CN104073547A - Kit and identification method for molecules of five Sinipercinae fishes - Google Patents
Kit and identification method for molecules of five Sinipercinae fishes Download PDFInfo
- Publication number
- CN104073547A CN104073547A CN201310096677.5A CN201310096677A CN104073547A CN 104073547 A CN104073547 A CN 104073547A CN 201310096677 A CN201310096677 A CN 201310096677A CN 104073547 A CN104073547 A CN 104073547A
- Authority
- CN
- China
- Prior art keywords
- mandarin fish
- primer
- fish
- dna
- mandarin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit and an identification method for molecules of five Sinipercinae fishes. The kit comprises three pairs of SSR primers and standard maps. The identification method for molecules of five Sinipercinae fishes by using the kit comprises the following steps: 1) DNA extraction: a step of acquiring the fin ray or muscle tissue of a to-be-tested Siniperca chuatsi sample, extracting genome DNA and measuring the purity and concentration of the genome DNA; 2) DNA fragment amplification: a step of amplifying the genome DNA of the to-be-tested sample by using a polymerase chain reaction; 3) electrophoresis and silver staining identification of PCR products: a step of carrying out electrophoretic separation on the PCR products by using nondenaturing polyacrylamide gel, then carrying out staining by using a conventional silver staining method and taking photos to record electrophoresis results; and 4) comparison with the standard maps. The kit and the identification method provided by the invention can substantially improve efficiency and accuracy of identification of important economic and rare varieties of Sinipercinae and are beneficial for protection of genetic resources of Sinipercinae fishes and sustained sound development of the breeding industry of Siniperca chuatsi.
Description
Technical field
The invention belongs to the natural germ plasm resource authenticate technology of aquaculture fingerling and aquatic animal field, be specifically related to a kind of test kit for five kinds of mandarin fish subfamily fish molecules, also relate to the authentication method of a kind of test kit for five kinds of mandarin fish subfamily fish molecules simultaneously.
Background technology
Mandarin fish subfamily is subordinate to Perciformes, is naturally only distributed in East Asia (Russia, Japan, Korea S, China and Vietnam (Red River)).In mandarin fish subfamily, stick up mouth mandarin fish (Siniperca chuatsi Basilewsky), large eye mandarin fish (Siniperca kneri Garman) and a spot mandarin fish (S iniperca scherzeri Steindachner) mainly cultivate famous and precious fish for China, their life habits are basic identical, and resemblance is similar.Above three kinds of economic mandarin fishes are in breeding process, and the stage of growing seedlings cannot differentiate according to morphology, though especially stick up mouth mandarin fish with large eye mandarin fish in fingerling and adult fish stage, morphology means are also difficult for differentiating.The few squama mandarin fish (Coreoperca whiteheadi Boulenger) of China and ripple mandarin fish (Siniperca undulate Fang & Chong) are rare species in mandarin fish subfamily, fine and tender taste, delicious flavour, the seed stage is all difficult for differentiating.
The simple reiterated DNA sequences of what micro-satellite was made up of 2-6 Nucleotide have variability.It is distributed in Eukaryotic whole genome, have allelotrope number many, reproducible, be the features such as codominant inheritance, be widely used in the research of the aspects such as species qualifications and the assignment of genes gene mapping.Except sticking up mouth mandarin fish and spot mandarin fish, still lack the relevant report that adopts micro-satellite molecule identification method to carry out five kinds of mandarin fish subfamily fish qualifications at present.
Summary of the invention
The present invention seeks to be to provide a kind of test kit for five kinds of mandarin fish subfamily fish molecules; efficiency and the accuracy between mandarin fish subfamily Important Economic, rare kind, identified be can significantly improve, the protection of mandarin fish subfamily fish genetic resource and the sustainable and healthy development of mandarin fish aquaculture contributed to.Use this test kit; can make up the deficiency of Morphological Identification; solve a difficult problem for three kinds of common cultivation mandarin fish classes (sticking up mouth mandarin fish, large eye mandarin fish and spot mandarin fish) seed qualification in aquaculture; solve the problem that mandarin fish subfamily rare species (the few squama mandarin fish of China and ripple mandarin fish) kind is differentiated, thereby promoted the Reasonable Protection of mandarin fish subfamily genetic resources and the sound development of aquaculture.
