CN104073480A

CN104073480A - High-immobilization-tendency heparinase I coding gene and protein thereof

Info

Publication number: CN104073480A
Application number: CN201410316391.8A
Authority: CN
Inventors: 杜宏银; 马小来; 李锂
Original assignee: SHENZHEN HEPALINK PHARMACEUTICAL CO Ltd
Current assignee: SHENZHEN HEPALINK PHARMACEUTICAL CO Ltd
Priority date: 2014-07-04
Filing date: 2014-07-04
Publication date: 2014-10-01

Abstract

The invention discloses a high-immobilization-tendency heparinase I protein and a coding gene thereof. The protein can be efficiently immobilized by chitin. The amino acid sequence of the high-immobilization-tendency heparinase I protein is disclosed as SEQ ID NO:2, and the coding gene of the protein is also within the protection range. The PCR (polymerase chain reaction) technique is superposed and extended to design the heparinase I gene and chitin combination domain to fuse and express the immobilizable heparinase I.

Description

A kind of easily Immobilized heparinase I encoding gene and albumen thereof

Technical field

The present invention relates to the genetic engineering modified of enzyme, specially refer to easy Immobilized heparinase I encoding gene and albumen thereof.

Background technology

Heparinase refers to that a class can specificity cracking heparin and the enzyme of heparitin main chain glycosidic link, finds and separates at first from heparin Flavobacterium, thereafter, finds again also to have heparinase to exist in some microorganisms and animal tissues.Heparinase has functions such as removing remaining heparin in blood, anti-hemostasis-coagulation, the structure of producing Low molecular heparin, research heparin is had to important effect simultaneously.But the easy inactivation of free heparinase, especially Heparinase I solution actively after 96h only has original 23% preserving, in addition, free heparinase need to be added in substrate in the time reacting, after reaction, enzyme solution, substrate mix and are not easy to separate with product, cause heparinase to reuse, the utilising efficiency of enzyme is low, this application that is heparinase brings a lot of inconvenience, therefore, need to find a kind of utilising efficiency that can improve heparinase, the method for shelf time that again can extending enzyme.

Compared with resolvase, immobilized enzyme is in keeping its efficient single-minded and gentle enzymic catalytic reaction characteristic, overcome again the weak point of resolvase, present that package stability is high, Separation and Recovery easily, can be repeatedly used, operate continuously the series of advantages such as controlled, therefore be, a kind of ideal chose that improves result of use to the immobilization of Heparinase I.At present less to the research of being fixed of Heparinase I, [the Bernstein such as Howard Bernstein, H., (1987), Appl.Biochem. Biotech. 16, 129-143] taking CNBr-activated Sepharose 4B as immobilization material, Heparinase I is carried out to the immobilization of covalent cross-linking method, realize the fixing of heparinase, but the immobilization efficiency of the method is low, we adopt result that identical materials and methods obtains can only reach the Heparinase I of the fixing 1IU of every milliliter of material, and taking CNBr-activated Sepharose 4B as immobilization material cost higher.

Through studying for a long period of time, the method that the present inventor's first passage is expressed proceed to engineering bacteria after the gene C end of Heparinase I adds chitin binding domain in, obtain a kind of novel immobilized Heparinase I that is easy to, for realizing efficiently and the immobilization of Heparinase I cheaply becomes possibility.

Summary of the invention

The object of the invention is for a kind of easily Immobilized heparinase I gene and expressing protein are provided.

Heparinase I albumen provided by the present invention, name is called HepA-1-chBD, and its heparinase HepA-1-chBD is the protein with SEQ IDNo:2 amino acid residue sequence in sequence table.

SEQ ID No:2 in sequence table is made up of individual 801 amino-acid residues.

Immobilized heparinase I protein coding gene, name is called HepA-1, and it has one of following nucleotide sequences:

1) DNA sequence dna of SEQ ID NO.1 in sequence table:

2) polynucleotide of SEQ ID No.2 protein sequence in code sequence list;

DNA sequence dna in sequence 1 is by individual 2043 based compositions, and the open reading frame of this gene is from 5 ' end the 1st to the 2043rd bit base.

The primer pair of the arbitrary fragment in this protein coding gene of increasing is also within protection scope of the present invention.

Second object of the present invention is to provide a kind of method of expressing Immobilized heparinase I albumen.

The method of the easy Immobilized heparinase I of expression provided by the present invention albumen, is that the recombinant expression vector that contains above-mentioned heparinase I protein coding gene is imported to expressive host bacterium, express heparinase I albumen, and it is with MBP label.

Wherein, described easy Immobilized heparinase I encoding gene complete sequence be the PMAL-C2X-HepA building be template, obtain according to conventional PCR method with 5 GACTGGATCCcaggccgacagtgctaag 3 and 5 GGTCAGGCCAAGTTTtctggcagtttcgctgt 3, and then chitin calmodulin binding domain CaM is taking the chitin binding domain of synthetic as template, with 5 CAGCGAAACTGCCAGAAAACTTGGCCTGACCGGT and 5 GACTAAGCTTCTATTGAAGCTGCCACAAGGC 3, after obtaining according to conventional PCR method, taking above-mentioned two PCR product mixtures as template, obtain after primer carries out PCR taking GACTGGATCCcaggccgacagtgctaag and GACTAAGCTTCTATTGAAGCTGCCACAAGGC 3.Described Host Strains can be intestinal bacteria, and described intestinal bacteria can be following bacterial strain: BL21.

Easily the abduction delivering condition of Immobilized heparinase I albumen can be .16 degree Celsius of induction of 0. 1mM IPTG 20 hours: the substratum adopting is LB substratum, Tryptones 10g/L, NaCl 10g/L, yeast extract 5g/L.

Brief description of the drawings

Fig. 1 is the PCR electrophoretogram of HepA-1.

The double digestion qualification schematic diagram of the positive transformant of Fig. 2.

Fig. 3 is that HepA-1-chBD albumen is by the SDS-PAGE electrophoretogram of the affine separation of amylose resin.

Embodiment

Below in conjunction with embodiment, the present invention is done to further detailed, complete explanation.

The expression of embodiment 1, disappearance heparinase I albumen HepA-1.

The structure of l, expression vector pMal-HepA-1-chBD.

The structure referenced patent of template PMal-HepA, the patent No. is CN 1312183C.

The structure detailed process of expression vector pMal-HepA-1-chBD is as follows: taking the PMAL-HepA that built and chitin binding domain plasmid PMD19T as template, upstream and downstream primer used is respectively the restriction enzyme site that the base of GACTGGATCCcaggccgacagtgctaag(with underscore is BamHI), with GGTCAGGCCAAGTTTtctggcagtttcgctgt 3 and, with 5 CAGCGAAACTGCCAGAAAACTTGGCCTGACCGGT and 5 GACTAAGCTTCTATTGAAGCTGCCACAAGGC 3, introduce respectively BamHI and HindIII restriction enzyme site, and then again to reclaim PMAL-HepA-1 after purifying and chitin binding domain plasmid PMD19T-chBD PCR product as template taking GACTGGATCCcaggccgacagtgctaag and GACTAAGCTTCTATTGAAGCTGCCACAAGGC 3 obtains HepA-1-chBD as this encoding gene of primer amplification, the reaction system of amplification is: 50ng template DNA, every kind of primer of 200nmol, 5 × PS buffer amplification buffer, every kind of dNTP of 2.5uMol/L, the high Pfu enzyme of protecting of 1 unit, amplification program is: 95 degrees Celsius of sex change 5 minutes, and 50-60 degree Celsius of primer annealing 15 seconds, 72 degrees Celsius of primer extensions 120 seconds, after 30 circulations, 72 degrees Celsius are extended and within 5 minutes, finish reaction.This PCR. result as shown in Figure 1, shows that amplification obtains the Immobilized heparinase I gene fragment of 1.1kb.In Fig. 1,1 for chitin binding domain PCR reclaims purified product, and size is 174bp; 2 is Heparinase I gene, and size is 1047bp; It is 51,53,55,57,59,61 DEG C of amplification Immobilized heparinase genes that 3-7 is respectively primer annealing temperature, and 8 is molecular weight marker DL1,000, and target segment place is 1.1kb.

HepA-1-chBD and pMal-c2x carrier are used respectively to BamHI and HindIII double digestion, with the connection of T4DNA ligase enzyme, transform BL21, upgrading grain is by BamHI and the checking of HindIII double digestion.The result shows as Fig. 2, result is sent to order-checking, wherein the right-on strain called after recombination bacillus coli BL21 (pMal-HepA-1-chBD) of sequence simultaneously.

2, the easily expression of immobilization change heparinase I albumen HepA-1-chBD.

Recombination bacillus coli BL21 (pMal-HepA-1-chBD) cultivates 3 hours 37 DEG C of LB substratum (containing l00ng/ml Amp), adds 0.7mM IPTG to carry out inducing culture at 15 DEG C in the time of OD600=0.7-0.8.Induce bacterium liquid centrifugal 10min under 8000rpm after 20 hours, be resuspended in ultrasonication in 40ml 20mmol Tris. HCl (ultrasonic power is 150W, ultrasonic 5s, intermittent time 5s, ultrasonic 200 circulations) after abandoning filtrate, 18000rpm.30min is centrifugal.

Embodiment 2, by amylose starch column purification heparinase I albumen HepA-1-chBD and heparinase HepA-1-chBD determination of activity.

