CN104055772A - Application of berberine in inhibition of expression of gene PPP1R3C - Google Patents

Abstract

The invention relates to the field of biomedicines and medicines, and in particular relates to berberine for inhibiting liver gluconeogenesis by inhibiting an expression of a gene PPP1R3C and a function of the gene PPP1R3C for promoting the gluconeogenesis. The level of mRNA of the gene PPP1R3C is decreased by the berberine in a time and dose depending manner. Thus, the result proves that the action mechanism of the berberine for inhibiting the gluconeogenesis is carried out by decreasing the expression of the gene PPP1R3C, namely, the gene expression of a key enzyme of the gluconeogenesis can be inhibited after the expression of the gene PPP1R3C is disturbed by the berberine so as to realize the gluconeogenesis inhibition. Thus, the gene PPP1R3C can be used for preparing and screening a medicine for inhibiting or promoting the gluconeogenesis.

Description

The application of berberine aspect inhibition PPP1R3C gene expression

Technical field

The present invention relates to medicine and biomedical sector, be specially the expression of the berberine inhibition PPP1R3C gene that suppresses liver glyconeogenesis, and PPP1R3C gene promotes the effect of glyconeogenesis.

Background technology

People living condition's improvement and the variation of dietary structure increase the danger of facing mankind noninfectious day by day, type 2 diabetes mellitus patient quantity sharply rises, diabetes and complication thereof are brought serious burden to human health and social development, prevention and the treatment type 2 diabetes mellitus public health problem that become international.

Liver is in human body, to participate in the vitals of Nutrition and Metabolism and the energy balance, to maintaining body glucose stable state, has important function.The hyperglycemia that the increase of liver glyconeogenesis causes is the key character of type 2 diabetes mellitus.

On an empty stomach, the energy source of body changes lipid mobilization into from glucose zymolysis, hypoglycemia stimulates alpha Cell of islet secretion glicentin simultaneously, and hepatic glycogen decomposition, glyconeogenesis are increased, and to maintain erythrocyte and brain etc., only can rely on the energy supply of the tissue of glucose energy supply; After feed, blood glucose increases and stimulates insulin secretion, and insulin promotes liver ingestion of glucose glycogen biosynthesis, and suppresses hepatic glycogen and decompose and glycogen heteroplasia.The hyperglycemia that the increase of Endogenous glucose output causes is the key character of type 2 diabetes mellitus, and liver glyconeogenesis is the main source of Endogenous glucose output.Therefore, about the study on regulation of this physiological process of liver glyconeogenesis, the control for type 2 diabetes mellitus just has very important significance.

Glyconeogenesis process is glucolytic inverse process, comprise that (G6P generates glucose to three irreversible reactions, 1,6 fructose diphosphate generate fructose-1, 6-diphosphate, acetone acid generates phosphoenolpyruvate), need four catalyzing enzymes not shared with glycolytic cycle---pyruvate carboxylase (PC), PEPCK, G6pase, Fbpase.PC is subject to the allosteric activation of S-acetyl-coenzyme-A, and Fbpase is suppressed by the allosteric of 2,6-fructose diphosphate, about them, known little by the information of transcriptional control.It is less that the activity of PEPCK, G6pase is subject to allosteric to regulate, transcribe the report of rear adjusting, they are mainly subject to the transcriptional control of multiple hormone signal, have insulin, thyroxin, glucocorticoid receptor (GR), cAMP response element in PEPCK, G6pase promoter.

The extract berberine of Chinese Drug Rhizomes of Coptis has significant hypoglycemic fat-regulating effect, and its blood sugar lowering mechanism has become the study hotspot in metabolism field in recent years.Metformin is in the world most widely used oral hypoglycemic thing, and increasing clinical research and animal model all confirm that the most important functions of Or Metformin In Treating diabetes is to suppress liver glyconeogenesis, but concrete mechanism of action is not illustrated yet completely.

Summary of the invention

The present invention aims to provide the application that berberine suppresses the expression of PPP1R3C gene.

The present invention also provides the application of PPP1R3C gene aspect increase or inhibition glyconeogenesis.

By relatively berberine and the metformin effect to inhibition liver glyconeogenesis, its drug effect has many similarities, be time and dose dependent and reduce mouse liver primary cell and take the glyconeogenesis that Lactic acid and Pyruvic acid is substrate, but mechanism of action incomplete same.

