CN104056262B - There is the protein vaccine constituent of antagonism streptococcus pneumoniae infection and detect the method for streptococcus pneumoniae in sample - Google Patents

Abstract

The present invention provides a kind of method of streptococcus pneumoniae in protein vaccine constituent with antagonism streptococcus pneumoniae infection and detection sample, exploitation primarily with regard to vaccine, and this vaccine is for preparing the application of pharmaceutical composition of antagonism streptococcus pneumoniae infection, and detection is from whether pneumonia infection streptococcus in the sample such as hydrothorax of urine, blood and empyema.Part streptococcus pneumoniae is in addition to two kinds of nerve amines phytase genes (i.e. nanA and nanB), also with another kind of nerve amines phytase gene (i.e. nanC gene).The neural amino acid enzyme of three kinds of total lengths is combined together, it is provided that best protected effect resists the infection of various serotype streptococcus pneumoniae, and the activity of the neural amino acid enzyme of neutralization, therefore can be as a preferable universal vaccine examination thing.And the streptococcus pneumoniae in sample can be detected, reach good effect.Also defining NanA, NanB, NanC of reduction equally and still have the region that is equivalent to total length effect, wherein antagonism NanC serum has the cross-protection of suppression NanB activity equally.

Description

There is the protein vaccine of antagonism streptococcus pneumoniae infection The method of streptococcus pneumoniae in constituent and detection sample

Technical field

The present invention provides lung in a kind of protein vaccine constituent with antagonism streptococcus pneumoniae infection and detection sample Scorching streptococcic method, primarily with regard to the exploitation of protein vaccine constituent, resists the infection of streptococcus pneumoniae, And detection from urine, blood and empyema the sample such as hydrothorax in whether pneumonia infection streptococcus.More Saying, the present invention is the protein vaccine that exploitation is general, resists the infection of various serotype streptococcus pneumoniae body.

Background technology

Streptococcus pneumoniae is a kind of Gram-positive diplococcus, and its infection can cause high mortality and high incidence (special It is not the old man of the child below 2 years old and more than 60 years old), for the whole world, estimate pneumococcal infection, About 160 are caused to die ten thousand deaths the case died every year, although some vaccine existing is applied to prevent streptococcus pneumoniae sense Dye, but the mortality rate caused because of streptococcus pneumoniae infection is still the highest, these relevant diseases, including invading Entering property pneumococcal disease (IPD), such as septicemia and meningitis；Lower respiratory infection, such as bacterial pneumonia； And upper respiratory tract infection, such as acute otitis media (AOM).

Hemolytic-uraemic (HUS) is one of disease the most serious in IPD complication, takes place mostly in child, And be the most also associated with diseases such as hemolytic anemia, thrombocytopenia and acute renal failures, this Disease, usually occurs in the child of health, is with a kind of children's being most commonly in acute renal failure.Depend on According to the report of the World Health Organization (WHO), the most global main cause of death of acute respiratory infection, its In be topmost symptom with the pneumonia (CAP) that little zone type streptococcus pneumoniae is relevant, it is seen that streptococcus pneumoniae infection Prevention and detection be extremely important and required.

Although the method having some detection streptococcus pneumoniae at present, but mainly still rely on traditional antibacterial culturing Method, loaded down with trivial details the most time-consuming, if the sensitivity that bacterial multiplication not, detects is the highest, or utilize pneumonia streptococcus Bacterium detectable (as) streptococcus pneumoniae folder film C-polysaccharide in test urine Composition, but pseudo-positive too high phenomenon often occurs, in prevention, the most mostly use vaccine PCV7 and PPV23, But the vaccine all prepared just for some streptococcus pneumoniae particular serotype because of them, so allow non-vaccine on the contrary Other serotype streptococcus pneumoniae of protection are gradually increased, and the infection disease that these bacterial strains are caused is the most often More serious.

Produced by streptococcus pneumoniae, toxicity factor has a variety of, but neural amino acid enzyme A (NanA) of only secreting type Being considered relevant with HUS, neural amino acid enzyme can crack red blood cell (RBC), platelet and endotheliocyte On surface N-acetylneuraminic amine acid (or claim sialic acid;N-acetylneuraminic acid,or sialic Acid) residue, its result causes exposing to the open air of Thomsen-Friedenrich antigen (T antigen), so, incites somebody to action Allow the antibody of loop anti-T antigen and the T antigen-reactive being exposed on cell, thus result in the inflammation of cell very To dead.On the other hand, T antigen from the clustering candy of cell surface and mucoprotein expose to the open air after, be also beneficial to lung Scorching streptococcic attachment, and then promote to infect, it is different that Diplococcus pneumoniae can produce two or three Neuraminidases (NanA and NanB, or plus NanC), these three nerve amino acid enzyme is all secreting type egg White matter, has typical victory peptide signal chain, wherein NanA, unlike NanB and NanC, further comprises one section of energy Embed the C-terminal protein anchor district in cell surface, study display in vivo, when the mutant of NanA is inoculated into After nasopharynx, trachea and pulmonary, in 12 hours, i.e. it is eliminated light, though and NanB mutant can be the most stagnant Stay, but do not increase its quantity.But, the effect of NanC is the most not clear.

The S. pneumoniae serotypes infection contained since non-vaccine is gradually increased, and the Drug resistance of these bacterial strains With toxicity also with enhancing, therefore the problem of pneumococcal infection is always global sanitarian a major challenge, Developing new vaccine and the method for detection, actually the public eagerly looks forward to, for correlational study person, developer's palpus Make great efforts target and direction that research and development break through.

Summary of the invention

It is an object of the invention to, it is provided that a kind of protein vaccine constituent with antagonism streptococcus pneumoniae infection And the method for streptococcus pneumoniae in detection sample, point to be solved the technical problem that: the infection of streptococcus pneumoniae can be led Cause high mortality and high incidence, although some vaccine existing is applied to prevent streptococcus pneumoniae infection, but by lung The mortality rate that scorching streptococcal infection is caused is still the highest.Although having some detection streptococcus pneumoniae at present Method, but mainly still rely on traditional method for cultivation of bacteria, loaded down with trivial details the most time-consuming, and if bacterial multiplication inadequate, The sensitivity that then can cause detection is low, or utilizes the pneumonia streptococcus in streptococcus pneumoniae detectable test urine The composition of bacterium folder film C-polysaccharide, then can occur pseudo-positive too high phenomenon；In prevention, at present Mostly use vaccine PCV7 and PPV23, but because they are all made just for some streptococcus pneumoniae particular serotype Standby vaccine, so other serotype streptococcus pneumoniae allowing non-vaccine protect on the contrary are gradually increased, causes these The infection disease that bacterial strain is caused is the most serious.

The technical characterstic of solution problem: for improving above-mentioned problem, first the present invention develops one and have antagonism lung The protein vaccine constituent of scorching streptococcal infection, it is by weight produced by the nerve amines phytase gene of streptococcus pneumoniae The neural amino acid enzyme of group, normal saline solution and Freund adjuvant Freund ' s adjuvant are as the composition of immunity inoculation Thing, wherein the neural amino acid enzyme of restructuring comprises NanA protein, NanB protein and NanC protein, wherein with The neural amino acid enzyme concentration of physiological saline water concocting restructuring so that it is there is identical proportion, after blending with Freund adjuvant Neural amino acid enzyme and Freund adjuvant again with equal-volume than formed protein vaccine constituent.It can be used to resist various The infection of serotype streptococcus pneumoniae.Also, the present invention separately provides a kind of neural amino acid enzyme antibody of exploitation antagonism to examine The method of streptococcus pneumoniae in test sample product, comprise the steps of the use neural amino acid enzyme NanA protein of antagonism, NanB protein and the antibody of NanC protein, wherein this antibody refers to directly to take from serum or that purification is crossed is anti- Body；And whether there is pneumonia through detection technique detection from the sample of human body or the pus of other biological, blood and urine Streptococcus strain, wherein this detection technique includes that the connection of Western blot Western hybridization, ferment is exempted from Epidemic disease adsorption reaction ELISA, immunofluorescence demarcate immunofluorescence labeling, immune radiating detection Arbitrary or the combination of method immunoradiometric assay.The neural amino acid enzyme of another kind of the present invention detection is subject to The method of activity during suppression, comprises the steps of the use mankind or animal via nerve amino acid enzyme immunity is produced Antibody, the antibody that wherein this antibody refers to directly to take from serum or purification is crossed；By this antibody and one or more Neural amino acid enzyme is blended in a sample, wherein this sample be red blood cell (RBC) or any kind of carefully Born of the same parents' strain；And use flow cytometer to detect the activity of neural amino acid enzyme, wherein said activity be with The exposure of Thomsen-Friedenrich antigen (being called for short: T antigen) is weighed, this T antigen exposure again Measurement be the binding capacity of agglutinin fluorescein-labeled lectin and the T antigen demarcated with fluorescein, Measure the activity of neural amino acid enzyme.

Comparison prior art effect: according to the result of study of the present invention, most streptococcus pneumoniae all with Three kinds of nerve amines phytase genes (i.e. nanA gene, nanB gene and nanC gene), although antagonism NanC base The serum of cause suppresses or neutralizes the activity of neural amino acid enzyme and not as anti-NanA gene and anti-NanB gene serum, But result of study of the present invention finds, when three kinds of neural amino acid enzymes are combined together, it but it is best vaccine examination Agent, it can be as a preferable vaccine examination thing, it is provided that best protected effect, resists various serum The infection of type streptococcus pneumoniae；Also define the neural amino acid enzyme part of optimal reduction simultaneously, reach good merit Effect.

Relevant the technology used in the present invention, means and effect thereof, hereby lift a preferred embodiment and coordinate graphic in detail After being carefully illustrated in, it is believed that purpose that the present invention is above-mentioned and feature, when can by a deeply concrete understanding.

Accompanying drawing explanation

Figure 1A, Figure 1B, Fig. 1 C: for recombinant clone and the time cloning of streptococcus pneumoniae nerve amino acid enzyme of the present invention Schematic diagram.

Fig. 2, Fig. 2 A, Fig. 2 B, Fig. 2 C: for the Thomsen-Friedenrich being exposed on red blood cell (TA) antigen schematic diagram.Fig. 2 D is the microscope figure of the coagulation effect of red blood cell.

Fig. 3, Fig. 3 A, Fig. 3 B, Fig. 3 C: for using enzyme linked immunosorbent adsorption test (ELISA) to confirm The polyclonal antiserum of Mus action diagram to neural amino acid enzyme antigen NanA, NanB and NanC respectively.

Fig. 4: for the result figure of vaccination tests, be wherein the streptococcus pneumoniae infection mice with serotype 3.

Fig. 5: for the result figure of vaccination tests, wherein include in order to the S. pneumoniae serotypes of infecting mouse 3 (A figures), 14 (B figures), 19A (C figure), 6B (D figure), 15B (E figure) and 23F (F figure).

Fig. 6 A, Fig. 6 B and Fig. 6 C: for being used for testing god through the rabbit antiserum of neural amino acid enzyme immunity inoculation Suppression schematic diagram through amino acid enzymatic activity.

Fig. 7 A, Fig. 7 B and Fig. 7 C: for being used for testing god through the mouse resisting anteserum of neural amino acid enzyme immunity inoculation Suppression schematic diagram through amino acid enzymatic activity.

Fig. 8 A, Fig. 8 B and Fig. 8 C: the mouse resisting anteserum for the neural amino acid enzyme time cloning strain immunity through reduction is used Test the suppression schematic diagram to nerve amines phytase activity.

Fig. 9: for the wild strain with nanB and nanC nerve amines phytase gene relative to mutant the most not In same time, the comparison schematic diagram that the T antigen on red blood cell is exposed to the open air.

Detailed description of the invention

Present invention firstly provides and a kind of develop neural amino acid enzyme antibody to detect the method for streptococcus pneumoniae in sample, Comprise the steps of and use the neural amino acid enzyme NanA protein of antagonism, NanB protein and NanC protein Antibody, the antibody that wherein this antibody refers to directly to take from serum or purification is crossed；Detect from people through detection technique Whether the sample of body or the pus of other biological, blood and urine exists streptococcus pneumoniae strain, and wherein this detection technique includes Western blot Western hybridization, ferment connection imnnoadsorption ELISA, immunofluorescence mark Determine immunofluorescence labeling, immunoradiometric assay immunoradiometric assay Arbitrary or combine.Aforesaid method further includes use gene-amplificative instrament PCR and expands and cause with streptococcus pneumoniae The gene that Hemolytic-uraemic HUS is associated, and detect and should cause Hemolytic-uraemic with streptococcus pneumoniae The step of the gene that (hemolytic uremic syndrome, HUS) is associated, wherein this gene comprises nanA Gene, nanB gene and nanC gene.The enforcement of the present invention describes in detail as follows:

Streptococcus pneumoniae nerve amines phytase gene nanA, nanB and nanC detect:

Neural amino acid enzyme NanA gene and NanB gene have been considered to the one of the virulence factor of streptococcus pneumoniae, But the function of NanC gene is the most unclear.The present invention has Hemolytic-uraemic (hemolytic from one Uremic syndrome, HUS) child in the S. pneumoniae serotypes 14 that is separated to, find its full base The nanC gene contained because of group, in order to confirm that nanC gene is a kind of weight such as nanA gene and nanB gene The virulence factor wanted, it can be gene-amplificative instrament PCR amplification nanA gene, nanB gene and nanC that the present invention devises Three groups of introductions of gene, to primer sets, are used for detecting and selecting growing nerve amines phytase gene, including nanA (Sequence ID No.1), nanB (Sequence ID No.2) and nanC (Sequence ID No.3), Its sequence is based on the whole genome sequence (accession number NC_010582 of NCBI) of S. pneumoniae serotypes 14, Especially it is used for detecting the sample separation strain of those tools invasive streptococcus pneumoniae infection disease (including HUS).

The design of six groups of introductions pair of the time cloning strain of amplification nanA gene, nanB gene and nanC gene and its reduction:

It is designed to expand six groups of introductions of nerve amines phytase gene nanA, nanB and nanC to there being two kinds of purposes: The first is respectively intended to detect gene nanA, nanB and nanC；It two is genetic fragment to be accessed on display carriers. Detailed application please see below.

1. amplification nanA gene introduction is to (sequence numbered Seq.ID No.1)

NanA-ATG-Kpn1:5’-AGATCTGGGTACCATGTCTTATT TCAGAA ATCG

NanA-TAA-Xho1:5’-TGGTGCTCGA GTTGTTCTCTCTTTTTCCCT A

The size of expection amplification is 2964bp.

2. amplification nanB gene introduction is to (sequence numbered Seq.ID No.2)

NanB-ATG-Kpn1:5’-AGATCTGGGTACCATGAATA AAAGAGGTCTTTA

NanB-TAA-Xho1:5’-TGGTGCTCGA GTTTTGTTAA ATCATTAATT TC

The size of expection amplification is 2115bp.

3. amplification nanC gene introduction is to (sequence numbered Seq.ID No.3)

NanC-ATG-Kpn1:5’-AGATCTGGGTACCATGAAAAAAAAT ATTAAACA

NanC-TAA-Xho1:5’-TGGTGCTCGA GATTCTTTTTCAGATCTTCA A

The size of expection amplification is 2244bp.

4. amplification nanA4 time cloning pnca gene introduction is to (the corresponding Amino acid sequence of this amplification of DNA fragments is sequence Numbering Seq.ID No.4)

NanA4-Kpn1:5’-AGATCTGGGTACC AGCCAGCCTTCTTCAGAGAC

NanA4-Xho1:5’-TGGTGCTCGA G TGATAGGGTATAGGCATTTT

The size of expection amplification is 2100bp, and corresponding amino acid (aa) number is 700.

5. amplification nanB3 time cloning pnca gene introduction is to (the corresponding Amino acid sequence of this amplification of DNA fragments is sequence Numbering Seq.ID No.5)

NanB3-Kpn1:5’-AGATCTGGGTACC ATGAATAAAAGAGGTCTTTA

NanB3-Xho1:5’-TGGTGCTCGA G TTGAGTAGAATCTCCTGATT

The size of expection amplification is 720bp, and corresponding amino acid (aa) number is 240.

6. amplification nanC4 time cloning pnca gene introduction is to (the corresponding Amino acid sequence of this amplification of DNA fragments is sequence Numbering Seq.ID No.6)

NanC4-Kpn1:5’-AGATCTGGGTACC ATGAAAAAAAATATTAAACA

NanC4-Xho1:5’-TGGTGCTCGA GACTTGTAGCAATATTAATTT

The size of expection amplification is 975bp, and corresponding amino acid (aa) number is 325.

The feature of these introductions pair is: boldface letter represents the sequence from nerve amines phytase gene；Bottom line wordGGTACC AndCTCGAGIt is that bit is cut in the identification of KpnI and XhoI respectively, its objective is to cut the montage of position when gene choosing is grown. Cut 5 ' terminal sequences of position as the identification of KpnI and XhoI and be then conducive to the effect of KpnI and XhoI ferment.

Neural amino acid enzyme nanA gene, nanB gene and the detection of nanC gene of streptococcus pneumoniae separation strain:

The streptococcus pneumoniae infection disease that the present invention is correlated with is from the clinical data of ancient Chinese name for Venus memorial hospital of Linkou County.Fixed The case of justice invasive pneumococcal disease IPD typically refers to from general sterile region, such as blood, and cerebrospinal fluid, or In hydrothorax, streptococcus pneumoniae can be separated to obtain.Wherein during in January, 2006 in December, 2009, the age is all Child less than 18 years old, the patient being in hospital because of Hemolytic-uraemic HUS is the object that the present invention studies, molten The definition of hematuria toxicity syndrome is all the method stated according to CDC of the U.S., wherein, and inspection Surveying is Hemolytic-uraemic, is to check with blood coagulation method, but former already present Normal fibrinogen is made The disseminated inravascular coagulation phenomenon become then can be excluded, and the disease of Hemolytic-uraemic patient is to coagulate with Semen arachidis hypogaeae Collection element starts T antigen and causes the method for coagulation to obtain checking.

This research selects sufferer and non-Hemolytic-uraemic HUS matched group from Hemolytic-uraemic HUS sick Suffer from the 72 strain streptococcus pneumoniae separated, and expand nanA, nanB and nanC base with the introduction of the present invention to carrying out PCR The method of cause, it may be verified that these three kinds of genes ratio present in the streptococcus pneumoniae.The haemolysis uremic of the present invention is combined Close the streptococcus pneumoniae in disease patient HUS and non-Hemolytic-uraemic HUS matched group and separate its nerve amines between strain The percentage ratio of phytase gene nanA, nanB and nanC, result shows that all of streptococcus pneumoniae is all with nanA Gene and nanB gene, but the streptococcus pneumoniae in 89% Hemolytic-uraemic HUS sufferer is with NanC gene； The streptococcus pneumoniae of the non-Hemolytic-uraemic HUS sufferer of only 41% is with nanC gene.Therefore, the present invention Introduction to by gene-amplificative instrament PCR amplification nanA gene, nanB gene and the method for nanC gene, may be used to test Whether card is deposited in the sample by streptococcus pneumoniae.

Also, a kind of method that the present invention is activity detecting neural amino acid enzyme when being suppressed, comprise the steps of Using antibody produced by the mankind or animal via nerve amino acid enzyme immunity, wherein this antibody refers to directly take from serum Or the antibody that purification is crossed；This antibody and one or more neural amino acid enzymes are blended in a sample, wherein should Sample is red blood cell (RBC) or any kind of cell strain；And use flow cytometer to detect nerve The activity of amino acid enzyme, wherein said activity is to weigh with the exposure of T antigen, again this T antigen exposure Measurement be the binding capacity of agglutinin fluorescein-labeled lectin and the T antigen demarcated with fluorescein, Measure the activity of neural amino acid enzyme.Wherein, aforesaid method further includes and allows agglutinin make with cell at low temperatures Step, its cryogenic temperature is as little as 4 DEG C or between 0～10 DEG C, is possible to prevent the coagulation of cell, and then keeps away Exempt from the blocking of this flow cytometer pipeline.The enforcement of the present invention describes in detail as follows:

The biological function detection of neural amino acid enzyme NanA, NanB and NanC of streptococcus pneumoniae:

In order to analyze the biological function of neural amino acid enzyme NanA, NanB and NanC of streptococcus pneumoniae, the present invention Utilize aforesaid introduction pair, choosing to grow gene nanA, nanB and nanC, and show and purification these restructuring NanA Protein, NanB protein and NanC protein.The biological function detection of these protein includes red blood cell The exposing to the open air and by matter specificity, be described below in detail of T antigen:

The choosing of gene nanA, nanB and nanC is grown, is showed and purification:

Refer to shown in Fig. 1, for recombinant clone schematic diagram, the nerve amines phytase gene fragment (bag of each PCR amplification Include nanA, nanB and nanC), it is all based on the genome sequence of streptococcus pneumoniae strain CGSP14, by gene It is cloned into an expression vector, such as pET29b (Novagen, Merck, Darmstadt, Germany).Logical Cross restricted enzyme KpnI and XhoI to be cut by DNA, and engage DNA fragmentation with joining enzyme.Sequence number ID(is from 1 Number to No. 6) represent DNA sequence and the aminoacid sequence of time cloning strain of gene.According to streptococcus pneumoniae strain The nerve amines phytase gene nanA of CGSP14 whole genome sequence (NCBI accession number NC_010582) (number by sequence Seq.ID No.1), nanB (sequence numbering Seq.ID No.2) and nanC (sequence numbering Seq.ID No.3) Sequence, utilize aforementioned three groups of introductions for expanding nanA gene, nanB gene and nanC gene to distinguishing PCR expands nerve amines phytase gene, and with the enzyme that limits of KpnI and XhoI, the DNA fragmentation choosing of amplification is grown entrance one In individual display carriers, the present invention only select general carrier pET29b (Novagen, MERCK, Darmstadt, Germany) (Figure 1A) is got final product.And this recombiant plasmid can be with isopropyl in e. coli bl21 (DE3) β-D-1-thiogalactopyranos ide(IPTG；Final concentration 1 μ g/mL) induce show in a large number weight Histone matter, wherein uses Luria-Bertani (LB) culture fluid, cultivates 4 hours at 37 DEG C.Collect afterwards Bacterial strain, and utilize Nickel (Ni2⁺) the Nickel-Chelating resin of affinity chromatography Recombinant protein is purified by (Invitrogen, Carlsbad, CA, USA).This recombinant protein is one to melt Hop protein matter, with the His-tag part from pET29b, can be combined with Nickel-Chelating resin, Thus can be purified out easily.Nerve amines phytase gene (Figure 1B, the figure of the most a series of reductions 1C) select the most in the same way and grow, show and these time cloning strain protein of purification.These time cloning strain bags Include the NanA1 (regions of 501～780 Amino acid sequence) from NanA, NanA2 (501～620 Amino acid sequence Region), NanA3 (regions of 1～325 Amino acid sequence) and the NanA4 (district of 80～780 Amino acid sequence Territory), from the NanB3 (regions of 1～240 Amino acid sequence) of NanB, and from the NanC1 (382～473 of NanC The region of Amino acid sequence), NanC2 (regions of 578～663 Amino acid sequence) and NanC4 (1～325 amine The region of base acid sequence).Time cloning strain NanA4 therein (Amino acid sequence is sequence numbering Seq.ID No.4) Then contain LamG (a kind of lectin agglutinin) and the sialidase sialidase super homology family of NanA Region, and NanB3 (Amino acid sequence is sequence numbering Seq.ID No.5) and NanC4 (Amino acid sequence is Sequence numbering Seq.ID No.6) contain the region of the LamG super homology family of NanB and NanC the most respectively.Cause Region after these three reductions has the biological effect of its affiliated neural amino acid enzyme total length of equivalent and (asks for an interview exempting from of Fig. 8 The epidemic disease serum part to nerve amines phytase activity inhibition), so presenting its Amino acid sequence especially.

Utilize the activity presenting to confirm the neural amino acid enzyme of restructuring of T antigen on cell:

As shown in Fig. 2 A, Fig. 2 B, Fig. 2 C, the detection of the nerve amines phytase activity of restructuring is to utilize T antigen on cell Present assess.Agglutinin is usually used to identify residual sugar conjugate (glycoconjugate residues), As T antigen is a kind of residual sugar conjugate.Fluorescein-labeled peanut agglatinin (Fluorescein-labeled peanut agglutinin,PNA;Vector Laboratories,Inc.,Burlingame,CA94010, U.S.A.) it is the label being generally used to detect T antigen.It addition, fluorescently-labeled Ramulus Sambuci Williamsii black substance agglutinin (Fluorescein-labeled Sambucus Nigra lectin,SNA;Vector Laboratories,Inc., Burlingame, CA94010, U.S.A.) and biotin labeled bosom sophora japonica lectin II (biotinylated Maackia Amurensis lectin II,MAL II;Vector Laboratories,Inc.,Burlingame, CA94010, U.S.A.) it is then to be respectively intended to identification α 2-6 and α 2-3 sialylated contact (sialyl Linkages) label.

For the amount of the residual sugar conjugate on cell to be detected, the research of the present invention is according to general method, such as AABB Standard technique (http://freetechebooks. Com/ebook-2011/aabb-technical-manual.html), purification fresh red blood cells with Healthy People (RBC) cell, about 3x10⁷Cells/mL tests.Also take the cell strain (1x10 of tissue culture simultaneously⁶ Cells/mL) test, such as A549 (human epithelial lung cell line;Number: CCL-185^TM) and HK-2 (human kidney2cell line;Number:CRU-2190^TM)。 Culture fluid selects to use DMEM (Dulbecco's modified Eagle's medium) additional Ham F12 nutrition Liquid, and at 37 DEG C with the restructuring nerve amino acid enzyme of purification (1 μ g and RBC effect;0.1 μ g and A549and HK-2 effect) act on 1～2 hour.

During with the neural amino acid enzyme of flow cytometry analysis restructuring to the T antigen presented after cytosis, detection No matter the cell concentration of 10,000-20,000, be to use that a kind of T antigenic label (such as PNA, SNA or MAL II), it is necessary to act on 1 hour at 4 DEG C, rather than higher temperature (such as 37 DEG C), or longer time (as Overnight), must exempt to cause cell agglutination to cause the blocking of flow cytometer pipeline.Such as cell agglutination to be detected Phenomenon, can be made used cell be placed in microscopy under microscope by the T antigenic label of 20 μ l and neural amino acid enzyme.

Although known neural amino acid enzyme NanA can cause the T antigen of erythrocyte, platelet and messangial cell in Existing, but NanC is the most not yet positioned the role of virulence factor, the especially relatedness with HUS is the most not yet reported. In order to prove NanC at virulence factor institute role, first we prove that the NanC of restructuring presents the T of cell and resists Former ability.Fig. 2 A, Fig. 2 B, Fig. 2 C are the T antigen schematic diagram being exposed on cell, on flow cytometer, Utilizing the fluorescence that the PNA binding lectin of FITC labelling presents to detect TA exposure, numerical digit shows what fluorescence counted Sample, including undressed cell (representing with black surround), NanA process group (in vain), NanB process group (ash Color), and NanC process group (twill).NanA(0.01 μ g), NanB(1 μ g) and NanC(1 μ g) The amount (see Fig. 2 A) of red blood cell TA can be exposed to the open air.All 1 μ g of NanA, NanB and NanC() permissible Expose A549 cell (see Fig. 2 B) and the amount of HK-2 cell (see Fig. 2 C) TA to the open air.The PNA agglutinin of 20 μ l subpackages The red blood cell of labelling is used for flow cytometry analysis, at 37 DEG C of basis of microscopic observation, to verify coagulation.With NanA, NanB and NanC(0.1 μ g) process after, observe red blood cell coagulation effect (refer to Fig. 2 D Shown in).Therefore when the usage amount of NanA is more than 0.01 μ g, its ability presenting RBC cell T antigen reaches Saturated.And the activity of 0.01-μ g NanA is equivalent to 1-μ g NanB and 1-μ g NanC, and to present RBC thin The ability of born of the same parents' T antigen, is 9.4x10 the most respectively²And 5.3x10²Multiple.And microscopy under the microscope When RBC cell is by the phenomenon of PNA label coagulation, find that the coagulation degree of NanA is also more a lot of than NanB and NanC (asking for an interview Fig. 2 D), but in matched group, the RBC cell of impassivity amino acid ferment treatment, even if adding PNA label The most still the phenomenon without coagulation occurs.Additionally when using A549 cell, the activity of NanA is only above NanB and NanC Can present the ability of cell T antigen, the most respectively higher than 2.2 and 3.3 times；Equally when using HK-2 cell, The ability that the activity of NanA can present HK-2 cell T antigen higher than NanB and NanC the most all only has 1.5 times.

Finally, the present invention provides a kind of vaccine combination of the present invention for preparing the medicine of antagonism streptococcus pneumoniae infection Application in compositions, wherein, this streptococcus pneumoniae comprises all types of serological type strain, described medicine Using of compositions comprises the steps of three kinds of nerve amines of S. pneumoniae serotypes 14 bacterial strain CGSP14 The neural amino acid enzyme of the produced restructuring of phytase gene: i.e. NanA, NanB and NanC protein is as immunity inoculation Constituent, and injection is in the main bodys such as the mankind or other animals；Wherein, this main body is by these restructuring nerve amines The injection of acid enzyme can cause the immunoreation of streptococcus pneumoniae, can be used to this main body of immunity to resist streptococcus pneumoniae Infection.The application of aforesaid pharmaceutical composition further includes the step using specific antibodies as passive immunity, Wherein, this specific antibodies is through amino acid enzyme antibody neural produced by neural amino acid enzyme immunity by this main body.Also, In this pharmaceutical composition, auxiliary material can be added, including the adjuvant of use all types molecule, exempt to improve Epidemic disease is reacted.The enforcement of the present invention describes in detail as follows:

Neural amino acid enzyme NanA, NanB and NanC of restructuring as antigen, the purposes using as immunoprotection:

In order to develop a preferable vaccine to resist the infection of streptococcus pneumoniae, the present invention has developed general egg White matter vaccine, i.e. selects the three kinds of neural amino acid enzymes using streptococcus pneumoniae as vaccine, tests its immunity little The effect of Mus, simultaneously the present invention also with currently available vaccines, existing vaccines PPV23 as matched group.On the other hand, through nerve The immunoenzymatic anti-neural amino acid enzyme serum of amino acid, is also used to suppress the activity of neural amino acid enzyme.

The immunization of mice antagonism streptococcus pneumoniae:

Please refer to shown in Fig. 3, Fig. 4 and Fig. 5.Fig. 3 shows employing ferment link immunosorbent adsorption test (ELISA) Confirm the polyclonal antiserum of Mus to three kinds of neural amino acids enzyme antigen NanA (Fig. 3 A), NanB (Fig. 3 B) and The effect of NanC (Fig. 3 C).Test by ELISA method, test mouse (ash after (black surround) and immunity before immunity Frame) effect to neural amino acid enzyme antigen of its antiserum, and negative control group for only add normal saline solution PBS and Freund adjuvant Freund ' s adjuvant but nonantigenic dosing (white edge), first by other neural amino acid enzyme NanA, NanB and NanC (10 μ g/ml, the 100 μ l little potholes of in PBS/, process for 16 hours by 4 DEG C) It is attached on the ELISA flat board of 96 little potholes, then with 200-μ l10% Ox blood serum (bovine serum Albumin, BSA) in room temperature treatment one hour, then the serum of anti-neural amino acid enzyme is added in little pothole, and this The serum combination of a little anti-neural amino acid enzymes includes other nerve amines acid enzyme (NanA, NanB or NanC), nerve Amino acid enzyme A+B(NanA+NanB) and three kinds of neural amino acid enzyme A+B+C(NanA+NanB+NanC), For carrying out the interaction of quantitative antigen-antibody, the present invention uses the sheep anti-mouse igg (Sigma of peroxidase labelling Company) as second antibody, and use tetramethyl benzidine/peroxidating (R&D Systems, Minneapolis, MN, the U.S.) it is chromogenic substrate, and chromogenic substrate is wavelength 405 at the absorption maximum band of elisa assay instrument Nenometer(EMax, Molecular Devices, Sunnyvale, CA94089, U.S.), Y-axis with Logarithm value represents.Antibody antigen reaction represents with logarithm value.Fig. 4 shows the result of vaccination tests again, By indivedual or neural amino acid enzyme (NanA, NanB and NanC) the 10 μ g of three various combinations, it is applied as Antigen, immune mouse (BALB/C, month big) is injected four times with the time intervals of 2 weeks, and and PPV23 Vaccine and negative control group (normal saline solution PBS+ Freund adjuvant Freund ' s adjuvant) are made comparisons.3x10³ The streptococcus pneumoniae of CFU (bacterium quantity) " serotype 3 " it is used for infecting those through the neural immunoenzymatic mice of amino acid. Wherein, Freund's complete adjuvant complete Freund ' s adjuvant be first immunity inoculation time use, and Incomplete Freund's adjuvant incomplete Freund ' s adjuvant is then to make during three immunity inoculations afterwards With.It is respectively adopted the adjuvant that ratio is 1:1 of immunity inoculation and the ratio of antigen.Exempt from four neural amino acid enzymes Epidemic disease Mice Inoculated and the infection of streptococcus pneumoniae subsequently, the most then see and look into feeding survival rate of mice in 14 days (%) change, wherein, n is the quantity of lab mice.Fig. 5 shows that vaccination tests is to different serotypes again The result of streptococcus pneumoniae infection, the neural amino acid enzyme (NanA, NanB and NanC) of three various combinations is each 10 μ g are as antigen, difference 5 mices of immunity (BALB/C, month big).

Shown in Fig. 3, Fig. 4 and Fig. 5, the present invention is to utilize NanA, NanB and NanC protein of restructuring As antigen thing, resist the streptococcus pneumoniae infection of various serotype in order to immune mouse.In order to the most various The immune effect of antigen thing, neural amino acid enzyme NanA, NanB and NanC of out of the ordinary or combination (10-μ g antigen/ Injection；It is about the animal body of 0.5 milligram/per kilogram weight) in order to one month big BALB/C mice of immunity, often Within two weeks, inject once, totally four times, polysaccharides vaccine PPV23 (23-valent simultaneouslyMerck Sharp&Dohme Corp., NJ08889, USA) it is used to as positive control group；And normal saline solution PBS Then it is taken as negative matched group.Freund's complete adjuvant and incomplete Freund's adjuvant are respectively used to for the first time and 2-4 time Time with antigen 1: 1 mixes, and injects mice the most again.Inject for four times after totally eight weeks, on the one hand extract the blood of mice Clearly, with enzyme linked immunosorbent adsorption test (enzyme-linked immunosorbent assay, ELISA) method Analyze the reaction (Fig. 3) of antibody-antigene；On the other hand in tail vein injection mode, by the pneumonia chain of serotype 3 Coccus (3x10³Cfu) infecting mouse in mice is injected, and the survival rate (Fig. 4) of 14 days small mouses after observing； And serotype 3 (5x10⁶Cfu), serotype 6B (7x10⁸Cfu), serotype 14 (1x10⁸Cfu), blood Clear type 15B (7x10⁸Cfu), serotype 19A (7x10⁸And serotype 23F (1x10 cfu)⁸Cfu), And the survival rate (Fig. 5) of 15 days small mouses after observing.

In order to confirm the polyclone being obtained anti-neural amino acid enzyme in the neural immunoenzymatic mice of amino acid (polyclonal) effect of serum, the present invention uses the ELISA flat board (Corning of 96 little potholes Incorporated, Corning, New York, USA) analyze antibody-antigene reaction, first by nerve amino acid Enzyme NanA, NanB and NanC attach in the little pothole of ELISA flat board, then by many for various anti-neural amino acid enzymes Polyclonal serum adds in each little pothole, and the serum combination of these anti-neural amino acid enzymes includes other nerve amines acid Enzyme (NanA, NanB or NanC), neural amino acid enzyme A+B(NanA+NanB) and three kinds of neural amino acids Enzyme A+B+C(NanA+NanB+NanC).And use the sheep anti-mouse igg (Sigma of mustard peroxidase labelling Company) as second antibody, and use tetramethyl benzidine/peroxidating (R&D Systems, Minneapolis, MN, the U.S.) develop the color (wavelength 405nenometer) (EMax, Molecular Devices, Sunnyvale, CA94089, the U.S.).

Result shows the polyclonal serum through neural amino acid enzyme anti-produced by the neural immunoenzymatic mice of amino acid, phase For matched group (only with Freund's complete adjuvant and Freund's incomplete adjuvant in PBS mixing), all can exclusively identification nerve Amino acid enzyme, when antibody antigen response value is expressed in logarithmic, all can have the increase of 3-4 logarithm value.Display is with god It is that a kind of preferably reagent carrys out immune mouse through amino acid enzyme, produces the antibody of anti-neural amino acid enzyme.

In order to develop the vaccine of the streptococcus pneumoniae tackling various serotype, the present invention uses single or three kinds of nerves The combination of amino acid enzyme is as the reagent of immune mouse.It is by produced by the nerve amines phytase gene of streptococcus pneumoniae Restructuring neural amino acid enzyme, normal saline solution PBS and Freund adjuvant Freund ' s adjuvant are as immunity inoculation Constituent, wherein the neural amino acid enzyme of restructuring comprises NanA protein, NanB protein and NanC protein, Wherein this Freund adjuvant can be complete or incomplete Freund adjuvant complete or incomplete Freund ' s adjuvant.This constituent manufacturing step is: 1. according to the agent of the weight nerve amino acid enzyme of animal body Amount, i.e. the animal body at per kilogram weight uses one of NanA, NanB and NanC or several composition each 0.5 The neural amino acid enzyme of milligram.2. with physiological saline water concocting nerve amines acid enzyme concentration so that it is have with Freund adjuvant Identical proportion.3. neural amino acid enzyme after concocting via step 2 and complete or incomplete Freund adjuvant with Equal-volume completes protein vaccine constituent than blending, and its embodiment is to be an interval injection animal body one every two weeks Secondary, totally four injections.The wherein use of the injection for the first time protein vaccine constituent containing complete Freund's adjuvant, and its Excess-three time then uses the protein vaccine constituent containing incomplete Freund's adjuvant.After last vaccine preparation injection every Two weeks, then give the infection of different serotypes streptococcus pneumoniae, and the mode of infection animal body is with intravenous injection Method is carried out.The bacterium number wherein used is respectively 3x10³Cfu S. pneumoniae serotypes 3 (Fig. 4), 5x10⁶cfu Serotype 3 (Fig. 5 A), 1x10⁸Cfu serotype 14 (Fig. 5 B), 7x10⁸Cfu serotype 19A (Fig. 5 C), 7x10⁸Cfu serotype 6B (Fig. 5 D), 7x10⁸Cfu serotype 15B (Fig. 5 D), 1x10⁸Cfu serotype 23F (Fig. 5 E).Record the survival rate of mice every day.

Result as shown in Figure 4, is vaccine when using three kinds of neural amino acid enzymes (NanA, NanB and NanC) simultaneously During reagent, the survival rate of mice is the highest, reaches 67%, and its effect is as used existing vaccine PPV23.But knot Fruit as it is shown in figure 5, when the reagent using three kinds of neural amino acid enzymes (NanA, NanB and NanC) to be vaccine simultaneously, Mice tackles the survival rate of the streptococcus pneumoniae infection of various serotype (3,14,19A, 6B, 15B and 23F), Being up to 60%, 60%, 20%, 60%, 40% and 40% respectively, its effect better than uses existing vaccine PPV23. Therefore the combination being used together three kinds of neural amino acid enzymes is a kind of most potential universal protein vaccine reagent, can In order to tackle the streptococcus pneumoniae infection of various serotype.

This protein vaccine constituent can be applicable to a large amount of commercial production of neural amino acid enzyme ferment, and becomes commodity The product changed.This neural amino acid enzyme ferment can as to its specificity by matter (substrate), such as sialic acid (Sialic Acid), specificity combine and the application of chemical reaction.

The antiserum after antibody or the immunity inhibitory action to nerve amines phytase activity:

Please refer to Fig. 6, Fig. 7 and Fig. 8, display nerve amines phytase activity is suppressed by narrow spectrum antibody Correlation test, foundation " utilize the activity presenting to confirm the neural amino acid enzyme of restructuring of T antigen on cell " single Method described by unit, i.e. by restructuring nerve amino acid enzyme (NanA, NanB or NanC) immunity of total length and reduction After rabbit and mice, produced anti-neural amino acid enzyme serum is used to suppress the activity of neural amino acid enzyme.Wherein, Fig. 6 A, Fig. 6 B and Fig. 6 C are for testing neural amino acid through the rabbit antiserum of neural amino acid enzyme immunity inoculation The inhibitory action schematic diagram of enzymatic activity；Fig. 7 A, Fig. 7 B and Fig. 7 C are little through neural amino acid enzyme immunity inoculation again Mouse Antisera is used for testing the inhibitory action schematic diagram to nerve amines phytase activity；Fig. 8 A, Fig. 8 B and Fig. 8 C again For being used for testing through the antiserum of the neural amino acid enzyme time cloning strain immunized mice of reduction, neural amino acid enzyme is lived The inhibitory action schematic diagram of property.Identify T antigen with the PNA lactin of FITC labelling, and utilize streaming thin Born of the same parents' instrument carrys out quantitative analysis nerve amino acid enzyme and acts on T antigen exposure produced by red blood cells surface, individually NanA, NanB and NanC nerve amino acid enzyme respectively from different anti-neural amino acid enzyme antiserums (30 μ g/mL) Effect, the most also includes the NanC antiserum of purification, and wherein, Fig. 6 A, Fig. 7 A represent rabbit and little respectively The anti-neural amino acid enzyme antiserum of Mus acts on different amounts of NanA respectively, and the test volume of these NanA exists respectively Fig. 6 A is 1 μ g(black surround), 0.1 μ g(white edge) and 0.01 μ g(ash frame), and figure 7A is 1 μ g(black surround), and be 0.0005 μ g(black surround in fig. 8 a)；Fig. 6 B, Fig. 7 B scheme Represent respectively the NanB of 1 μ g respectively with rabbit and anti-neural amino acid enzyme antiserum effect (white edge) of mice, And be 0.005 μ g(black surround in the fig. 8b)；Fig. 6 C, Fig. 7 C represent the NanC of 1 μ g respectively with rabbit The anti-neural amino acid enzyme antiserum effect (ash frame) of son and mice, and be 0.05 μ g(black surround in Fig. 8 C). " * " represents p < 0.05, for having significance relative to matched group, the i.e. control treatment of preimmune serum.

Wherein for the activity of the neural amino acid enzyme of suppression more efficiently, the present invention utilizes a-protein (Protein A Sepharose beads, GE Healthcare) carry out the serum of the anti-NanC of purification.The work of the neural amino acid enzyme of suppression The assay method of property is as follows:

In 10-μ l PBS, add different amounts of neural amino acid enzyme, and with the serum of 10-μ L separate sources, Effect 5 minutes at room temperature.In order to quantify the neural repressed activity of amino acid enzyme, the present invention is with RBC cell The degree that presents of T antigen as foundation, and utilize the PNA agglutinin through FITC fluorescence calibration (FITC-labeled PNA lectin), acts on 1 hour at 4 DEG C, carrys out quantitative T antigen.Special feature Being little at present at 4 DEG C and 1, agglutinin only can be combined with T antigen, and does not easily cause the coagulation of cell, so Can avoid causing the obstruction of flow cytometry analysis pipeline because of the formation of cell mass, if neural amino acid enzyme Activity is suppressed by the serum of single-minded anti-neural amino acid enzyme, then the amount of FITC fluorescence calibration T antigen will reduce.

Y-axis such as Fig. 6 A, Fig. 6 B and Fig. 6 C shows, NanB and NanC presents the ability of T antigen and seem remote Less than NanA, when using the anti-neural amino acid enzyme serum from rabbit, the research of the present invention finds: 0.1-μ g Can be suppressed completely by the anti-NanA serum of 10-μ L with the NanA of 0.01-μ g, but 1-μ g NanA quilt After the anti-NanA serum effect of 10-μ L, still remnants have the activity (Fig. 6 A) of 20%；But 1-μ g NanB is but (Fig. 6 B) can be suppressed completely by the anti-NanB serum of 10-μ L；But 1-μ g NanC is only by 10-μ L Anti-NanC serum suppression 40% activity, wherein, when use purification cross 30-μ g anti-NanC antibody time, Then can suppress the activity (Fig. 6 C) of 90%NanC.

Also it is used to test its cross-protection as specific anti-neural amino acid enzyme serum.Found that it is anti- NanA serum can not suppress the activity of NanB and NanC, same anti-NanB and NanC serum to suppress The activity (Fig. 6 A) of NanA；But, anti-NanB serum then can suppress the activity of 74%NanC；Anti-NanC The anti-NanC antibody of serum and purification, compared to the serum before immunity, can suppress 40% and 76%NanB the most respectively Activity (Fig. 6 B and Fig. 6 C).

On the other hand, the present invention is with the antiserum of serial dilution, when acting on different amounts of neural amino acid enzyme, and can To suppress 50% nerve amines phytase activity, found that the anti-NanA serum of 1,8 and 32 times of dilutions, respectively can So that the NanA of 1,0.1 and 0.01 μ g, lose 50% nerve amines phytase activity.But 16 times of dilutions Anti-NanB serum, so that the NanB of 1 μ g, loses 50% nerve amines phytase activity；And as anti-NanC When the anti-NanC antibody of serum and purification does 1 and 8 times of dilution respectively, then the NanC of 1 μ g can be made to lose 50% nerve amines phytase activity.

When using the anti-neural amino acid enzyme serum of mice, when suppressing neural amino acid enzyme active, its result with come It is similar (as shown in Fig. 7 A, Fig. 7 B and Fig. 7 C) from the serum of rabbit.The anti-NanA of 10-μ L mice and NanB serum can completely inhibit 0.1-μ g NanA and the activity of 1-μ g NanB respectively；But, 10-μ L The anti-NanC serum of mice then may only suppress the work of about 50%NanC (1-μ g) compared to the serum before immunity Property.

When using from anti-god produced by the neural amino acid enzyme time cloning strain immune mouse of a series of reductions further When amino acid enzyme serum (as shown in Fig. 8 A, Fig. 8 B and Fig. 8 C), compare the effect of its suppression nerve amines phytase activity Really, if can be (such as Fig. 6 and figure as the serum of previously hung oneself total length nerve amino acid enzyme immune rabbit and mice Shown in 7).Its result shows that only time cloning strain NanA4, NanB3 and NanC4 have equivalent total length nerve amines Effect of acid enzyme.Wherein with the serum of NanC4 immune mouse except NanC nerve amino acid can be suppressed in specific manner Outside enzymatic activity, it is also possible to the activity of intersection suppression NanB nerve amino acid enzyme.

The impact that T antigen on red blood cell is exposed to the open air by the mutant of NanB and NanC nerve amino acid enzyme:

In order to prove that not only NanA also has NanB and NanC nerve amino acid enzyme to have important biological function equally. First construction NanB and the mutant of NanC nerve amino acid enzyme, and mutant is infected little in intravenous injection mode Mus, analyzes the difference (such as Fig. 9) that on mice red blood cell, T antigen exposes to the open air.