Another object of the present invention is to be to provide the authentication method of a kind of test kit for five kinds of mandarin fish subfamily fish molecules, and easy to implement the method, easy and simple to handle, determination rates is high, accuracy good.The method uses microsatellite molecular marker to differentiate that mandarin fish subfamily mainly cultivates kind (sticking up mouth mandarin fish, large eye mandarin fish and spot mandarin fish) and rare species (the few squama mandarin fish of China and ripple mandarin fish), is beneficial to the reasonable management of mandarin fish subfamily cultured population and the protection of wild resource.
In order to realize above-mentioned object, the present invention adopts following technical measures:
For a test kit for five kinds of mandarin fish subfamily fish molecules, it comprises three pairs of SSR primers and standard diagram, is wherein respectively for three pairs of primer sequences of polymerase chain reaction:
Primer 1 forward sequence: 5 ' TACATGCACACCAGTACGG3 ',
Primer 1 reverse sequence: 5 ' ACCCCGTTAAGTCCACGTC3 ';
Primer 2 forward sequence: 5 ' TAAGTGTACAAAGAACTTTTCGC3 ',
Primer 2 reverse sequence: 5 ' ACAATGTAAAAGTTTGGTTCAGC3 ';
Primer 3 forward sequences: 5 ' ATCAGCTCAACCCCTCTGCA3 ',
Primer 3 reverse sequences: 5 ' GCATGGATGCCAGCGTGA3 ';
For differentiating that the standard diagram of five kinds of mandarin fish subfamily fish is:
Micro-satellite band spectrum schematic diagram (Fig. 1) of the Some Species mandarin fish subfamily fish that a kind of primer 1 increases; Micro-satellite band spectrum schematic diagram (Fig. 2) of a kind of Some Species mandarin fish subfamily fish of primer 2 amplification; Micro-satellite band spectrum schematic diagram (Fig. 3) of the Some Species mandarin fish subfamily fish that a kind of primer 3 increases.
Test kit, for an authentication method for the molecule of five kinds of mandarin fish subfamily fish, the steps include:
1) DNA extraction: gather fin ray or the muscle tissue of mandarin fish sample to be measured, extract genomic dna and measure its purity and concentration; In this step, record the A of DNA
260/ A
280ratio is 1.82-1.97.
2) DNA fragmentation amplification: adopt polymerase chain reaction (PCR) amplification testing sample genomic dna, amplimer sequence is:
Primer 1 forward sequence: 5 ' TACATGCACACCAGTACGG3 ',
Primer 1 reverse sequence: 5 ' ACCCCGTTAAGTCCACGTC3 ';
Primer 2 forward sequence: 5 ' TAAGTGTACAAAGAACTTTTCGC3 ',
Primer 2 reverse sequence: 5 ' ACAATGTAAAAGTTTGGTTCAGC3 ';
Primer 3 forward sequences: 5 ' ATCAGCTCAACCCCTCTGCA3 ',
Primer 3 reverse sequences: 5 ' GCATGGATGCCAGCGTGA3 ';
The concentration range that records DNA in this step is 585.5-3210.4ng/ μ l.
In this step, PCR response procedures is: 94 DEG C of denaturation 4min, then carry out 35 circulations by following condition: 94 DEG C of 30s, 55 DEG C of annealing 45s, 72 DEG C are extended 1min, and after loop ends, 72 DEG C are extended 10min and finish, and preserve in 4 DEG C.
3) electrophoresis of PCR product and silver dyeing qualification: PCR product is carried out to electrophoretic separation with non-denaturing polyacrylamide gel, after conventional argentation dyeing, Taking Pictures recording electrophoresis result;
In this step, PCR reaction system is:
In this step, adopt 8% non-denaturing polyacrylamide gel.