1. heparinase I albumen HepA-1-chBD purifying.

Fusion partners (fusion partner) the maltose binding protein MBP utilizing in the present invention can realize a step with the affine absorption of amylose starch and separate.Concrete affine separating step is as follows: by bacterium liquid centrifugal 10min under 8000rpm after the induction of the 0. 7mmol IPTG abduction delivering thalline of 20 hours, abandon and be resuspended in 40ml 20mmol Tris. HCl ultrasonication after filtrate (ultrasonic power is 150W, ultrasonic 5s, intermittent time 5s, ultrasonic 200 circulations), 18000rpm.30min is centrifugal.Centrifugal rear supernatant liquid, is also collected by 10mM 0. 5ml/min maltose gradient elution by the affine separator column of amylose starch of 20ml pre-equilibration with 0. 5ml/min.

With 10mM maltose can be by target protein wash-out under 10 column volumes.Result as shown in Figure 3, shows that target protein can account for more than 95% after amylose resin single step purification.Fig. 3 is SDS-PAGE electrophorogram after 10mM maltose concentration wash-out purifying, and M is molecular weight marker, and 1,2,3 is solvable target protein HepA-1-chBD, and molecular weight is 80KD.

2. heparinase HepA-1-chBD determination of activity.

Heparanase activity is measured: the 2.5 ml heparin concentrations that are added in 35 DEG C of preheatings in 5 ml quartz colorimetric utensils are Tris-HCl (50 mM of 1 mg/ml, containing CaCl2 10 mM, pH7.0) damping fluid, pipette 20 μ l enzyme liquid, after shaking up, measure light absorption value at 232 nm, read the variable quantity of per minute.Molar extinction coefficient 3500 with two keys calculates its formation volume, is scaled the international unit of enzyme in enzyme liquid.Determination of protein concentration adopts Bradford method.

<110> Shenzhen City HaiPuRui Pharmaceutical Co., Ltd

<120> Heparinase I fixing means

<130> 2014

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 2403

<212> DNA

<213> artificial sequence

<400> 1

atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60

ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120

ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180

atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240

accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300

aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360

gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420

aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480

ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540

gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600

aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660

ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720

gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780

ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840

ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900

ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960

actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020

tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080

gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140

aacctcggga tcgagggaag gatttcagaa ttcggatccc aggccgacag tgctaagcag 1200

agcgagatta ttgacaacaa atgggtggca gtaggcatca ataaacctta tgcattacaa 1260

tatgacgata aactgcgctt taatggaaaa ccatcctatc gctttgagct taaagccgaa 1320

gacaattcgc ttgaaggtta tgctgcagga gaaacaaagg gccgtataga attgtcgtac 1380

agctatgcaa ccaccaatga ttttaagaaa tttcccccaa gcgtatacca aaatgcgcaa 1440

aagctaaaaa ccgtttatca ttacggcaaa gggatttgtg aacaggggag ctcccgcagc 1500

tatacctttt cagtgtacat accctcctcc ttccccgaca atgcgactac tatttttgcc 1560

caatggcatg gtgcacccag cagaacgctt gtagctacac cagagggaga aattaaaaca 1620

ctgagcatag aagagttttt ggccttatac gaccgcatga tcttcaaaaa aaatatcgcc 1680

catgataaag ttgaaaaaaa agataaggac ggaaaaatta cttatgtagc cggaaagcca 1740

aatggctgga aggtagaaca aggtggttat ccaccgctgg cctttggttt ttctaaaggg 1800

tatttttaca tcaaggcaaa ctccgaccgg cagtggctta ccgacaaagc cgaccgtaac 1860

aatgccaatc ccgagaatag tgaagtaatg aagccctatt cctcggaata caaaacttct 1920

accattgcct ataaaatgcc ctttgcccag ttccctaaag attgctggat tacttttgat 1980

gtcgccatag actggacgaa atatggaaaa gaggccaata caattttgaa acccggtaag 2040

ctggatgtga tgatgactta taccaagaat aagaaaccac aaaaagcgca tatcgtaaac 2100

cagcaggaaa tcctgatcgg acgtaacgat gacgatggct attacttcaa atttggaatt 2160

tacagggtcg gtaacagcac ggtcccggtt acttataacc tgagcgggta cagcgaaact 2220

gccagaaaac ttggcctgac cggtctgaac agtggcctga ctactgcttg gcaggtcaac 2280

acagcttata ctgcgggaca attggtcaca tataacggca agacgtataa atgtttgcag 2340

ccccacacct ccttggcagg atgggaacca tccaacgttc ctgccttgtg gcagcttcaa 2400

tag 2403

<210> 2

<211> 801

<212> PRT

<213> artificial sequence

<220>

<223>

<400> 2

Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys

1 5 10 15

Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr

20 25 30

Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe

35 40 45

Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala

50 55 60

His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile

65 70 75 80

Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp

85 90 95

Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu

100 105 110

Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys

115 120 125

Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly

130 135 140

Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro

145 150 155 160

Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys

165 170 175

Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly

180 185 190

Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp

195 200 205

Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala

210 215 220

Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys

225 230 235 240

Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser

245 250 255

Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro

260 265 270

Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp

275 280 285

Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala

290 295 300

Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala

305 310 315 320

Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln

325 330 335

Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala

340 345 350

Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn

355 360 365

Ser Ser Ser Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Gly Ile

370 375 380

Glu Gly Arg Ile Ser Glu Phe Gly Ser Gln Ala Asp Ser Ala Lys Gln

385 390 395 400

Ser Glu Ile Ile Asp Asn Lys Trp Val Ala Val Gly Ile Asn Lys Pro

405 410 415

Tyr Ala Leu Gln Tyr Asp Asp Lys Leu Arg Phe Asn Gly Lys Pro Ser

420 425 430

Tyr Arg Phe Glu Leu Lys Ala Glu Asp Asn Ser Leu Glu Gly Tyr Ala

435 440 445

Ala Gly Glu Thr Lys Gly Arg Ile Glu Leu Ser Tyr Ser Tyr Ala Thr

450 455 460

Thr Asn Asp Phe Lys Lys Phe Pro Pro Ser Val Tyr Gln Asn Ala Gln

465 470 475 480

Lys Leu Lys Thr Val Tyr His Tyr Gly Lys Gly Ile Cys Glu Gln Gly

485 490 495

Ser Ser Arg Ser Tyr Thr Phe Ser Val Tyr Ile Pro Ser Ser Phe Pro

500 505 510

Asp Asn Ala Thr Thr Ile Phe Ala Gln Trp His Gly Ala Pro Ser Arg

515 520 525

Thr Leu Val Ala Thr Pro Glu Gly Glu Ile Lys Thr Leu Ser Ile Glu

530 535 540

Glu Phe Leu Ala Leu Tyr Asp Arg Met Ile Phe Lys Lys Asn Ile Ala

545 550 555 560

His Asp Lys Val Glu Lys Lys Asp Lys Asp Gly Lys Ile Thr Tyr Val

565 570 575

Ala Gly Lys Pro Asn Gly Trp Lys Val Glu Gln Gly Gly Tyr Pro Pro

580 585 590

Leu Ala Phe Gly Phe Ser Lys Gly Tyr Phe Tyr Ile Lys Ala Asn Ser

595 600 605

Asp Arg Gln Trp Leu Thr Asp Lys Ala Asp Arg Asn Asn Ala Asn Pro

610 615 620

Glu Asn Ser Glu Val Met Lys Pro Tyr Ser Ser Glu Tyr Lys Thr Ser

625 630 635 640

Thr Ile Ala Tyr Lys Met Pro Phe Ala Gln Phe Pro Lys Asp Cys Trp

645 650 655

Ile Thr Phe Asp Val Ala Ile Asp Trp Thr Lys Tyr Gly Lys Glu Ala

660 665 670

Asn Thr Ile Leu Lys Pro Gly Lys Leu Asp Val Met Met Thr Tyr Thr

675 680 685

Lys Asn Lys Lys Pro Gln Lys Ala His Ile Val Asn Gln Gln Glu Ile

690 695 700

Leu Ile Gly Arg Asn Asp Asp Asp Gly Tyr Tyr Phe Lys Phe Gly Ile

705 710 715 720

Tyr Arg Val Gly Asn Ser Thr Val Pro Val Thr Tyr Asn Leu Ser Gly

725 730 735

Tyr Ser Glu Thr Ala Arg Lys Leu Gly Leu Thr Gly Leu Asn Ser Gly

740 745 750

Leu Thr Thr Ala Trp Gln Val Asn Thr Ala Tyr Thr Ala Gly Gln Leu

755 760 765

Val Thr Tyr Asn Gly Lys Thr Tyr Lys Cys Leu Gln Pro His Thr Ser

770 775 780

Leu Ala Gly Trp Glu Pro Ser Asn Val Pro Ala Leu Trp Gln Leu Gln

785 790 795 800

Pro

Claims

1. an easy Immobilized heparinase I albumen, by the protein that in sequence table, the aminoacid sequence shown in sequence SEQ ID NO:2 forms.

2. protein coding gene described in claim 1.

3. gene according to claim 2, is characterized in that: the nucleotide sequence in the nucleotide sequence formula sequence table of described gene described in SEQ ID NO:1.

4. contain the engineering bacteria of gene described in claim 2.