding miR827 | |
| CN104004767A (en) | WRKY transcription factor polypeptide gene application vector and method thereof | |
| CN104093842A (en) | Improving plant drought tolerance, nitrogen use efficiency and yield | |
| CN110818782A (en) | Lilium regale WRKY transcription factor gene LrWRKY3 and application thereof | |
| CN102459615B (en) | Drought tolerant plants | |
| CN102105590B (en) | Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving genes encoding LNT1 polypetides and homologs thereof | |
| CN104086636B (en) | Derive from the resisting verticillium albumen of sea island cotton and encoding gene thereof and application | |
| CN102149818A (en) | Plants with altered root architecture, related constructs and methods involving genes encoding protein phophatase 2C (PP2C) polypeptides and homologs thereof | |
| CN103503777B (en) | The carrier of glutamate receptor polypeptide gene application and method | |
| CN107974459A (en) | Improve the construct and method of plant abiotic stress tolerance | |
| ES2423209T3 (en) | Plants that have an increase in performance-related characteristics and a method for making them | |
| US10851382B2 (en) | Synthetic promotor induced by abiotic stress, genetic construct containing same and plant cells transformed therewith | |
| EP2044107A1 (en) | Use of plant chromatin remodeling genes for modulating plant architecture and growth | |
| CN103172716B (en) | Heat-resistant plant gene and application thereof | |
| CN107417780B (en) | Application of UBC32 protein and coding gene thereof in regulation and control of plant drought tolerance | |
| CN102348803A (en) | Drought tolerant plants and methods involving genes encoding type c3hc4 ring finger zinc-finger family polypeptides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |