CN104043109B - In preparation, neural axon guidance cues promotes that the application in goods is repaired in corneal injury - Google Patents
In preparation, neural axon guidance cues promotes that the application in goods is repaired in corneal injury Download PDFInfo
- Publication number
- CN104043109B CN104043109B CN201410086629.2A CN201410086629A CN104043109B CN 104043109 B CN104043109 B CN 104043109B CN 201410086629 A CN201410086629 A CN 201410086629A CN 104043109 B CN104043109 B CN 104043109B
- Authority
- CN
- China
- Prior art keywords
- netrin1
- corneal
- cell
- axon guidance
- guidance cues
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The object of this invention is to provide a kind of neural axon guidance cues and promote that the application in goods is repaired in corneal injury in preparation, namely neural axon guidance cues is utilized to prepare medicine or preparation that after suppressing corneal epithelial wound, inflammatory reaction and promotion corneal epithelium are repaired, the present invention finds that Netrin1 can not only promote that limbal stem cell is bred and transfer ability, the inflammatory reaction after normal mouse and diabetic mice corneal epithelial wound can also be suppressed, promote the injury repairing of the corneal epithelium of normal mouse and diabetic mice, can be used for the cultivation of eye table Cornea and conjunctiva epithelial stem cell, the treatment of diabetes keratopathy, the treatment of nerve keratitis.
Description
Technical field
The invention belongs to treatment of eye disorders medicine preparing technical field, be specifically related to a kind of neural axon guidance cues and promote that the application in goods is repaired in corneal injury in preparation, namely neural axon guidance cues affects the application in corneal restoration disease at treatment diabetes keratopathy, neurotrophic keratitis etc.
Background technology
The complete of transparent and function of cornea depends on the structure of each layer tissue of cornea and the normal of metabolism, and is positioned at outermost corneal epithelial tissue and this is played to considerable effect undoubtedly.Corneal epithelium is the physical barriers that the extraneous virulence factor of defence is invaded, and its integrity maintains and depends on epithelial iuntercellular, and the compact siro spinning technology between cell with basement membrane and grappling are connected and epithelial continuous self renewal.
Corneal epithelium is impaired affects intercellular connection, and cause membrane passage and selectivity to change, thus affect its barrier function, the infringement causing cornea to be subject to extraneous virulence factor causes inflammation and causes the corneal opacity, even causes blind.Re-epithelialization after corneal injury is a process the most basic of injury repairing, and epithelization can rebuild epithelial barrier rapidly, and this is extremely important for the structural integrity and normal function keeping cornea.Various physical damnification, chemical damage, mechanical damage, pathogenic microorganism, endocrine and immunity factor all can cause corneal epithelial wound.As diabetic keratopathy, there are some researches show: constitutional keratopathy may appear in the diabetics of 47%-64%, its Clinical symptoms main manifestations is the symptoms such as corneal sensitivity decline, associated with epithelial healing delay, neurotrophic corneal ulcer.Diabetics may occur that after carrying out cataract or operation on retina regeneration of corneal epithelium postpones, and even occurs peeling-off phenomenon repeatedly.
Agglutination after corneal epithelial wound is very complicated, have many factors to participate in regulating: 1. come from the continuous propagation of basal cell and limbal stem cell, the epithelial self renewal of differentiation to the rapid re-epithelialization after epithelial cell damage, rebuild epithelial barrier, thus keep the structural integrity of cornea and normal function extremely important; 2., in corneal epithelium agglutination, by different extracellular matrix molecules and the cell surface receptor of cellular expression, key effect is played to the cell adhesion mediated by cytoskeleton and motion aspect; 3. many somatomedin are as EGF, KGF, HGF, TGF, PDGF etc.) by autocrine or/and paracrine approach participates in regulating the propagation of corneal epithelial cell and migration, maintain the normal of cornea structure and function; 4. the cell adhesion molecule (as integrin) being positioned at cell surface plays a role with the form of receptor-ligand, plays an important role in corneal wound healing; 5. in addition, some other factor such as nerve factor etc. also participates in the barrier function and the wound healing that regulate corneal epithelial cell.
No matter the corneal epithelial defect which kind of reason causes, intactly can repairing rapidly, is the barrier function recovering corneal epithelial cell, the key promoting wound healing, keep good vision.Therefore fullying understand the regulate factors of corneal epithelial cell barrier function and wound healing, is very important to clinical treatment corneal epithelial cell barrier dysfunction and incompatible the saying of promotion wound healing.
Summary of the invention
The object of this invention is to provide a kind of neural axon guidance cues and promote that the application in goods is repaired in corneal injury in preparation, namely utilize neural axon guidance cues to prepare medicine or preparation that after suppressing corneal epithelial wound, inflammatory reaction and promotion corneal epithelium are repaired, thus make up the deficiencies in the prior art.
Inventor finds, adds the neural axon guidance cues Netrin1(such as 10-20ng/ml of doses in the culture medium KSFM of mouse cornea epithelial cell line TKE2) can effectively promote that limbal stem cell is bred.In the high sugared guidance model of TKE2 cell, in culture medium, add the Netrin1(such as 10-100ng/ml of doses) can effectively promote that limbal stem cell moves.Meanwhile, in the diabetic mice of normal C57 mice and STZ induction, set up after corneal epithelium strikes off damage model, the Netrin1(such as 50ng of subconjunctival injection doses), can effectively promote corneal epithelial wound reparation, inflammation-inhibiting reacts; Thus facilitate the present invention.
First the present invention provides a kind of new purposes of Netrin1, is namely repairing goods for the preparation of promotion corneal epithelial wound or is suppressing the application in Corneal inflammation reaction goods.
Described goods are eye drop, wherein include the neural axon guidance cues of pharmacology valid density;
Described goods can also be injection;
Wherein pharmacology valid density is 10-100ng/ml, preferred 50ng/ml;
Described neural axon guidance cues, its aminoacid sequence is SEQ ID NO:1;
In order to improve neural axon guidance cues inflammation and the effect in promoting corneal epithelial wound to repair after treatment corneal epithelial wound, the aminoacid sequence of inventor to the neural axon factor is transformed, and improved aminoacid sequence is SEQ ID NO:2;
The present invention finds that Netrin1 can not only promote that limbal stem cell is bred and transfer ability, the inflammatory reaction after normal mouse and diabetic mice corneal epithelial wound can also be suppressed, promote the injury repairing of the corneal epithelium of normal mouse and diabetic mice, can be used for the cultivation of eye table Cornea and conjunctiva epithelial stem cell, the treatment of diabetes keratopathy, the treatment of nerve keratitis.
Accompanying drawing explanation
Fig. 1: the Netrin1 adding variable concentrations in the culture medium of TKE2 on the impact of cell clone proliferation ability, and the Netrin1 adding 10ng/ml in culture fluid effectively can promote the propagation of TKE2 cell clone.
Fig. 2: under the high sugared environment of TKE2 damage model culture medium in add the impact of the Netrin1 on cell migration ability of variable concentrations, the Netrin1 adding 50ng/ml or 100ng/ml in culture fluid effectively can promote the transfer ability of TKE2 cell.
Fig. 3: the Netrin1 impact of repairing normal mouse cornea epithelial damage, subconjunctival injection 50ngNetrin1 effectively can promote the injury repairing of corneal epithelium.
Fig. 4: the Netrin1 impact of repairing the diabetic mice corneal epithelial wound of STZ induction, subconjunctival injection 50ng Netrin1 effectively can promote the injury repairing of diabetic mice corneal epithelium.
Fig. 5: Netrin1 damages the impact of inflammatory reaction to normal mouse and STZ induced diabetes mouse cornea, and subconjunctival injection 50ng Netrin1 effectively can reduce the infiltration of inflammatory cell in the corneal epithelium of mice damage.
Detailed description of the invention
Neural axon guidance cues (Netrin1) belongs to Netrin family member, is the solubility nervous process guidance cues found the earliest.Netrin1 carries out gene analysis to sudden change nematicide defect UNC-6 gene and is found, and called after axon guidance cue, now claim neural axon guidance cues.Netrin1 is a kind of emiocytosis type soluble protein of high conservative, and molecular weight is 70 ~ 80kD about, and its aminoacid sequence is SEQ ID NO:1.Current Netrin1 is just for regulating and controlling renal tubular epithelial inflammation and apoptosis in acute injury of kidney model; Application is obtained in the growth of cell migration, tumor cell survival ability, embryonic cell.