4) contrast with standard diagram: use primer 1, as sample amplifies 1 DNA band in the 300bp position near standard Marker, be accredited as few squama mandarin fish; Use primer 1, amplify 1 specific band in the 180bp position near standard Marker, be accredited as spot mandarin fish; Use primer 2, as sample amplifies 1 or 2 DNA bands in the 200bp position near standard Marker, be accredited as ripple mandarin fish; Use primer 3, as sample amplifies 1 DNA band in the 120bp position near standard Marker, be accredited as and stick up mouth mandarin fish; Use primer 3, as sample amplifies 1 DNA band in the 120bp position near standard Marker, be accredited as large eye mandarin fish.
Described 4) while using primer 1 and primer 2 in step, testing sample is five kinds of mandarin fish subfamily fish: stick up any one in mouth mandarin fish, large eye mandarin fish, spot mandarin fish, the few squama mandarin fish of China and ripple mandarin fish.
Described 4) while using primer 3 in step, testing sample for stick up mouth mandarin fish or large eye mandarin fish any one.
The invention has the advantages that:
Mandarin fish subfamily is subordinate to Perciformes, and NATURAL DISTRIBUTION is (Russia, Japan, Korea S, China and Vietnam (Red River)) in East Asia.In mandarin fish subfamily, stick up mouth mandarin fish (Siniperca chuatsi Basilewsky), large eye mandarin fish (Siniperca kneri Garman) and a spot mandarin fish (Sini perca scherzeri Steindachner) mainly cultivate famous and precious aquatic products kind for China, their life habits are basic identical, and resemblance is similar.Above three kinds of economic mandarin fishes are in breeding process, and the stage of growing seedlings cannot differentiate according to morphology, though especially stick up mouth mandarin fish with large eye mandarin fish in fingerling and adult fish stage, morphology means are also difficult for differentiating.The few squama mandarin fish (Coreoperca whitehead i Boulenger) of China and ripple mandarin fish (Siniperca undulate Fang & Chong) are the rare species in mandarin fish subfamily, fine and tender taste, delicious flavour, the seed stage is all difficult for differentiating.
The simple reiterated DNA sequences of what micro-satellite was made up of 2-6 Nucleotide have variability.It is distributed in the whole genome of eukaryote, have allelotrope number many, reproducible, be the features such as codominant inheritance, be widely used in the research of the aspects such as species qualifications and the assignment of genes gene mapping.Except sticking up mouth mandarin fish and spot mandarin fish, still lack the relevant report that adopts micro-satellite molecule identification method to carry out five kinds of mandarin fish subfamily fish qualifications at present.
The present invention adopts micro-satellite labeling technique to differentiate five kinds of mandarin fish subfamily fish, and its stable reaction is reproducible, has suitability widely; Compared with traditional Morphological Identification, there is detection time few, detection accuracy high.The present invention can make up the deficiency of Morphological Identification; solve three kinds of common cultivation mandarin fish classes (sticking up mouth mandarin fish, large eye mandarin fish and spot mandarin fish) seed qualification difficult problem in aquaculture; solve mandarin fish subfamily rare species (the few squama mandarin fish of China and ripple mandarin fish) kind and differentiate problem, thereby promote the Reasonable Protection of mandarin fish subfamily genetic resources and the sound development of aquaculture.Therefore, the present invention has higher industrialization prospect, and actual operation is strong, easy, accurate, moderate cost.
Brief description of the drawings
Fig. 1 is micro-satellite band spectrum schematic diagram of a kind of primer 1 Some Species mandarin fish subfamily fish of increasing.
Spot mandarin fish, few squama mandarin fish (stick up mouth mandarin fish with other three kinds of mandarin fishes respectively, large eye mandarin fish and ripple mandarin fish) amplify Bu Tong big or small DNA band, spot mandarin fish sample amplifies 1 specific band in the 180bp position near standard Marker, few squama mandarin fish sample amplifies 1 DNA band in the 300bp position near standard Marker, stick up mouth mandarin fish, large eye mandarin fish and ripple mandarin fish sample respectively amplify 1 specific band in the 140bp position near standard Marker, can tell spot mandarin fish and few squama mandarin fish according to the position difference of amplification sample.
Fig. 2 is micro-satellite band spectrum schematic diagram of a kind of Some Species mandarin fish subfamily fish of primer 2 amplification.
Ripple mandarin fish and other two kinds of mandarin fishes (stick up mouth mandarin fish, large eye mandarin fish) amplify the DNA bands of different sizes, ripple mandarin fish sample amplifies 1 or 2 specific bands in the 200bp position near standard Marker, stick up mouth mandarin fish and respectively amplify 1 or 2 specific bands in the 140bp position near standard Marker with a large eye mandarin fish sample, can tell ripple mandarin fish according to the position difference of amplification sample.
Fig. 3 is micro-satellite band spectrum schematic diagram of a kind of primer 3 Some Species mandarin fish subfamily fish of increasing.
Stick up the DNA band that mouth mandarin fish and large eye mandarin fish amplify different sizes, stick up mouth mandarin fish sample and amplify 1 specific band in the 120bp position near standard Marker, large eye mandarin fish sample amplifies 1 specific band in the 140bp position near standard Marker, can tell and stick up mouth mandarin fish and large eye mandarin fish according to the position difference of amplification sample.
Embodiment
Embodiment 1:
For a test kit for five kinds of mandarin fish subfamily fish molecules, it comprises three pairs of SSR primers and standard diagram, is wherein respectively for three pairs of primer sequences of polymerase chain reaction:
Primer 1 forward sequence: 5 ' TACATGCACACCAGTACGG3 ',
Primer 1 reverse sequence: 5 ' ACCCCGTTAAGTCCACGTC3 ';
Primer 2 forward sequence: 5 ' TAAGTGTACAAAGAACTTTTCGC3 ',
Primer 2 reverse sequence: 5 ' ACAATGTAAAAGTTTGGTTCAGC3 ';
Primer 3 forward sequences: 5 ' ATCAGCTCAACCCCTCTGCA3 ',
Primer 3 reverse sequences: 5 ' GCATGGATGCCAGCGTGA3 ';
For differentiating that the standard diagram of five kinds of mandarin fish subfamily fish is:
Micro-satellite band spectrum schematic diagram (Fig. 1) of the Some Species mandarin fish subfamily fish that a kind of primer 1 increases, the spot mandarin fish described in figure, the few squama mandarin fish of China amplify Bu Tong big or small DNA band with other three kinds of mandarin fishes (sticking up mouth mandarin fish, large eye mandarin fish and ripple mandarin fish) respectively.Spot mandarin fish sample amplifies 1 specific band in the 180bp position near standard Marker, the few squama mandarin fish sample of China amplifies 1 DNA band in the 300bp position near standard Marker, stick up mouth mandarin fish, large eye mandarin fish and ripple mandarin fish sample and respectively amplify 1 specific band in the 140bp position near standard Marker, can tell the few squama mandarin fish of spot mandarin fish and China according to the position difference of amplification sample.
Micro-satellite band spectrum schematic diagram (Fig. 2) of the Some Species mandarin fish subfamily fish of a kind of primer 2 amplification, the ripple mandarin fish described in figure amplifies different big or small DNA bands with other two kinds of mandarin fishes (sticking up mouth mandarin fish, large eye mandarin fish).Ripple mandarin fish sample amplifies 1 or 2 specific bands in the 200bp position near standard Marker, stick up mouth mandarin fish and respectively amplify 1 or 2 specific bands in the 140bp position near standard Mark er with a large eye mandarin fish sample, can tell ripple mandarin fish according to the position difference of amplification sample.
Micro-satellite band spectrum schematic diagram (Fig. 3) of the Some Species mandarin fish subfamily fish that a kind of primer 3 increases, the DNA band that sticks up mouth mandarin fish and large eye mandarin fish and amplify different sizes described in figure.Stick up mouth mandarin fish sample and amplify 1 specific band in the 120bp position near standard Marker, large eye mandarin fish sample amplifies 1 specific band in the 140bp position near standard Marker, can tell and stick up mouth mandarin fish and large eye mandarin fish according to the position difference of amplification sample.
Test kit, for an authentication method for five kinds of mandarin fish subfamily fish molecules, the steps include:
The extraction of 1.DNA:
Extract genomic dna from every tail fish clip isozyme, and by UV spectrophotometer measuring DNA concentration, the sepharose detection DNA purity that concentration is 1.5%.
2. amplification of DNA fragments:
Be polymerase chain reaction, for three pairs of primed DNA sequences of PCR reaction be:
1) primer 1 forward sequence: 5 ' TACATGCACACCAGTACGG3 ',
Primer 1 reverse sequence: 5 ' ACCCCGTTAAGTCCACGTC3 ';
Primer 2 forward sequence: 5 ' TAAGTGTACAAAGAACTTTTCGC3 ',
Primer 2 reverse sequence: 5 ' ACAATGTAAAAGTTTGGTTCAGC3 ';
Primer 3 forward sequences: 5 ' ATCAGCTCAACCCCTCTGCA3 ',
Primer 3 reverse sequences: 5 ' GCATGGATGCCAGCGTGA3 ';
2) PCR reaction system is as follows:
Mix centrifugal
3) PCR response procedures is: 94 DEG C of denaturation 4min, then carry out 35 circulations by following condition: 94 DEG C of 30s, 55 DEG C of annealing 45s, 72 DEG C are extended 1min, and after loop ends, 72 DEG C are extended 10min and finish, and preserve in 4 DEG C.
The electrophoresis of 3.PCR product and silver dyeing qualification:
1) PCR product carries out electrophoretic separation with 8.0% non-denaturing polyacrylamide gel, after argentation dyeing, and Taking Pictures recording electrophoresis result.
2) electrophoretogram shows, uses primer 1, as sample amplifies 1 DNA band in the 300bp position near standard Marker, is accredited as few squama mandarin fish; Use primer 1, amplify 1 specific band in the 180bp position near standard Marker, be accredited as spot mandarin fish; Use primer 2, as sample amplifies 1 or 2 DNA bands in the 200bp position near standard Marker, be accredited as ripple mandarin fish; Use primer 3, as sample (sticking up mouth mandarin fish or large eye mandarin fish) amplifies 1 DNA band in the 120bp position near standard Marker, be accredited as and stick up mouth mandarin fish; Use primer 3, as sample amplifies 1 DNA band in the 120bp position near standard Marker, be accredited as large eye mandarin fish.Correlated results is asked for an interview Fig. 1,2 and 3 detailed discussion.
Claims (4)
1. for a test kit for five kinds of mandarin fish subfamily fish molecules, it comprises three pairs of SSR primers and standard diagram, is wherein respectively for three pairs of primer sequences of polymerase chain reaction:
Primer 1 forward sequence: 5 ' TACATGCACACCAGTACGG3 ',
Primer 1 reverse sequence: 5 ' ACCCCGTTAAGTCCACGTC3 ';
Primer 2 forward sequence: 5 ' TAAGTGTACAAAGAACTTTTCGC3 ',
Primer 2 reverse sequence: 5 ' ACAATGTAAAAGTTTGGTTCAGC3 ';
Primer 3 forward sequences: 5 ' ATCAGCTCAACCCCTCTGCA3 ',
Primer 3 reverse sequences: 5 ' GCATGGATGCCAGCGTGA3 ';
For differentiating that the standard diagram of five kinds of mandarin fish subfamily fish is:
Micro-satellite band spectrum of the Some Species mandarin fish subfamily fish that a kind of primer 1 increases; Micro-satellite band spectrum of a kind of Some Species mandarin fish subfamily fish of primer 2 amplification; Micro-satellite band spectrum of the Some Species mandarin fish subfamily fish that a kind of primer 3 increases.
2. a kind of test kit claimed in claim 1, for the authentication method of the molecule of five kinds of mandarin fish subfamily fish, the steps include:
1) DNA extraction: gather fin ray or the muscle tissue of mandarin fish sample to be measured, extract genomic dna and measure its purity and concentration; Record the A of DNA
260/ A
280ratio is 1.82-1.97;
2) DNA fragmentation amplification: adopt polymerase chain reaction (PCR) amplification testing sample genomic dna, amplimer sequence is:
Primer 1 forward sequence: 5 ' TACATGCACACCAGTACGG3 ',
Primer 1 reverse sequence: 5 ' ACCCCGTTAAGTCCACGTC3 ';
Primer 2 forward sequence: 5 ' TAAGTGTACAAAGAACTTTTCGC3 ',
Primer 2 reverse sequence: 5 ' ACAATGTAAAAGTTTGGTTCAGC3 ';
Primer 3 forward sequences: 5 ' ATCAGCTCAACCCCTCTGCA3 ',
Primer 3 reverse sequences: 5 ' GCATGGATGCCAGCGTGA3 ';
The concentration range that records DNA in this step is 585.5-3210.4 ng/ μ l;
PCR response procedures is: 94 DEG C of denaturation 4min, then carry out 35 circulations by following condition: 94 DEG C of sex change 30s, 55 DEG C of annealing 45s, 72 DEG C are extended 1min, and after loop ends, 72 DEG C are extended 10min and finish, and preserve in 4 DEG C;
3) electrophoresis of PCR product and silver dyeing qualification: PCR product is carried out to electrophoretic separation with non-denaturing polyacrylamide gel, after conventional argentation dyeing, Taking Pictures recording electrophoresis result; Adopt 8% non-denaturing polyacrylamide gel;
4) contrast with standard diagram: use primer 1, sample amplifies 1 DNA band in the 300bp position near standard Marker, be accredited as the few squama mandarin fish of China; Use primer 1, amplify 1 specific band in the 180bp position near standard Marker, be accredited as spot mandarin fish; Use primer 2, sample amplifies 1 or 2 DNA bands in the 200bp position near standard Marker, is accredited as ripple mandarin fish; Use primer 3, sample amplifies 1 DNA band in the 120bp position near standard Marker, is accredited as and sticks up mouth mandarin fish; Use primer 3, sample amplifies 1 DNA band in the 120bp position near standard Marker, is accredited as large eye mandarin fish.
3. a kind of test kit according to claim 2, for the authentication method of the molecule of five kinds of mandarin fish subfamily fish, is characterized in that: in described step (3), PCR reaction system is:
A kind of test kit according to claim 2 is for the authentication method of the molecule of five kinds of mandarin fish subfamily fish, it is characterized in that: in described step (4), use primer 1 and primer 2, testing sample is five kinds of mandarin fish subfamily fish: stick up any one in mouth mandarin fish, large eye mandarin fish, spot mandarin fish, the few squama mandarin fish of China and ripple mandarin fish.
4. a kind of test kit according to claim 2, for the authentication method of the molecules of five kinds of mandarin fish subfamily fish, is characterized in that: while using primer 3 in described step (4), testing sample for stick up mouth mandarin fish or a large mandarin fish any one.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310096677.5A CN104073547B (en) | 2013-03-25 | 2013-03-25 | A kind of test kit for five kinds of mandarin fish subfamily fish molecules and authentication method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310096677.5A CN104073547B (en) | 2013-03-25 | 2013-03-25 | A kind of test kit for five kinds of mandarin fish subfamily fish molecules and authentication method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104073547A true CN104073547A (en) | 2014-10-01 |
| CN104073547B CN104073547B (en) | 2016-04-06 |
Family
ID=51595150
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310096677.5A Expired - Fee Related CN104073547B (en) | 2013-03-25 | 2013-03-25 | A kind of test kit for five kinds of mandarin fish subfamily fish molecules and authentication method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104073547B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222271A (en) * | 2016-08-03 | 2016-12-14 | 苏州大学 | A kind of method of microsatellite genetic marker monitoring kind matter |
| CN108913783A (en) * | 2018-07-12 | 2018-11-30 | 镇江华大检测有限公司 | For identifying molecular specificity labeled primers and its application of mandarin fish |
| CN110777210A (en) * | 2019-11-12 | 2020-02-11 | 中山大学 | Siniperca chuatsi male molecular marker primer and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101381768A (en) * | 2008-10-24 | 2009-03-11 | 长沙学院 | Molecular identification method for siniperca chuatsi and siniperca scherzeri and kit |