Metformin and berberine all can reduce glycogen heteroplasia key enzyme PEPCK, G-6-Pase (G6pase), fructose 1, the mRNA level of 6-diphosphatase (Fbpase) and associated transcription factor FOXO1, CCAAT enhancer binding protein (C/EBP) α, C/EBP β, HNF (HNF) 4 α, peroxisome proliferator-activated receptor γ co-activation (PGC) 1 α; Reduce the promoter activity of PEPCK, suppress the protein expression of PEPCK; All do not affect the phosphorylation of CREB, but all can promote CRTC2 phosphorylation; All can increase the phosphorylation of AMPK (protein kinase of AMP activation) and acetyl-CoA carboxylase (ACC), but the inhibitor Compound C of AMPK only can reverse the effect of metformin, invalid to berberine.

PPP1R3C (protein phosphatase 1 regulatory subunit 3C) is the adjusting subunit of protein phosphatase 1 (PP1).PP1 belongs to a class of albumen serine/threonine phosphatase, participates in the adjusting of a series of cell functions by other albumen of dephosphorylation.PP1 controlling that glycogen metabolism, muscle contraction, cell cycle progression, neuron activity, RNA shearing, mitosis, cell division, apoptosis, albumen are synthetic, the aspects such as adjusting of membrane receptor and membrane channels play an important role.Each PP1 enzyme comprises a catalytic subunit PP1C and an adjusting subunit PP1R.PP1C is a 30kD single domain albumen, conservative at eukaryotic cell inner height, illustrates that catalyst mechanism is all identical.The realization of PP1 function depends on its catalytic subunit and is combined with a series of adjusting subunit, PP1C can with different adjustment subunit combinations, so it has different effects.Regulate subunit can make PP1C be anchored into special cell subunit, combine with specific substrate, and extracellular signal is produced to reaction.PP1R comprises PPP1R5, PPP1R3A/GM, PPP1R3B/GL, PPP1R3C/PTG/R5, R6, PPP1R4, PPP1R8 etc.PPP1R3C/PTG, R6, GM and GL are all glycogen grappling subunits of PP1, can make PP1C be bonded to glycogen, but GM and GL mainly at striped muscle and liver expression, and PPP1R3C/PTG and R6 expression tissue are more extensive.These four regulate subunit conservative between same species, illustrate that their mechanism of action is also incomplete same, but the variation of these four subunit expressions all can cause insulin resistant and type 2 diabetes mellitus.PP1 is by regulating glycogen metabolism to have important function to glucostasis.Glycogen is synthetic by glycogen synthetase (glycogensynthase, GS) catalysis, and glycogenolysis is by glycogen phosphorylase (glycogen phosphorylase, GP) catalysis, and the activity of these two enzymes is all subject to phosphorylation/dephosphorylation to modify regulation and control.GS by protein kinase phosphorylations such as PKA, GSK3 (glycogensynthase kinase3) after its activity inhibited, by activation recovering after GSP (glycogen synthasephosphatase) dephosphorylation.In contrast, GP activates after by protein kinase phosphorylation, by inactivation after PP1 dephosphorylation.By affecting phosphatase a, (phosphorylase a) transforms with phosphatase b (phosphorylase b) PP1 mutually, and the synthetic and decomposition of glycogen is had to important function.(phosphorylase is a) glucorceptor in hepatocyte to phosphatase a, when glucose level is low, phosphatase a and PP1 in the state of activation combine closely, the phosphatase activity that stops PP1, keep phosphatase a in the state of activation, promote glycogenolysis until blood glucose acquires a certain degree.When glucose level is very high, phosphatase a inactivation, PP1 disintegrates down from their complex, and PP1 dephosphorylation phosphatase a, makes it become phosphatase b, stops the decomposition of glycogen, promotes the synthetic of glycogen.In cellular level and animal model, cross express or knock out the experiment of PPP1R3C/PTG clear and definite PTG regulating the importance of glycogen in synthetic, after knocking out such as report mice PPP1R3C/PTG heterozygosis such as Sean, can cause a plurality of tissue glycogens dyssynthesis and insulin resistant with age.In crossing the Chinese hamster ovary cell of expression of insulin receptor, cross and express PPP1R3C/PTG and can significantly increase basis synthetic with glycogen insulin stimulating.