Below in conjunction with embodiment, the present invention is described in detail:
Embodiment 1: add the variable concentrations Netrin1 impact on TKE2 cell proliferation and transfer ability
1. apply KSFM(Keratinocyte-SFM and add BPE (50 μ g/mL) and rEGF (5ng/mL): GIBCO, 10724-011) culture fluid cellar culture TKE2 cell, by 4 × 10
4individual cell is seeded in 60mm culture dish, respectively to the Netrin1 (0,5,10 and 20ng/ml) adding variable concentrations in each ware, then cultivate under the condition of 5%CO2 and 37 DEG C, within every 3 days, more renew culture medium, add the Netrin1 factor of above-mentioned concentration simultaneously, cultivating utilized cell counter to carry out cell counting after 6 days, and cell quantity statistics is shown in Fig. 1.As shown in Figure 1, the TKE2 cell quantity not adding Netrin1 cultivation is 2.7 × 10
5, and add 10 and 20ng/ml Netrin1 culture fluid cultivate TKE2 cell number be respectively 4.4 × 10
5, 4.7 × 10
5, the TKE2 cell quantity cultivated compared with blank adds 1.5-2 doubly (* P<0.01).Thus, the propagation that the Netrin1 adding 10-20ng/ml effectively can promote TKE2 cell is demonstrated.
2. apply KSFM(Keratinocyte-SFM and add BPE (50 μ g/mL) and rEGF (5ng/mL): GIBCO, 10724-011) culture fluid cellar culture TKE2 cell, by 1 × 10
5individual cell is seeded in six orifice plates, selects a hole in contrast, and a hole adds the mannitol 25 μ l/ml of 1mol/L, and all the other 4 holes add the glucose 25 μ l/ml of 1mol/L respectively, then in 5%CO
2cultivate with under the condition of 37 DEG C, in six orifice plate expert cell scratch tests after 2 days, microscope 10x take a picture backward interpolation glucose hole in add Netrin1(0,10,50,100ng/ml), microphotograph after 24h, the situation that observation cut position TKE2 cell moves to central authorities is shown in Fig. 2.As shown in Figure 2, after matched group TKE2 cell cut 24h, cell migration area accounts for cut defect area 60%, and the cell migration area adding 1mol/L glucose group accounts for 20%, and visible high sugared environmental energy effectively suppresses the migration of TKE2 cell; And the TKE2 cell migration area adding 10ng/ml, 50ng/ml and 100ng/ml Netrin1 cultivation is respectively about 50%, 70% and 60% respectively, Netrin1 effectively can reverse the inhibitory action of high concentration glucose on cell migration as can be seen here, promotes TKE2 cell migration.
Embodiment 2: the impact of exogenous interpolation Netrin1 corneal epithelial injury repairing
1.Netrin1 on the impact that normal mouse cornea epithelial damage is repaired.
12 C57BL/6 mices (6-8 age in week) are divided into matched group and experimental group at random, use 3mm trepan and epithelium scraper strike off the epithelium in mice cornea of right eye central authorities 3mm region, control group mice conjunctiva of right eye hemostasis 7 μ l PBS simultaneously, experimental mice conjunctiva of right eye hemostasis 50ng Netrin1 (being dissolved in 7 μ l PBS), after modeling 0,24,48 and 72h use respectively fluorescein sodium dye and slit lamp under take a picture, the situation that the epithelial damage observing each group of mice is repaired, Fig. 3 is shown in by representative slit lamp observation photo.As shown in Figure 3, the epithelial defect rate of normal mouse 24h, 48h and 72h of subconjunctival injection PBS is respectively 0.83,0.65 and 0.32; The epithelial defect rate of normal mouse 24h, 48h and 72h of subconjunctival injection 50ng Netrin1 is respectively 0.83,0.54 and 0.16.As can be seen here, Netrin1 effectively can promote the injury repairing of mouse cornea epithelium.
The impact that 2.Netrin1 repairs the diabetic mice corneal epithelial wound that STZ induces
The C57BL/6 diabetic mice of 12 STZ inductions is divided into matched group and experimental group at random, use 3mm trepan and epithelium scraper strike off the epithelium in mice cornea of right eye central authorities 3mm region, control group mice conjunctiva of right eye hemostasis 7 μ l PBS simultaneously, experimental mice conjunctiva of right eye hemostasis 50ngNetrin1 (being dissolved in 7 μ l PBS), after modeling 0,24,48 and 72h use respectively fluorescein sodium dye and slit lamp under take a picture, the situation that the epithelial damage observing each group of mice is repaired, Fig. 4 is shown in by representative slit lamp observation photo.As shown in Figure 4, the epithelial defect rate of diabetic mice 24h, 48h and 72h of subconjunctival injection PBS is respectively 0.83,0.70 and 0.46; The epithelial defect rate of diabetic mice 24h, 48h and 72h of subconjunctival injection 50ng Netrin1 is respectively 0.74,0.33 and 0.07.As can be seen here, Netrin1 effectively can promote the injury repairing of diabetic mice corneal epithelium.