For construction NanB and the mutant of NanC nerve amino acid enzyme, first expand nanB and nanC base with PCR Cause.It is similar to described in Figure 1A, uses general carrier, as carrier (RBC Biosicience, platform are grown in TA choosing Gulf), the gene of amplification is loaded in carrier.On the other hand with PCR amplification, spectinomycin had resistance Gene " spc " (GI:1185605;Accession number:CVU46202), then it is respectively connected to nanB Limit in enzyme action position with MscI and DraI of nanC gene, and in order to turn shape escherichia coli, and with Spectinomycin screens the clone strain with spectinomycin resistance, be nanB::spec and The mutant clon strain of nanC::spec.The DNA of this mutant clon strain i.e. may be used to turn shape streptococcus pneumoniae 6B.Cause The mutant clon DNA of nanB::spec and nanC::spec cannot be survived in streptococcus pneumoniae, thus when with Spectinomycin screens the clone strain with spectinomycin resistance, i.e. represents this DNA and has occurred double Restructuring Homo~logous exchange (double-crossing-over homologous recombination) and intercalation enter dyeing In body, obtain nanB and the nanC mutant of streptococcus pneumoniae 6B the most respectively.

It is illustrated in figure 9 research streptococcus pneumoniae nanB and T antigen on red blood cell is exposed by nanC mutant The impact of dew.NanB and nanC mutant and wild type 6B streptococcus pneumoniae are connect with intravenous injection respectively Planting BALB/c mouse, these three kinds process 16 mices of inoculation the most respectively, and using PBS as without any strain The negative control group processed.Then at first (Fig. 9 A), second (Fig. 9 B), the 3rd (Fig. 9 C), the 5th (figure The red blood cell of tested mice is gathered respectively, as dividing that T antigen exposes to the open air time 9D) and seven day (Fig. 9 E) Analysis.Such as the method exposing analysis to the open air previously as T antigen, T antigen exposes to the open air and can produce because of the effect of neural amino acid enzyme Thus can be combined by the PNA lectin agglutinin of FITC fluorescence calibration.With this at the P1 of flow cytometer The erythrocyte that in door, (gating area) is demarcated by FITC, except upper erythrocytic sum, can obtain percentage ratio. Relatively these the four kinds P1 fluorescent labeling percentage ratios processed, result shows streptococcus pneumoniae nanB in the live body of mice Act on the T antigen of ball of invigorating blood circulation, the most significantly than wild-type strain with the neural amino acid enzyme of nanC mutant Activity is the lowest.(the p value of statistical analysis is all especially all to have significant meaning when the second, the 5th and the 7th day Less than 0.05).It is then wherein the erythrocyte T calculating all tests with the result of the 7th day further in Fig. 9 F The percentage ratio of antigen, i.e. in the way of positive with negative percentage ratio is as presenting；Result is again shown in mice Live body in the neural amino acid enzyme of streptococcus pneumoniae nanB and nanC mutant act on the T antigen of ball of invigorating blood circulation in Now go up, lower than the activity of wild-type strain the most significantly.It can thus be appreciated that NanB and NanC of streptococcus pneumoniae Neural amino acid enzyme, in the live body of mice, the most all has important biological function.

Summary result shows, all has whether from neural amino acid enzyme serum anti-produced by rabbit or mice Suppress or neutralize the activity of neural amino acid enzyme in specific manner.Also define the neural amino acid enzyme of optimal reduction simultaneously Time cloning strain, the effect of the neural amino acid enzyme of its effect equivalent total length, i.e. anti-nerve amines produced by immune mouse Acid enzyme serum all has specificity suppression or neutralizes the equivalence activity of neural amino acid enzyme.On the other hand, the most anti-NanB Having cross-protection with anti-NanC serum, anti-NanA serum does not then have this to act on.Although anti-NanC blood Suppress clearly or neutralize the activity of neural amino acid enzyme and be not so good as anti-NanA and anti-NanB serum, and using single kind Or two kinds (NanA+NanB) neural amino acid enzyme, its effect the most all be not so good as to combine making together with three kinds of neural amino acid enzymes With also to get well.Show when using three kinds of neural amino acid enzymes to combine together, can be best vaccine preparation.

It is specifically described described previously for the technical characteristic that presently preferred embodiments of the present invention is the present invention；Only, ripe Know the personage of technique when under spirit and the principle without departing from the present invention, the present invention being changed and repair Change, and such change and amendment, all should be covered by the category that following claim is defined.

Claims (7)

1. having a protein vaccine constituent for antagonism streptococcus pneumoniae infection, it is by streptococcus pneumoniae strain The neural amino acid enzyme of the produced restructuring of the nerve amines phytase gene of CGSP14, normal saline solution and Freund adjuvant Freund ' s adjuvant as the constituent of immunity inoculation, wherein the neural amino acid enzyme of restructuring comprise NanA protein, NanB protein and NanC protein, described NanA protein is nanA4, its aminoacid sequence such as SEQ Shown in ID NO:4；Described NanB protein is nanB3, and its aminoacid sequence is as shown in SEQ ID NO:5； Described NanC protein is nanC4, and its aminoacid sequence is as shown in SEQ ID NO:6；Wherein eat with physiology The neural amino acid enzyme concentration of salt water concocting restructuring so that it is with Freund adjuvant, there is identical proportion, the nerve amines after blending Acid enzyme and Freund adjuvant form protein vaccine constituent with equal-volume ratio again.

2. protein vaccine constituent as claimed in claim 1, it is characterised in that this Freund adjuvant be complete or Incomplete Freund adjuvant complete or incomplete Freund ' s adjuvant.

3. protein vaccine constituent as claimed in claim 1, it is characterised in that this streptococcus pneumoniae comprises institute There is the serological type strain of type.

4. protein vaccine constituent as claimed in claim 1, it is characterised in that the neural amino acid enzyme of this restructuring Including the neural amino acid enzyme region of reduction, it still has effect of total length nerve amino acid enzyme, can effectively suppress neural Amino acid enzymatic activity, the LamG gene of NanA gene is contained in the region after this reduction and sialidase sialidase surpasses The region of level homology family, and the super homology of LamG gene respectively from NanB gene and NanC gene The region of family.

5. the application of protein vaccine constituent as claimed in claim 1, described application is for being used for preparing antagonism pneumonia Application in the pharmaceutical composition of streptococcal infection.

6. the application of protein vaccine constituent as claimed in claim 1, described application is for for neural amino acid The preparation of enzyme ferment, this neural amino acid enzyme ferment can be combined and change by the specificity of matter as to its specificity Learn the application of reaction.

7. the application of protein vaccine constituent as claimed in claim 6, described application is for for nerve The preparation of amino acid enzyme ferment, this neural amino acid enzyme ferment can be as anti-to the combination of sialic specificity and chemistry The application answered.