And berberine is time and dose dependent reduces the mRNA level of PPP1R3C.By cDNA cDNA microarray, going out PPP1R3C is the pivotal role target spot that berberine regulates glyconeogenesis, the mechanism of action that confirms berberine inhibition glyconeogenesis is by lowering the expression of PPP1R3C gene, the activity of Profilin phosphatase 1 (PP1), PP1 weakens the dephosphorylation of p-CRTC2, p-CRTC2 blocks in endochylema, can not enter core and bring into play the effect that it promotes PEPCK genetic transcription.But also confirmed excessively expressing and can increase glyconeogenesis of PPP1R3C gene, and disturb the expression of PPP1R3C gene can suppress the expression of glyconeogenesis key enzyme, suppress glyconeogenesis.

PPP1R3C/PTG has significant impact to the balance of blood glucose and stable state, but is all around glycogen metabolism aspect substantially about the research of PPP1R3C/PTG, and whether about it, participate in regulating the process of glyconeogenesis is a unknown field completely.Chip detection result of the present invention and follow-up confirmatory experiment explanation PPP1R3C and glyconeogenesis process have very large dependency, in Mouse Liver primary cell, cross expression PPP1R3C and can increase glyconeogenesis, and can suppress glyconeogenesis key gene after the expression of interference PPP1R3C, express, suppress glyconeogenesis.Therefore, PPP1R3C gene can be suppressed or promotes the medicine of glyconeogenesis for the preparation of screening.

The invention provides berberine and suppressing the expression of PPP1R3C gene and suppressing the mrNA of the PPP1R3C gene application aspect horizontal, can be by berberine for the preparation of suppressing the medicine of PPP1R3C gene expression and suppressing the medicine of the mRNA level of PPP1R3C.

Accompanying drawing explanation

Fig. 1 is in embodiment 1, concentration of glucose temporal evolution under the effect of 2mmol/L metformin

Fig. 2 is in embodiment 1, concentration of glucose temporal evolution under 2.5 μ mol/L berberine effects

Fig. 3 is in embodiment 1, the variation of concentration of glucose under various dose metformin and berberine effect

Fig. 4 is in embodiment 1, the horizontal temporal evolution of mRNA of glycogen heteroplasia related gene under the effect of 2mmol/L metformin

Fig. 5 is in embodiment 1, the horizontal temporal evolution of mRNA of glycogen heteroplasia related gene under 2.5 μ mol/L berberine effects

Fig. 6 is in embodiment 1, the horizontal temporal evolution of mRNA of glycogen heteroplasia related gene under the effect of various dose metformin

Fig. 7 is in embodiment 1, the horizontal temporal evolution of mRNA of glycogen heteroplasia related gene under the effect of various dose berberine

Fig. 8 is in embodiment 1, the inhibition to PEPCK mover activity under the effect of various dose berberine

Fig. 9 is in embodiment 2, mice empty stomach and the impact of taking food again on PPP1RC3 gene and glyconeogenesis related gene expression

Figure 10 is in embodiment 2, by cDNA chip detection result after berberine processing mouse primary liver cell,

Figure 11 is in embodiment 2, PPP1RC3 gene expression temporal evolution under 2.5 μ mol/L berberine effects

Figure 12 is in embodiment 2, the variation of various dose berberine effect PPP1RC3 gene expression after 8 hours

Figure 13 is in embodiment 2, and transfection PPP1R3C crosses the expression of expressing liver primary cell PPP1R3C after adenovirus

Figure 14 is in embodiment 2, and after transfection PPP1R3C crosses expression adenovirus, liver primary cell glyconeogenesis changes

Figure 15 is in embodiment 2, the variation of PPP1RC3 gene expression after the little interference adenovirus of transfection PPP1R3C

Figure 16 is in embodiment 2, the variation of PEPCK, G6pase gene expression after the little interference adenovirus of transfection PPP1R3C

In Figure 17 embodiment 2, after the little interference adenovirus of transfection PPP1R3C, glyconeogenesis changes

The specific embodiment

Embodiment 1 berberine and metformin suppress hepatic gluconeogenesis

One, the separation of mouse liver primary cell

1, get 10～12 week age, body weight is the male C57 mice of 18～20g approximately, preoperatively freely enters diet, lumbar injection 1% pentobarbital 0.1ml/g anesthesia; Separated liver, and liver is put into sterile petri dish, the 0.05%IV Collagenase Type of slowly in vitro circumfusion 20ml37 ℃ preheating, until there is be full of cracks in liver surface, approximately after 15～20min, pour into completely, with shears, cut off peplos, shears point is gently scraped connective tissue makes hepatocyte separated; Culture dish is taken to the super-clean bench (using in advance ultra-vioket radiation 30min) into cell room, with the screen filtration cell suspension of 100 μ m.The centrifugal 5min of 4 ℃ of 500 turn/min (upper and lower acceleration is 5), abandons supernatant, adds ice PBS liquid 20ml to blow and beat gently, mixes, if there is bulk tissue impurity to choose with liquid-transfering gun, repeats above-mentioned steps totally three times.Clean completely, with hepatocyte training liquid re-suspended cell, after bed board 24h, cell attachment can change common DMEM training liquid into.

2, MTT experiment confirms: effect 24h, berberine in mice liver primary cells more than 5 μ mol/L has overt toxicity effect (P<0.05), the berberine of 2.5 μ mol/L is all no more than 2.5 μ mol/L by its tolerant maximum effect concentration, subsequent experimental berberine activity used; And HepG2 cell can tolerate the berberine of 10 μ mol/L and following concentration.The activity list of references of metformin is definite, and its activity is no more than 2mmol/L.

Two, the impact of metformin and berberine in mice liver primary cell glyconeogenesis

(1) method

1. separated mouse liver primary cell is laid in 24 orifice plates, after adherent 24h, with the DMEM training liquid of high sugar and DMEM training liquid configuration low sugar (5mmol/L) the DMEM training liquid of sugar-free, add 100nmol/L Dex pretreatment 16h, add again containing the sugar-free of glyconeogenesis substrate (10mmol/L-lactic acid/1mmol/L-acetone acid) and 100nmol/L dexamethasone (DEX)/100 μ mol/L cAMP and train liquid without phenol red DMEM, add the metformin of respective concentration or berberine to process different time simultaneously;

2. collecting cell culture medium supernatant, 4 ℃ of centrifugal 10min of 2000 * g, get supernatant to be measured;

3. in 96 orifice plates, first add 5 μ l blanks (sugar-free is without phenol red DMEM training liquid), standard substance (being 2000,1000,500,250,125,62.5,31.25,15.625 μ M without phenol red DMEM training liquid dilution 10mmol/L dextrose standard sample with sugar-free) and sample to be tested, add 195 μ l working solutions (being configured by 4:1 by R1 in test kit and R2), 15s slightly vibrates again;

In 4.37 ℃ of water-baths, hatch 20～30min, 570nm measures absorbance, can obtain the concentration of glucose of sample to be tested according to standard curve.

(2) result

1, metformin and berberine are time dependence reduction liver glyconeogenesis

At sugar-free, without phenol red DMEM, train in liquid, add 1mmol/L acetone acid and 10mmol/L lactic acid as the substrate of glycogen heteroplasia, dexamethasone and cAMP represent that respectively the signal path of glucocorticoid and glicentin stimulates liver glyconeogenesis (being Pyrucate/Lactate+Dex/cAMP), by the concentration of glucose detecting in culture medium, reflect liver primary cell glyconeogenesis level, metformin (Pyrucate/Lactate+Dex/cAMP+Met) and berberine (Pyrucate/Lactate+Dex/cAMP+BBR) can be time dependence and reduce hepatocyte Endogenous glucose output.When 2mmol/L metformin effect 4,8,12 and 24h Hepatic glucose production decline respectively 28%, 56%, 80% and 98% (all P<0.05, compares with acetone acid/lactic acid+dexamethasone/cAMP, ^ap<0.05, Fig. 1).When the berberine effect 2,4,8,12 of 2.5 μ mol/L and 24h Hepatic glucose production decline respectively 33%, 57%, 65%, 76% and 92% (all P<0.05, compares with acetone acid/lactic acid+dexamethasone/cAMP, ^ap<0.05, Fig. 2).