3.Netrin1 is on the impact of inflammatory reaction after the diabetic mice corneal epithelial wound of normal and STZ induction
Get the eyeball of mouse of C57BL/6 diabetic mice 48h and 72h after above-mentioned process that normal and STZ induces, be placed in OCT and make freezing sample.Make 8 μm of thickness frozen sections with freezing microtome, detected the impact of Netrin1 centering granulocyte labelling (Ly6G) by immunofluorescence method.As shown in Figure 5, the infiltration of the C57BL/6 diabetic mice corneal epithelial wound position neutrophilic granulocyte that Netrin1 can obviously reduce normally and STZ induces, suppresses the inflammatory reaction after corneal epithelial wound.
The character transformation of embodiment 3:Netrin1
In order to improve neural axon guidance cues inflammation and the effect in promoting corneal epithelial wound to repair after treatment corneal epithelial wound, the aminoacid sequence of neural axon guidance cues Netrin1 is transformed, namely Netrin1 0th ~ 21 amino acids is sheared, retain from 22 ~ 604 amino acids.Obtain the variant Human Netrin1 (Val22Ala604) of Netrin1, its aminoacid sequence is SEQ IDNO:2.
Concrete adaptation step is as follows:
With people Netrin1cDNA for template, by 22-604 position (Netrin1-truncate) totally 583 amino acid whose coded sequences in pcr amplification Netrin1 full-length proteins sequence, Netrin1-truncate primer sequence is AGACACGAATTCGTGCGCGGCGGGCCCGGGCTCA, AGACTCGAGGGCCTTCTTGCACTTGCC, is respectively manually-injected EcoR I and Xho I restriction enzyme site at the two ends of primer sequence.With EcoRI and XhoI double digestion empty carrier pGEX-4T-1 and pcr amplification product respectively, Netrin1-truncate is connected with pGEX-4T-1 carrier with correct frame, obtains GST and Netrin1-truncate fusion protein expression plasmid pGEX-Netrin1-truncate.The method that the recombinant expression carrier obtained applies enzyme action and order-checking is respectively identified; the size of result display endonuclease bamhi is correct; and sequencing result display conforms to completely with reference sequences, and according to sequencing result and reading frame position, the aminoacid sequence after translation is SEQ ID NO:2;
The gst fusion protein expression plasmid of structure is transformed in escherichia coli BL-21, picking monoclonal inoculation in 3ml LB culture fluid, 37 DEG C, 250rpm shaken overnight; Again by 3 ‰ inoculum concentrations switchings, 37 DEG C are cultured to after bacterium liquid A value reaches 0.6 ~ 0.8, and adding IPTG to final concentration is 500 mol/L, continuation shaken cultivation 2h; Then 4 DEG C, 3000rpm centrifugal 30min collection thalline, the ratio in 40: 1 adds the resuspended thalline of bacterial lysate, ultrasonication antibacterial, collected by centrifugation supernatant; Application GlutathioneSepharose4B purification column (purchased from Amersham Biosciences company) purification GST-Netrin1-truncate fusion rotein; After GST-Netrin1-truncate fusion rotein Thrombin thrombin is cut away, after a purification column, collect and penetrate liquid, then by dialysis and lyophilizing, obtain Netrin1-truncated protein, then use PBS buffer to be again dissolved as the liquid storage of 100ng/ul, frozen for subsequent use in-80 DEG C.And verify improved Netrin1(Netrin1-truncated protein) in treatment limbal stem cell propagation and the effect in promoting corneal epithelial wound to repair.
One, Netrin1-truncated protein is on the impact of TKE2 cell
1. apply TKE2 cell culture fluid (Keratinocyte-SFM adds BPE (50 μ g/mL) and rEGF (5ng/mL): GIBCO,
10724-011) cellar culture TKE2 cell, by 4 × 10
4individual cell is seeded in 60mm culture dish, respectively to adding Netrin1 (10ng/ml) and Netrin1-truncate (10ng/ml) in two wares, then in 5%CO
2cultivate with under the condition of 37 DEG C, within every 3 days, more renew culture medium, add Netrin1 and the Netrin1-truncate factor of above-mentioned concentration simultaneously, cultivating utilized cell counter to carry out cell counting after 6 days, the display of cell quantity statistics, the TKE2 cell number that interpolation 10 and 20ng/ml Netrin1 culture fluid are cultivated is respectively 4.5 × 10
5, 4.7 × 10
5, and add 10 and 20ng/mlNetrin1-truncate culture fluid cultivate TKE2 cell number be respectively 5.6 × 10
5, 6.8 × 10
5, the TKE2 cell quantity cultivated compared with blank adds 1-1.5 doubly (* P<0.05).As can be seen here, compared with the interpolation Netrin1 factor, the propagation that the Netrin1-truncate factor more effectively can promote TKE2 cell is added.