| CN101381769A (en) * | 2008-10-24 | 2009-03-11 | 长沙学院 | Molecular identification method for siniperca kneri garman and siniperca scherzeri and kit |
-
2013
- 2013-03-25 CN CN201310096677.5A patent/CN104073547B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101381768A (en) * | 2008-10-24 | 2009-03-11 | 长沙学院 | Molecular identification method for siniperca chuatsi and siniperca scherzeri and kit |
| CN101381769A (en) * | 2008-10-24 | 2009-03-11 | 长沙学院 | Molecular identification method for siniperca kneri garman and siniperca scherzeri and kit |
Non-Patent Citations (1)
| Title |
|---|
| 匡刚桥等: "GenBank数据库中鳜鱼微卫星位点的筛选及特征分析", 《动物学报》, vol. 53, no. 1, 31 December 2007 (2007-12-31), pages 184 - 189 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222271A (en) * | 2016-08-03 | 2016-12-14 | 苏州大学 | A kind of method of microsatellite genetic marker monitoring kind matter |
| CN108913783A (en) * | 2018-07-12 | 2018-11-30 | 镇江华大检测有限公司 | For identifying molecular specificity labeled primers and its application of mandarin fish |
| CN110777210A (en) * | 2019-11-12 | 2020-02-11 | 中山大学 | Siniperca chuatsi male molecular marker primer and application thereof |
| CN110777210B (en) * | 2019-11-12 | 2021-07-27 | 中山大学 | Siniperca chuatsi male molecular marker primer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104073547B (en) | 2016-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102134593B (en) | Gender-specific microsatellite marker for Cynoglossus semilaevis and application of same in identification of superfemale Cynoglossus semilaevis | |
| CN104789676B (en) | Kit for distinguishing pelteobagrus fulvidraco, pelteobagrus vachelli and hybrid pelteobagrus fulvidraco and using method thereof | |
| CN105176989B (en) | It is a kind of to differentiate fugu obscurus and the primer and method of Fugu Xanthopterus (Temminck et Schlegel) fry | |
| CN103060318A (en) | SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and application of SSR core primer group | |
| CN113637794B (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| CN104004833A (en) | EST-SSR core primer group developed on basis of transcriptome sequence of towel gourd and application thereof | |
| CN104498604A (en) | Misgurnus anguillicaudatus and paramisgurnus dabryanus specie identification primer and identification method | |
| CN101381768A (en) | Molecular identification method for siniperca chuatsi and siniperca scherzeri and kit | |
| CN106244681A (en) | A kind of method and the application that utilize genome SSR and EST SSR finger printing to differentiate mung bean variety | |
| CN104630335B (en) | Molecular identification method used for siniperca chuatsi, siniperca scherzeri and hybrid f1 of siniperca chuatsi and siniperca scherzeri | |
| CN104073547B (en) | A kind of test kit for five kinds of mandarin fish subfamily fish molecules and authentication method | |
| CN108103219A (en) | A kind of molecular labeling, primer pair and its application for being used to differentiate red bayberry male and female | |
| CN104789691B (en) | A kind of method that Environment of Litopenaeus vannamei Low genetic sex identification is carried out based on One_step PCR technology | |
| CN102876777B (en) | The special primer of brown croaker EST microsatellite marker and screening method | |
| CN106834469A (en) | One main laminaria male gametophyte specific molecular marker and its application | |
| CN106191285A (en) | A kind of method and the application that utilize genome SSR and EST SSR finger printing to differentiate Semen Phaseoli kind | |
| CN103436618A (en) | Aphis gossypii Glover specificity SS-COI primers, kit containing primer and detection method of kit | |
| CN103993070B (en) | A kind of SSR primer for exquisite joint melon hybrid seed purity qualification and method | |
| CN103725785B (en) | Construction method and application of teak clone fingerprint spectrums | |
| CN105349691A (en) | DNA (deoxyribonucleic acid) sequence tag for identifying genetic sex of fenneropenaeus chinensis and application thereof | |
| CN103361340B (en) | Bay scallop thermostable related heat shock protein 70 gene marker and assistant breeding method thereof | |
| CN105400869B (en) | A method of Amaranthus palmeri S. Watson is detected with PCR primer | |
| CN105755117B (en) | The nucleotide primer of Rapid identification angular sponge gourd ' refined green No. 6 ' hybrid seed purity combines and detection method | |
| CN108588244B (en) | Molecular marker for identifying carp, crucian carp and intercrossed carp and crucian carp, primer and application thereof | |
| CN103451185B (en) | Propylaea Japonica specific COI primers, kit containing primer and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160406 Termination date: 20210325 |