2, metformin and berberine are dose dependent reduction liver glyconeogenesis

Action time is while being 8h, compared with the control, 0.1,0.25mmol/L metformin effect not obvious, when concentration is 0.5mmol/L, metformin starts to work, 2mmol/L metformin obviously reduces hepatic glucose production [(79.51 ± 1.52 couples 343.87 ± 37.96) μ mol/L, P<0.05], after adding the inhibitor Compound C of AMPK, obviously weaken the inhibition [(176.42 ± 0.97 couples 79.51 ± 1.52) μ mol/L, P<0.05] that metformin produces glycogen simultaneously; The berberine of 0.1 μ mol/L is without the effect that reduces glyconeogenesis, 0.5, the effect of 1 μ mol/L is also not fairly obvious, 2.5 μ mol/L berberine obviously reduce hepatic glucose production [(100.37 ± 16.10 couples 343.87 ± 37.96) μ mol/L, P<0.05], but can not reverse inhibition (Fig. 3 that berberine produces glycogen after adding Compound C, with the comparison of substrate matched group ^ap<0.05; Organize relatively with adding dexamethasone/cAMP, ^bp<0.05; With add the comparison of dexamethasone/cAMP group+2mM metformin group, cP<0.05).

3, metformin and berberine time dependence reduce the mRNA level of glycogen heteroplasia related gene

PEPCK, G-6-Pase (G6pase), fructose 1,6-diphosphatase (Fbpase) is the required catalyzing enzyme of glyconeogenesis approach, and PEPCK wherein, G6pase are the rate-limiting enzymes of glyconeogenesis process.FOXO1, CCAAT enhancer binding protein (C/EBP) α, C/EBP β, peroxisome proliferator-activated receptor γ co-activation (PGC) 1 α, HNF (HNF) 4 α have transcribed the transcription factor of positivity regulating and controlling effect to PEPCK, G6pase.

By the reaction system of fluorescence real-time quantitative PCR, detect.Design of primers: genome sequence website (NCBI) searches gene order, the interference that the selection of extension increasing sequence adopts the strategy across intron to pollute to get rid of DNA, primer all adopts Primer3.0 software to design online (http://frodo.wi.mit.edu/).Designing requirement product amplification length 100～250bp, Optimal Tm60～65 ℃, Primer GC%40～60%.Sequence is as table 1:

Table 1RT-PCR primer sequence

2mmol/L metformin can be time dependence to be reduced the expression of PEPCK, G6pase, Fbpase, FOXO1, C/EBP α, C/EBP β (Fig. 4, with the comparison of acetone acid/lactic acid+dexamethasone/cAMP matched group ^ap<0.05).2.5 μ mol/L berberine can be time dependence to be reduced the expression of PEPCK, G6pase, Fbpase, FOXO1, PGC1 α, HNF4 α (Fig. 5, with the comparison of acetone acid/lactic acid+dexamethasone/cAMP matched group ^ap<0.05).

When 4, metformin and berberine are the mRNA horizontal force 8h of dose dependent reduction glycogen heteroplasia related gene, with 0mmol/L for contrasting, 0.1,0.5,1,2mmol/L metformin is mRNA level (Fig. 6 that dose dependent reduces glycogen heteroplasia related gene, with the comparison of 0mmol/L metformin matched group ^ap<0.05); 0.1,0.5,1,2.5 μ mol/L berberine be the mRNA level that dose dependent reduces glycogen heteroplasia related gene (Fig. 7, with the comparison of 0mmol/L berberine matched group, ^ap<0.05).

5, metformin and berberine are on the active impact of glycogen heteroplasia rate-limiting enzyme pepck promoter

When hungry, low sugar stimulates glicentin secretion, it is combined with hepatocyte g protein coupled receptor, activated adenyl cyclase, cAMP level is raise, activate PKA and enter karyon, make cyclic adenosine monophosphate response element binding protein (cAMP response element-binding protein, CREB) 133 serine phosphorylations, become the state of transcription activating, the cAMP response element in phosphorylation CREB and pepck promoter subarea (cAMPresponsive element, CRE) combination, promotes this genetic transcription [6].In HepG2 cell, the sub-plasmid of transfection pepck promoter (pGL3basic-PEPCK ,-2000kb) or CRE cis acting element plasmid are tested.The PEPCK reporter gene promoter activity of matched group (only adding lactic acid/acetone acid processed group) is made as to 1, under the stimulation of dexamethasone (500nmol/L)/cAMP (500 μ mol/L), PEPCK reporter gene promoter activity is increased to (6.56 ± 0.32) doubly (P<0.05), after adding 2mmol/L metformin effect 24h, its activity is down to (4.30 ± 0.36) doubly, has reduced by 34% (P<0.05).