2. apply KSFM(Keratinocyte-SFM and add BPE (50 μ g/mL) and rEGF (5ng/mL): GIBCO, 10724-011) culture fluid cellar culture TKE2 cell, by 1 × 10
5individual cell is seeded in six orifice plates, and each hole adds the glucose 25 μ l/ml of 1mol/L, then in 5%CO
2cultivate with under the condition of 37 DEG C, row cell scratch test after 2 days, microscope 10x takes a picture in backward hole and adds Netrin1(10 respectively, 50,100ng/ml) with the Netrin1-truncate factor (10,50,100ng/ml), microphotograph after 24h, observes the situation that cut position TKE2 cell moves to central authorities.After adding the TKE2 cell cut 24h of Netrin1, cell migration area accounts for cut defect area 50%, 70% and 60% respectively, and after adding the TKE2 cell cut 24h of the Netrin1-truncate factor, cell migration area accounts for cut defect area 60%, 85% and 60% respectively.The Netrin1-truncate factor promotes that the effect of TKE2 cell migration is more obvious as can be seen here.
Two: the impact of exogenous interpolation NETRIN1 corneal epithelial injury repairing
1.Netrin1 on the impact that normal mouse cornea epithelial damage is repaired
12 C57BL/6 mices (6-8 age in week) are divided into matched group and experimental group at random, use 3mm trepan and epithelium scraper strike off the epithelium in mice cornea of right eye central authorities 3mm region, control group mice conjunctiva of right eye hemostasis 50ng Netrin1 (being dissolved in 7ul PBS) simultaneously, experimental mice conjunctiva of right eye hemostasis 50ng Netrin1-truncate (being dissolved in 7ul PBS), after modeling 0, 24, 48 and 72h use respectively fluorescein sodium dye and slit lamp under take a picture, the situation that the epithelial damage observing each group of mice is repaired, the normal mouse 24h of subconjunctival injection 50ng Netrin1, the epithelial defect rate of 48h and 72h is respectively 0.83, 0.53 and 0.17, the epithelial defect rate of normal mouse 24h, 48h and 72h of the subconjunctival injection 50ng Netrin1-truncate factor is respectively 0.76,0.33 and 0.08.Result shows the injury repairing of the more effective promotion corneal epithelium of subconjunctival injection 50ngNetrin1-truncate factor energy.
The impact that 2.Netrin1 repairs the diabetic mice corneal epithelial wound that STZ induces
The C57BL/6 diabetic mice of 12 STZ inductions is divided into matched group and experimental group at random, use 3mm trepan and epithelium scraper strike off the epithelium in mice cornea of right eye central authorities 3mm region, control group mice conjunctiva of right eye hemostasis 50ng Netrin1 (being dissolved in 7ul PBS) simultaneously, experimental mice conjunctiva of right eye hemostasis 50ng Netrin1-truncate (being dissolved in 7ul PBS), after modeling 0, 24, 48 and 72h use respectively fluorescein sodium dye and slit lamp under take a picture, the situation that the epithelial damage observing each group of mice is repaired, the diabetic mice 24h of subconjunctival injection 50ng Netrin1, the epithelial defect rate of 48h and 72h is respectively 0.75, 0.32 and 0.07, the epithelial defect rate of diabetic mice 24h, 48h and 72h of the subconjunctival injection 50ng Netrin1-truncate factor is respectively 0.68,0.26 and 0.04.Result shows the injury repairing of the more effective promotion diabetic mice corneal epithelium of subconjunctival injection 50ng Netrin1-truncate factor energy.
Claims (5)
1. a purposes for neural axon guidance cues, is characterized in that, is repairing goods for the preparation of promotion corneal epithelial wound or suppressing the application in Corneal inflammation reaction goods; The aminoacid sequence of described neural axon guidance cues is SEQ ID NO:2.
2. purposes as claimed in claim 1, is characterized in that described goods are eye drop or the injection of the neural axon guidance cues including pharmacology valid density.
3. purposes as claimed in claim 2, is characterized in that described pharmacology valid density is 10-100ng/ml.