Berberine is dose dependent and reduces PEPCK reporter gene promoter activity, under the stimulation of dexamethasone (500nmol/L)/cAMP (500 μ mol/L), PEPCK reporter gene promoter activity is increased to (5.04 ± 0.48) doubly (P<0.05), after adding 5,10 μ mol/L berberine effect 24h, its activity is down to respectively (3.46 ± 0.98), (2.68 ± 0.74) doubly, reduced respectively 31.3%, 46.7% (P<0.05), if Fig. 8 is (with the comparison of dexamethasone/cAMP matched group ^ap<0.05; With dexamethasone/cAMP comparison, ^bp<0.05); Only for the CRE cis acting element in pepck promoter subarea, berberine is under the stimulation of dexamethasone (500nmol/L)/cAMP (500 μ mol/L), can make CRE uciferase activity be increased to (5.42 ± 0.65) doubly (P<0.05), after adding 10 μ mol/L berberine effect 24h, its activity is down to (2.90 ± 0.14) doubly, has reduced by 46% (P<0.05).

Embodiment 2PPP1R3C gene and glycogen heteroplasia

One, mice is hungry, feed is tested again

6 of the male C57 mices of SPF in 10～12 week age (Specific pathogen Free) level, body weight 18～20g, is divided into 3 groups at random, and every group of 2 mices, are put in respectively in three mouse cages, all remove bedding and padding, freely intake.First group is ad lib group; Second group is fasting 24h group, and hypoglycemia stimulates alpha Cell of islet secretion glicentin, and hepatic glycogen decomposition, glyconeogenesis are increased; The 3rd group is the 2h group of taking food again after fasting 24h, and blood glucose increases and brings out insulin secretion, insulin stimulating liver ingestion of glucose glycogen biosynthesis, and suppress hepatic glycogen and decompose and glycogen heteroplasia.Three groups of mices are raised in identical peace and quiet, isoperibol, and mice normal diet is provided by Shanghai Slac Experimental Animal Co., Ltd..When experiment starts, only first group of mice gives feedstuff; After experiment 24h, give the 3rd group of mice normal diet, and get the liver of first and second group mice, liquid nitrogen is preserved; After experiment 26h, get the 3rd group of mouse liver.The liver organization of three groups of mices homogenate simultaneously, every 50mg hepatic tissue adds 1ml Trizol, extracting RNA.

Research is found, compare with not fasting group, fasting 24h can make the expression of PPP1R3C increase, mRNA level obviously raises (P<0.05), simultaneously the gene expression dose relevant with glyconeogenesis such as PEPCK, G6pase, Fbpase, PGC1 α also raise (P<0.05); The 2h that takes food again after fasting group is compared with fasting group, the PPP1R3C increasing falls after rise, the mRNA level of PPP1R3C obviously falls (P<0.05) after rise, the expression of PEPCK, G6pase, Fbpase, PGC1 α simultaneously changes consistent (P<0.05) with PPP1R3C, if Fig. 9 is (with the comparison of not fasting group ^ap<0.05; With the comparison of fasting group, ^bp<0.05).

Two, cDNA chip detection

Mouse primary liver cell is processed after 8h with berberine, and extracting RNA reverse transcription is cDNA, carries out cDNA chip detection, and each processed group all has 3 parallel sampless.Can see, compared with the control, Dex/cAMP processes and can make the expression of PEPCK, G6pase, Fbpase raise, and berberine can make the down-regulated expression of PEPCK, G6pase, Fbpase, cDNA chip results is consistent with the RT-PCR result before us, illustrates that cDNA chip results is really credible.Protein phosphatase 1 regulatory subunit 3C (Proteinphosphatase1regulatory subunit3C, PPP1R3C), also referred to as also referred to as PTG (protein targetglycogen), it is originally just higher at the intracellular gene expression abundance of mouse liver, and adding with obviously raising after Dex/cAMP processing, after berberine effect, can obviously reduce the expression (Figure 10) of PPP1R3C.PPP1R3C is the adjusting subunit of protein phosphatase 1 (Protein phosphatase1, PP1), can make the catalytic subunit PP1C of PP1 be anchored into special cell subunit, combines, and extracellular signal is produced to reaction with specific substrate.PPP1R3C and glycaemic homeostasis have very large relation, and PP1 is very possible relevant with the dephosphorylation of CRTC2 as phosphatase.Therefore we to lock PPP1R3C be the possible action target spot of berberine.

Three, berberine is the mRNA level that Time and dosages dependency reduces PPP1R3C

Under dexamethasone/cAMP effect, the expression of PPP1R3C increases in time and increases, and apparently higher than only adding by glyconeogenesis substrate group; Add on its basis with 2.5 μ mol/L berberine can make the expression of PPP1R3C decline gradually (Figure 11, with the comparison of substrate group, ^ap<0.05; Organize relatively with dexamethasone/cAMP, ^bp<0.05).Effect is during 8h, 0.1 μ mol/L berberine can make the expression of PPP1R3C decline (Figure 12, with the comparison of substrate group, ^ap<0.05; Organize relatively with dexamethasone/cAMP, ^bp<0.05), the berberine of 0.5 μ mol/L has reached maximum effect; Meanwhile, insulin also can make the expression of PPP1R3C decline, and the effect of 100nM insulin is equivalent to the effect of 0.1 μ mol/L berberine.

Result demonstration, berberine is the mRNA level that Time and dosages dependency reduces PPP1R3C, as Figure 11 and 12.

Four, cross and express the impact of PPP1R3C on glyconeogenesis

Expression adenovirus excessively, siRNA (smallinterfering, siRNA) adenovirus for mice PPP1R3C mRNA sequence are synthetic by Shanghai JiKai Gene Chemical Technology Co., Ltd's design;

Cross expression adenovirus primer sequence as follows:

Ad-PPP1R3C-P1：

AGGTCGACTCTAGAGGATCCCGCCACCATGAGCTGCACCAGAATG

Ad-PPP1R3C-P2：TCCTTGTAGTCCATACCTCGATAGGAGGTCAAGTTC

PCR product size: 995

(3) the primary liver cell of recombinant adenovirus transfected

(4) fluorescence real-time quantitative PCR

The forward primer of PPP1R3C gene: 5 ' TGATCCATGTGCTAGATCCACG3 ', downstream primer: 5 ' ACTCTGCGATTTGGCTTCCTG '

Result shows, transfection PPP1R3C crosses and expresses the expression of liver primary cell PPP1R3C after adenovirus and significantly increase (more than 3000 times), as shown in figure 13 (with matched group comparison, ^ap<0.05); Transfection PPP1R3C crosses after expression adenovirus, compares with the culture fluid containing glyconeogenesis substrate, and liver primary cell glyconeogenesis significantly increases, as shown in figure 14 (with matched group comparison, ^ap<0.05).

Five,, little RNA disturbs the impact of PPP1R3C on glyconeogenesis

No matter in only having the training liquid of glyconeogenesis substrate, still add at the same time with in the training liquid of dexamethasone/cAMP, the little interference adenovirus of transfection PPP1R3C all can make the expression of PPP1R3C obviously decline (Figure 15, with the comparison of substrate matched group, ^ap<0.05P), but only in the training liquid of dexamethasone/cAMP, PEPCK, the G6pase gene expression of transfection viral interference group just obviously decline (Figure 16, with the comparison of substrate matched group, ^ap<0.05); Meanwhile, the little interference adenovirus of transfection PPP1R3C can make liver glyconeogenesis level decline (Figure 17, with the comparison of substrate matched group, ^ap<0.05).

In sum, berberine and metformin all can suppress liver glyconeogenesis process, but mechanism of action incomplete same.The effect that both suppress glyconeogenesis is not all by reducing the phosphorylation of CREB, but mediates by increasing the phosphorylation of CRTC2.

Metformin promotes the phosphorylation of CRTC2 by activating AMPK, p-CRTC2 blocks in endochylema, can not enter core and bring into play the effect that it promotes PEPCK genetic transcription, and this effect can be reversed by AMPK inhibitor Compound C.

The mechanism of action that berberine suppresses glyconeogenesis is by lowering the expression of PPP1R3C gene, the activity of Profilin phosphatase 1 (PP1), PP1 weakens the dephosphorylation of p-CRTC2, and p-CRTC2 blocks in endochylema, can not enter core and bring into play the effect that it promotes PEPCK genetic transcription.Berberine, for reducing the mRNA level of PPP1R3C protein phosphatase 1 regulatory subunit 3C, can reduce the expression of PPP1R3C.

Claims (5)

1. the application of berberine aspect inhibition PPP1R3C gene expression.

2. berberine application aspect horizontal at the mRNA that suppresses PPP1R3C.

3. berberine is for the preparation of the medicine that suppresses PPP1R3C gene expression.

4. berberine is for suppressing the medicine of the mRNA level of PPP1R3C.

5.PPP1R3C gene suppresses or promotes the medicine of glyconeogenesis for the preparation of screening.