4. purposes as claimed in claim 3, is characterized in that described pharmacology valid density is 50ng/ml.
5. the goods for promoting corneal epithelial wound to repair, is characterized in that, described goods are the medicine of the neural axon guidance cues including pharmacology valid density; Wherein the aminoacid sequence of neural axon guidance cues is SEQ ID NO:2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410086629.2A CN104043109B (en) | 2014-03-05 | 2014-03-05 | In preparation, neural axon guidance cues promotes that the application in goods is repaired in corneal injury |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410086629.2A CN104043109B (en) | 2014-03-05 | 2014-03-05 | In preparation, neural axon guidance cues promotes that the application in goods is repaired in corneal injury |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104043109A CN104043109A (en) | 2014-09-17 |
| CN104043109B true CN104043109B (en) | 2015-09-30 |
Family
ID=51496830
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410086629.2A Active CN104043109B (en) | 2014-03-05 | 2014-03-05 | In preparation, neural axon guidance cues promotes that the application in goods is repaired in corneal injury |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104043109B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111544658B (en) * | 2020-06-24 | 2022-02-01 | 中国人民解放军陆军军医大学 | Cardiovascular implant for regulating and controlling immune response and promoting intimal regeneration and preparation method thereof |
| CN113827548B (en) * | 2021-06-16 | 2023-08-22 | 温州医科大学 | Magnetic graphene nanocomposite gel for targeted inhibition of keratopathy, preparation method and application thereof, and treatment method |
-
2014
- 2014-03-05 CN CN201410086629.2A patent/CN104043109B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104043109A (en) | 2014-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Frossi et al. | Is it time for a new classification of mast cells? What do we know about mast cell heterogeneity? | |
| Nichols et al. | Surface features of the conjunctiva and cornea. | |
| Trosan et al. | The key role of insulin-like growth factor I in limbal stem cell differentiation and the corneal wound-healing process | |
| De Winter et al. | Connective tissue growth factor: structure–function relationships of a mosaic, multifunctional protein | |
| Ji et al. | Neutralization of ocular surface TNF-α reduces ocular surface and lacrimal gland inflammation induced by in vivo dry eye | |
| Chaudhary et al. | Inflammatory and fibrogenic factors in proliferative vitreoretinopathy development | |
| Blalock et al. | Connective tissue growth factor expression and action in human corneal fibroblast cultures and rat corneas after photorefractive keratectomy | |
| AU2012308476B2 (en) | Wnt compositions and therapeutic uses of such compositions | |
| CN103476791A (en) | Novel WNT compositions and therapeutic uses of such compositions | |
| CN104043109B (en) | In preparation, neural axon guidance cues promotes that the application in goods is repaired in corneal injury | |
| Shang et al. | Adipose-derived mesenchymal stromal cells promote corneal wound healing by accelerating the clearance of neutrophils in cornea | |
| CN106279429A (en) | The stroma cell derivative factor being combined with collagen specificity and application thereof | |
| WO2006119035A2 (en) | Vegf variants | |
| CN103998053A (en) | Methods for preventing or treating certain disorders by inhibiting binding of il-4 and/or il-13 to their respective receptors | |
| CN108463240A (en) | A method of preventing or treat diabetic retinopathy | |
| Shirai et al. | The murine lens: A model to investigate in vivo epithelial–mesenchymal transition | |
| EP2270141B9 (en) | Partial peptide of lacritin | |
| WO2017075719A1 (en) | Compositions and methods comprising growth factors, chondroitin and glucosamine for degenerative disc regeneration | |
| Bai et al. | Coculture with partial digestion notochordal cell-rich nucleus pulposus tissue activates degenerative human nucleus pulposus cells | |
| Qin et al. | LECT2 Ameliorates Blood–Retinal Barrier Impairment Secondary to Diabetes Via Activation of the Tie2/Akt/mTOR Signaling Pathway | |
| Zhang et al. | Y-27632 promotes the repair effect of umbilical cord blood-derived endothelial progenitor cells on corneal endothelial wound healing | |
| CN103800894B (en) | Application of CNTF to corneal limbal stem cell proliferation and corneal epithelium damage repair | |
| CN116836264B (en) | Recombinant humanized fibronectin rhFEB and application thereof | |
| CN108939055A (en) | Purposes of the recombined human PH20 in preparation treatment thyroid-associated ophthalmopathy drug | |
| Yao et al. | Contraction-dependent TGF-β1 activation is required for thrombin-induced remodeling in human airway smooth muscle cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |