CN104039817A

CN104039817A - Polypeptides having xylanase activity and polynucleotides encoding same

Info

Publication number: CN104039817A
Application number: CN201280065538.XA
Authority: CN
Inventors: 汤岚; 刘晔; 张羽; 段俊欣
Original assignee: Novozymes Biotech Inc
Current assignee: Novozymes Inc
Priority date: 2011-10-28
Filing date: 2012-10-26
Publication date: 2014-09-10

Abstract

The present invention provides isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Description

There are the polypeptide of xylanase activity and the polynucleotide of this polypeptide of coding

Statement for the right of the invention completing under the research and development of federal funding

The present invention has supported in the cooperation agreement of being authorized by USDOE (Cooperative Agreement) DE-FC36-08GO18080 Xia Yi government.Government has certain right in the present invention.

Relate to sequence table

The sequence table that the application comprises computer-reader form, it is incorporated to herein by carrying stating.

Background of invention

Background technology

Ligno-cellulose, maximum renewable biomass resource, mainly consists of xylogen, Mierocrystalline cellulose and hemicellulose in the world, and wherein the major part of hemicellulose is xylan.Zytase (for example, in-and Isosorbide-5-Nitrae-xylobiase, EC3.2.1.8) the inside β-Isosorbide-5-Nitrae-wood sugar glycosidic bond in hydrolyzed xylan enzyme is to produce wood sugar and the wood oligose (xylo-oligomer) of lower molecular weight.Xylan is the polysaccharide from D-wood sugar pyranose (Isosorbide-5-Nitrae-β-glycoside-linked D-xylopyranose) formation of Isosorbide-5-Nitrae-β-glucoside connection.

Mierocrystalline cellulose is that glucose passes through the polymkeric substance that β-Isosorbide-5-Nitrae-key connects.The enzyme of the dextran of many microorganisms hydrolysis β-connections.These enzymes comprise endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.Endoglucanase, at random site digest cellulose polymkeric substance, makes it be exposed to cellobiohydrolase and attacks (attack).Cellobiohydrolase sequentially discharges the molecule of cellobiose from the end of cellulose polymer compound.Cellobiose is the glucose dimer of water miscible β-Isosorbide-5-Nitrae-connection.Beta-glucosidase enzyme is hydrolyzed into glucose by cellobiose.Once cellulose conversion is glucose, described glucose can be easily ethanol by yeast fermentation.

Lignocellulose-containing raw material (lignocellulosic feedstock) is converted into ethanol and there is following advantage: large content of starting materials is ready-made available, avoids burning or the desirability of embedding material and the spatter property of alcohol fuel.Timber, agricultural residue, draft crop and municipal solid waste are considered to the raw material for alcohol production.These material three major polymers: celluloses, hemicellulose and xylogen form.Once cellulose conversion is glucose, described glucose can be easily ethanol by yeast fermentation.

In this area, exist by supplementing other enzyme and improve cellulose decomposition enzyme composition to increase efficiency and the demand that is provided for the cellulosic enzyme solution to one's profit of xylogen degradation.

WO2011/041405 discloses from having a liking for loose mould (Penicillium pinophilum) GH10 zytase and gene thereof.

The invention provides and there are the polypeptide of xylanase activity and the polynucleotide of coding said polypeptide.

Technical field

The present invention relates to have the polypeptide of xylanase activity, and the polynucleotide of coding said polypeptide.The present invention also relates to nucleic acid construct, carrier and the host cell that comprises described polynucleotide, and the method that produces and use described polypeptide.

Summary of the invention

The present invention relates to have the isolated polypeptide of xylanase activity, it is selected from lower group:

(a) polypeptide, the mature polypeptide of itself and SEQ ID NO:2 has at least 60% sequence identity; There is at least 65% sequence identity with the mature polypeptide of SEQ ID NO:12; There is at least 70% sequence identity with the mature polypeptide of SEQ ID NO:4 or SEQ ID NO:10; There is at least 75% sequence identity with the mature polypeptide of SEQ ID NO:14 or SEQ ID NO:16; There is at least 80% sequence identity with the mature polypeptide of SEQ ID NO:6 or SEQ ID NO:8; There is at least 85% sequence identity with the mature polypeptide of SEQ ID NO:20; Or there is at least 90% sequence identity with the mature polypeptide of SEQ ID NO:18;

(b) polypeptide, it is by polynucleotide encoding, described polynucleotide are hybridized with following under at least medium-Gao stringent condition: (i) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9, or the mature polypeptide encoded sequence of SEQ ID NO:11, (ii) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9, or the cDNA sequence of SEQ ID NO:11, or (iii) (i) or total length complementary strand (ii); Or hybridize with following under at least high stringent condition: (i) SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or the mature polypeptide encoded sequence of SEQ ID NO:19, (ii) SEQ ID NO:5, SEQ ID NO:13, SEQ ID NO:17, or the cDNA sequence of SEQ ID NO:19, or (iii) (i) or total length complementary strand (ii).

(c) polypeptide, it is by polynucleotide encoding, and mature polypeptide encoded sequence or its cDNA sequence of described polynucleotide and SEQ ID NO:1 have at least 60% sequence identity; There is at least 65% sequence identity with mature polypeptide encoded sequence or its cDNA sequence of SEQ ID NO:11; There is at least 70% sequence identity with the mature polypeptide encoded sequence of SEQ ID NO:3 or its cDNA sequence or SEQ ID NO:9 or its cDNA sequence; There is at least 75% sequence identity with the mature polypeptide encoded sequence of SEQ ID NO:13 or the mature polypeptide encoded sequence of its cDNA sequence or SEQ ID NO:15; There is at least 80% sequence identity with the mature polypeptide encoded sequence of SEQ ID NO:5 or the mature polypeptide encoded sequence of its cDNA sequence or SEQ ID NO:7; There is at least 85% sequence identity with mature polypeptide encoded sequence or its cDNA sequence of SEQ ID NO:19; Or there is at least 90% sequence identity with mature polypeptide encoded sequence or its cDNA sequence of SEQ ID NO:17;

(d) SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the mature polypeptide of SEQ ID NO:20 for example, comprises the variant of replacement, disappearance and/or insertion in one or more (several) position; With

(e) (a), (b), (c) or polypeptide (d) have the fragment of xylanase activity.

The present invention also relates to the separated polynucleotide of the polypeptide of the present invention of encoding, the nucleic acid construct that comprises described polynucleotide, recombinant expression vector and recombinant host cell; With the method that produces described polypeptide.

The present invention also relates to degradation of fibers cellulosic material or containing the technique of xylan material, it comprises: under the existence of the polypeptide with xylanase activity of the present invention, with enzyme composition, process cellulose materials or containing xylan material.In one aspect, described technique also comprises the cellulose materials reclaiming through degrading or transforming or contains xylan material.

The present invention also relates to the technique that produces tunning, and it comprises: (a) under the existence of the polypeptide with xylanase activity of the present invention by enzyme composition diastatic fiber cellulosic material or containing xylan material; (b) with the fermentation of one or more (for example several) organism of fermentation through the cellulose materials of saccharification or containing xylan material to produce tunning; (c) from fermentation, reclaim this tunning.

The present invention also relates to fermented cellulose material or contains the technique of xylan material, it for example comprises, with ferment described cellulose materials or containing xylan material of one or more (several) organism of fermentation, wherein said cellulose materials or have in the present invention containing xylan material under the existence of polypeptide of xylanase activity and use enzyme composition saccharification.In one aspect, described cellulose materials or produce tunning containing the fermentation of xylan material.In yet another aspect, above-mentioned technique further comprises from fermentation recovery tunning.

The present invention also relates to the polynucleotide of coded signal peptide, described signal peptide comprises or consists of the amino acid/11 to 20 of (consist of) SEQ ID NO:2, the amino acid/11 to 17 of SEQ ID NO:4, the amino acid/11 to 18 of SEQ ID NO:6, the amino acid/11 to 22 of SEQ ID NO:8, the amino acid/11 to 18 of SEQ ID NO:10, the amino acid/11 to 20 of SEQ ID NO:12, the amino acid/11 to 17 of SEQ ID NO:14, the amino acid/11 to 19 of SEQ ID NO:16, the amino acid/11 to 17 of SEQ ID NO:18, or the amino acid/11 to 17 of SEQ ID NO:20, it is operably connected to the gene of proteins encoded, the nucleic acid construct that comprises described polynucleotide, expression vector and recombinant host cell, with the protedogenous method of product.

Accompanying drawing explanation

Fig. 1 shows the restricted figure of plasmid pGH10_ZY577198_20.

Fig. 2 shows the restricted figure of plasmid pGH10_ZY577319_22.

Fig. 3 shows the restricted figure of plasmid pGH10_ZY577226_23.

Fig. 4 shows the restricted figure of plasmid pGH10_ZY577198_133.

Fig. 5 shows the restricted figure of plasmid pxyn13.

Fig. 6 shows the restricted figure of plasmid pGH10_ZY582331_279.

Fig. 7 shows the restricted figure of plasmid pGH10_Mf4036.

Fig. 8 shows the restricted figure of plasmid pGH10_Mf2809.

Fig. 9 shows the restricted figure of plasmid pGH10_Mf0530.

Figure 10 shows the restricted figure of plasmid pGH10_ZY569164_676.

Definition

Acetyl xylan esterase: term " acetyl xylan esterase " means Carboxylesterase (EC3.1.1.72), its catalysis ethanoyl is from the hydrolysis of polymerization xylan, acetylize wood sugar, acetyl glucose, acetic acid α-naphthylacetate (alpha-napthyl acetate) and acetic acid p-nitrophenyl acetate (p-nitrophenyl acetate).For the present invention, acetyl xylan esterase activity is to use to contain 0.01%TWEEN ^tM0.5mM acetic acid p-nitrophenyl acetate in the 50mM sodium acetate pH5.0 of 20 (polyoxyethylenesorbitan monolaurates) is determined as substrate.The acetyl xylan esterase of Yi Ge unit is defined as can be at pH5, and 25 ℃ of per minutes discharge the enzyme amount of 1 micromole's p-NP negatively charged ion (p-nitrophenolate anion).

Allelic variant (allelic variant): term " allelic variant " means to occupy any two or more optional forms of the gene of phase syntenic genes seat.Allelic variation occurs natively by sudden change, and can cause the polymorphism in population.Transgenation can be the polypeptide of reticent (unchanged in the polypeptide of the coding) aminoacid sequence with change of maybe can encoding.The allelic variant of polypeptide is the polypeptide by the allelic variant coding of gene.

α-l-arabfuranglycosidase: term " α-l-arabfuranglycosidase " means the Arabic furans lytic enzyme (EC3.2.1.55) of α-L-arbinofuranose glycosides, the hydrolysis of its catalysis to the end irreducibility α-L-arbinofuranose glycosides residue in α-L-arabinose glycosides.This enzyme to α-L-arbinofuranose glycosides, contain (1,3)-and/or α-L-arabinan, araboxylan and the arabogalactan of (1,5)-key work.α-l-arabfuranglycosidase is also referred to as arabinofuranosidase/xylosidase, α-arabinofuranosidase/xylosidase, α-L-arabinose glycosides enzyme, α-arabinofuranosidase, polysaccharide α-l-arabfuranglycosidase, α-L-arbinofuranose glycosides lytic enzyme, L-arabinose glycosides enzyme or α-L-arabanase.For the present invention, α-l-arabfuranglycosidase activity is to use medium-viscosity wheat araboxylan (the Megazyme International Ireland of 5mg in the 100mM sodium acetate pH5 of the every ml in cumulative volume 200 μ l, Ltd., Bray, Co.Wicklow, Ireland) at 40 ℃, carry out 30 minutes, then pass through the pectinose analysis of HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA) is determined.

Alpha-glucuronidase: term " alpha-glucuronidase " means α-D-glucuronide glucuronic acid lytic enzyme (alpha-D-glucosiduronate glucuronohydrolase) (EC3.2.1.139), its catalysis α-D-glucuronic acid glycoside hydrolysis is D-glucuronic acid and alcohol.For the present invention, alpha-glucuronidase activity is according to de Vries, and 1998, J.Bacteriol.180:243-249 determines.The alpha-glucuronidase of Yi Ge unit equals can be at pH5, and 40 ℃ of per minutes discharge the enzyme amount of 1 micromole's glucuronic acid or 4-O-methylglucuronic acid.

Beta-glucosidase enzyme: term " beta-glucosidase enzyme " means β-D-glucoside glucose lytic enzyme (beta-D-glucoside glucohydrolase) (E.C.No.3.2.1.21), the hydrolysis of the non-reduced β-D-Glucose of its catalysis end residue, and discharge β-D-Glucose.For the present invention, beta-glucosidase enzyme is according to Venturi etc., 2002, Extracellular beta-D-glucosidase from Chaetomium thermophilum var.coprophilum:production, purification and some biochemical properties, the method for J.Basic Microbiol.42:55-66 is used p-nitrophenyl-β-D-glucose pyranoside to determine as substrate.The beta-glucosidase enzyme of Yi Ge unit is defined as at 25 ℃, and pH4.8 is containing 0.01% in 20 50mM Trisodium Citrate, from the 1mM p-nitrophenyl-β-D-glucose pyranoside per minute as substrate, produce 1.0 micromole's p-NP negatively charged ion.

Xylobiase: term " xylobiase " means β-D-xyloside wood sugar lytic enzyme (β-D-xyloside xylohydrolase) (E.C.3.2.1.37), and the outer hydrolysis of the short β of its catalysis (1 → 4) wood oligose (xylooligosaccharide) is to remove continuous D-xylose residues from non-reducing end.For the present invention, the xylobiase of Yi Ge unit is defined as at 40 ℃, and pH5 is containing 0.01% in 20 100mM Trisodium Citrate, from the 1mM p-nitrophenyl-β-D-xyloside per minute as substrate, produce 1.0 micromole's p-NP negatively charged ion.

CDNA: term " cDNA " means the DNA molecular that can prepare from deriving from the mRNA molecule ripe, montage of eucaryon or prokaryotic cell prokaryocyte by reverse transcription.CDNA lacks the intron sequences being conventionally present in corresponding gene group DNA.The precursor that initial (initial) elementary rna transcription thing is mRNA, it comprises montage by a series of step processing, then the mRNA as ripe montage occurs.

Cellobiohydrolase: term " cellobiohydrolase " means 1, 4-callose cellobiohydrolase (1, 4-beta-D-glucan cellobiohydrolase) (E.C.3.2.1.91 and E.C.3.2.1.176), its catalyse cellulose, cell-oligosaccharide, or any β-1 that comprises, in the polymkeric substance of the glucose that 4-connects 1, the hydrolysis of 4-β-D-glycosidic link, from reducing end (cellobiohydrolase I) or the non-reducing end (cellobiohydrolase II) of chain, discharge cellobiose (Teeri, 1997, Crystalline cellulose degradation:New insight into the function of cellobiohydrolases, Trends in Biotechnology15:160-167, Teeri etc., 1998, Trichoderma reesei cellobiohydrolases:why so efficient on crystalline cellulose?, Biochem.Soc.Trans.26:173-178).According to Lever etc., 1972, Anal.Biochem.47:273-279; Van Tilbeurgh etc., 1982, FEBS Letters149:152-156; Van Tilbeurgh and Claeyssens, 1985, FEBS Letters187:283-288; And Tomme etc., the method that 1988, Eur.J.Biochem.170:575-581 describes is determined cellobiohydrolase activity.In the present invention, the method for Tomme etc. can be used for determining cellobiohydrolase activity.

Cellulolytic enzyme or cellulase: term " cellulolytic enzyme " or " cellulase " mean the enzyme of one or more (for example several) hydrolysis fiber cellulosic material.This fermentoid comprises endoglucanase, cellobiohydrolase, beta-glucosidase enzyme, or its combination.Two kinds of basic skills measuring cellulolytic activity comprise: (1) measures total fiber element degrading activity, (2) measure independent cellulolytic activity (endoglucanase, cellobiohydrolase and beta-glucosidase enzyme), as Zhang etc., Outlook for cellulase improvement:Screening and selection strategies, 2006, Biotechnology Advances24:452-481 summarizes.Total fiber element degrading activity typically uses that insoluble substrate measures, and described substrate comprises Whatman1 filter paper, Microcrystalline Cellulose, bacteria cellulose, algae Mierocrystalline cellulose, cotton, pretreated ligno-cellulose etc.Modal total fiber element degrading activity assay method is to use Whatman1 filter paper as the filter paper assay method of substrate.This assay method is to be established by International Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Measurement of cellulase activities, Pure Appl.Chem.59:257-68).

For the present invention, cellulose decomposition enzymic activity is determined than the increase of not adding the contrast hydrolysis of cellulose decomposition zymoprotein by measuring the cellulosic material hydrolysis being undertaken by cellulolytic enzyme under the following conditions: Mierocrystalline cellulose in the PCS of cellulose decomposition zymoprotein/g of 1-50mg (or other pretreated cellulose materials) is in suitable temperature, and for example 50 ℃, 55 ℃ or 60 ℃ are carried out 3-7 day.Usual conditions are: 1ml reaction solution, and through washing or unwashed PCS, 5% insoluble solid, 50mM sodium acetate pH5,1mM MnSO ₄, 50 ℃, 55 ℃ or 60 ℃, 72 hours, by hPX-87H post (Bio-Rad Laboratories, Inc., Hercules, CA, USA) carries out glycan analysis.

Cellulose materials: term " cellulose materials " means to comprise cellulosic any material.Secondly main polysaccharide in the primary cell wall of biomass (primary cell wall) is Mierocrystalline cellulose, and the abundantest is hemicellulose, and the 3rd be pectin.Secondary cell wall (secondary cell wall) produces after cell stops growing, and it contains equally polysaccharide and strengthens by being covalently cross-linking to the polymerization xylogen of hemicellulose.Mierocrystalline cellulose is the homopolymer of anhydro cellobiose, therefore be straight chain β-(1-4)-D-dextran, and hemicellulose comprises multiple compounds, for example xylan, xyloglucan (xyloglucan), araboxylan and mannosans, form and have diversified substituent complex branches structure.Although Mierocrystalline cellulose is multiform normally, the Mierocrystalline cellulose being present in plant tissue is mainly the insoluble crystal substrate of parallel dextran chain.Hemicellulose is connected with hydrogen bond with Mierocrystalline cellulose and other hemicellulose conventionally, and it helps stabilized cell wall matrix.

Mierocrystalline cellulose sees for example stem, leaf, shell, skin and the cob of plant conventionally, or leaf, branch and the timber of tree.Cellulose materials can be, but be not limited to, agricultural residue, draft material (comprising energy crop), municipal solid waste, paper pulp and paper mill resistates, waste paper and timber (comprising forestry resistates) (referring to, for example, Wiselogel etc., 1995, in Handbook on Bioethanol (Charles E.Wyman volume), pp.105-118, Taylor & Francis, Washington D.C.; Wyman, 1994, Bioresource Technology50:3-16; Lynd, 1990, Applied Biochemistry and Biotechnology24/25:695-719; Mosier etc., 1999, Recent Progress in Bioconversion of Lignocellulosics, in Advances in Biochemical Engineering/Biotechnology, T.Scheper chief editor, Volume65, pp.23-40, Springer-Verlag, New York).It should be understood that in this article Mierocrystalline cellulose can be the form of ligno-cellulose, ligno-cellulose is a kind of Plant cell wall material, the mixed-matrix that comprises xylogen, Mierocrystalline cellulose and hemicellulose.One preferred aspect, cellulose materials is any biological material.Another preferred aspect, described cellulose materials is ligno-cellulose, it comprises Mierocrystalline cellulose, hemicellulose and xylogen.

In one aspect, cellulose materials is agricultural residue.In yet another aspect, cellulose materials is draft material (comprising energy crop).In yet another aspect, cellulose materials is municipal solid waste.In yet another aspect, cellulose materials is paper pulp and paper mill resistates.In yet another aspect, cellulose materials is waste paper.In yet another aspect, cellulose materials is timber (comprising forestry resistates).

In yet another aspect, cellulose materials is giantreed (arundo).In yet another aspect, cellulose materials is bagasse.In yet another aspect, cellulose materials is bamboo.In yet another aspect, cellulose materials is corn cob.In yet another aspect, cellulose materials is zein fiber.In yet another aspect, cellulose materials is maize straw.In yet another aspect, cellulose materials is that Chinese silvergrass belongs to.In yet another aspect, cellulose materials is orange peel.In yet another aspect, cellulose materials is rice straw.In yet another aspect, cellulose materials is switchgrass (switch grass).In yet another aspect, cellulose materials is straw.

In yet another aspect, cellulose materials is white poplar.In yet another aspect, cellulose materials is eucalyptus.In yet another aspect, cellulose materials is fir (fir).In yet another aspect, cellulose materials is pine tree.In yet another aspect, cellulose materials is willow.In yet another aspect, cellulose materials is dragon spruce.In yet another aspect, cellulose materials is willow.

In yet another aspect, cellulose materials is algae Mierocrystalline cellulose.In yet another aspect, cellulose materials is bacteria cellulose.In yet another aspect, cellulose materials is velveteen (cotton linter).In yet another aspect, cellulose materials is filter paper.In yet another aspect, cellulose materials is Microcrystalline Cellulose.In yet another aspect, cellulose materials is the acid-treated Mierocrystalline cellulose of phosphorus.

In yet another aspect, cellulose materials is hydrobiont matter.As for herein, " hydrobiont matter " means the biomass that produced by photosynthesis process in aquatic environment.Hydrobiont matter can be algae, emergent (emergent plant), floatingleaved plant (floating-leaf plant) or submerged plant (submerged plant).

Cellulose materials in statu quo (as is) is used or carries out pre-treatment, and ordinary method known in the art is used in pre-treatment, as described herein.One preferred aspect, pretreatment of fiber cellulosic material.

Encoding sequence: term " encoding sequence " means directly to specify the polynucleotide of the aminoacid sequence of polypeptide.The border of encoding sequence determines by open reading frame conventionally, and described open reading frame starts as ATG, GTG or TTG with initiator codon, and finishes as TAA, TAG or TGA with terminator codon.Encoding sequence can be genomic dna, cDNA, synthetic DNA or its combination.

Regulating and controlling sequence (control sequence): it is essential nucleotide sequence that term " regulating and controlling sequence " means the polynucleotide of the mature polypeptide of the present invention of encoding to express.Each regulating and controlling sequence can be (that is, from different genes) of natural (that is, from same gene) or external source for the polynucleotide of the described mature polypeptide of coding, or each regulating and controlling sequence is for can be natural or external source each other.These regulating and controlling sequences include but not limited to leader sequence, polyadenylation sequence, propeptide sequence, promotor, signal peptide sequence and transcription terminator.At least, regulating and controlling sequence comprises promotor and the termination signal of transcribing and translating.Regulating and controlling sequence can be equipped with for introducing the joint of specificity restriction site, and described specificity restriction site promotes being connected of polynucleotide encoding district of regulating and controlling sequence and coded polypeptide.

Endoglucanase: term " endoglucanase " means inscribe-Isosorbide-5-Nitrae-(1,3; 1,4)-callose 4-glucan hydrolase (endo-1,4-β-D-glucan4-glucanohydrolase) (E.C.3.2.1.4), for example, in its catalyse cellulose, derivatived cellulose (carboxymethyl cellulose and Natvosol), moss starch (lichenin) 1, β-1 of 4-β-D-glycosidic link, mixing, 3 dextran are the interior hydrolysis (endohydrolysis) of the β-Isosorbide-5-Nitrae key in cereal callose or xyloglucan and other vegetable material of containing cellulosic component for example.Endoglucanase activity can be by measuring the minimizing of substrate viscosity or being increased and determined by the definite reducing end of reducing sugar test method (Zhang etc., 2006, Biotechnology Advances24:452-481).For the present invention, according to Ghose, the method for 1987, Pure and Appl.Chem.59:257-268, at pH5,40 ℃ are used carboxymethyl cellulose (CMC) to determine endoglucanase activity as substrate.

Express: term " expressions " comprises any step that relates to polypeptide generation, it includes but not limited to transcribe, post transcriptional modificaiton, translation, posttranslational modification and secretion.

Expression vector: term " expression vector " means DNA molecular linear or ring-type, the polynucleotide that it comprises coded polypeptide, and described polynucleotide are operably connected with the regulating and controlling sequence that is provided for its expression.

Family's 61 glycoside hydrolases: term " family's 61 glycoside hydrolases " or " GH61 of family " or " GH61 " are defined as the B. according to Henrissat in this article, 1991, A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem.J.280:309-316, and Henrissat B. and Bairoch A., 1996, Updating the sequence-based classification of glycosyl hydrolases, Biochem.J.316:695-696 belongs to the polypeptide of glycoside hydrolysis enzyme family 61.Proenzyme in this family is the very weak inscribe-Isosorbide-5-Nitrae-β-D dextranase activity based on measuring a family member and classify as glycoside hydrolysis enzyme family first.The structure of these enzymes and binding mode are non-classical, and they cannot be considered as real (bona fide) Glycosylase.Yet when the mixture based on when with cellulase or cellulase is together used, it strengthens the ability that ligno-cellulose decomposes, they are retained in CAZy classification.

Feruloyl esterase: term " feruloyl esterase (feruloyl esterase) " means 4-hydroxy-3-methoxy cinnyl-glycosylhydrolase (EC3.1.1.73), its catalysis 4-hydroxy-3-methoxy cinnyl (asafoetide acyl) group is from the hydrolysis of the sugar (it is generally pectinose " natural biomass " substrate) of esterification, to produce forulic acid (Ferulic acid).Feruloyl esterase is also referred to as feruloyl esterase (ferulic acid esterase), hydroxyl cinnamoyl esterase, FAE-III, laurate lytic enzyme, FAEA, cinnAE, FAE-I or FAE-II.For the present invention, ferulaic acid esterase activity is to use the 0.5mM forulic acid p-nitrophenyl ester in 50mM sodium acetate pH5.0 to determine as substrate.The feruloyl esterase of Yi Ge unit equals can be at pH5, and 25 ℃ of per minutes discharge the enzyme amount of 1 micromole's p-NP negatively charged ion.

Fragment: term " fragment " for example means, from the amino acid whose polypeptide of the amino of mature polypeptide and/or carboxyl-terminal deletion one or more (several); Wherein said fragment has xylanase activity.In one aspect, at least 330 amino-acid residues that fragment contains SEQ ID NO:2, for example at least 350 amino-acid residues, or at least 370 amino-acid residues.In yet another aspect, at least 300 amino-acid residues that fragment contains SEQ ID NO:4, for example at least 315 amino-acid residues or at least 330 amino-acid residues.In yet another aspect, at least 300 amino-acid residues that fragment contains SEQ ID NO:6, for example at least 320 amino-acid residues or at least 340 amino-acid residues.In yet another aspect, at least 300 amino-acid residues that fragment contains SEQ ID NO:8, for example at least 315 amino-acid residues or at least 330 amino-acid residues.In yet another aspect, at least 260 amino-acid residues that fragment contains SEQ ID NO:10, for example at least 275 amino-acid residues or at least 290 amino-acid residues.In yet another aspect, at least 290 amino-acid residues that fragment contains SEQ ID NO:12, for example at least 305 amino-acid residues or at least 320 amino-acid residues.In yet another aspect, at least 290 amino-acid residues that fragment contains SEQ ID NO:14, for example at least 305 amino-acid residues or at least 320 amino-acid residues.In yet another aspect, at least 300 amino-acid residues that fragment contains SEQ ID NO:16, for example at least 315 amino-acid residues or at least 330 amino-acid residues.In yet another aspect, at least 320 amino-acid residues that fragment contains SEQ ID NO:18, for example at least 335 amino-acid residues or at least 350 amino-acid residues.In yet another aspect, at least 300 amino-acid residues that fragment contains SEQ ID NO:20, for example at least 315 amino-acid residues or at least 330 amino-acid residues.

Hemicellulose lytic enzyme or hemicellulase: term " hemicellulose lytic enzyme " or " hemicellulase " mean the enzyme of one or more (for example several) hydrolyzed hemicellulose materials.Referring to, for example Shallom D. and Shoham Y.Microbial hemicellulases.Current Opinion In Microbiology, 2003,6 (3): 219-228).Hemicellulase is the key component in Degrading plant biomass.The example of hemicellulase includes but not limited to acetyl mannan esterase, acetyl xylan esterase, arabanase, arabinofuranosidase, coumaric acid esterase, feruloyl esterase, tilactase, glucuronidase, glucuronic acid esterase, mannonase mannosidase, zytase and xylosidase.The substrate of these enzymes, hemicellulose is the group that mixes of branching and straight-chain polysaccharide, and these polysaccharide are the cellulose micro-fibers in plant cell wall by hydrogen bonding, and cross-linking is the network of robust (robust).Hemicellulose also covalently invests xylogen, with the Mierocrystalline cellulose structure of height of formation complexity together.The changeable structure of hemicellulose and organizational form need the synergy of many enzymes to make it degradable.The catalytic module of hemicellulase is the glycoside hydrolase (GH) of hydrolysis sugar glycosidic bond, or the sugar ester enzyme (CE) of the ester of hydrolysis acetic acid or forulic acid side group connection.These catalytic module, the homology based on its primary structure, can be assigned as GHHe CE family.Some families, have generally and similarly fold, and can further classify as clan (clan), with alphabetic flag (for example, GH-A).The classification of tool informedness and up-to-date these and other sugared organized enzymes can obtain at Carbohydrate-Active Enzymes (CAZy) database.Hemicellulose lytic enzyme activity can be according to Ghose and Bisaria, and 1987, Pure & Appl.Chem.59:1739-1752 is in suitable temperature, and for example 50 ℃, 55 ℃ or 60 ℃, and pH, for example 5.0 or 5.5 measure.

High stringent condition: term " high stringent condition " means the probe at least 100 Nucleotide of length, 42 ℃ 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 50% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 65 ℃, solid support material finally to be washed three times, each 15 minutes.

Host cell: term " host cell " means to be suitable for to use that the nucleic acid construct or the expression vector that comprise polynucleotide of the present invention transform, the cell type of transfection, transduction etc.It is any because the sudden change copying middle generation is different from the offspring of parental cell that parental cell contained in term " host cell ".

Separated: term " separated " means the material that form not occur at nature or environment exist.The non-limiting example of separated material comprises the material that (1) any non-natural exists, (2) any at least in part with one or more or material that all the naturally occurring composition followed natural with it departs from, include but not limited to any enzyme, variant, nucleic acid, protein, peptide or cofactor; (3) anyly for being seen this material of occurring in nature, passed through manually modified material; Or (4) are any, and by increase this amount of substance with respect to other components of following natural with it, (for example, the restructuring in host cell produces; The encode multiple copied of gene of this material; And the use promotor stronger than the natural promotor of following of gene with this material of coding) material of modifying.

Low stringency condition: term " low stringency condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 25% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 50 ℃, solid support material finally to be washed three times, each 15 minutes.

Mature polypeptide: term " mature polypeptide " means the polypeptide that the final form after translation and any posttranslational modification exists with it, the processing of described modification such as N-end, the brachymemma of C-end, glycosylation, phosphorylation etc.In one aspect, according to the amino acid/11 to 20 of prediction SEQ ID NO:2 (P244XT), are SignalP program (Nielsen etc. of signal peptide, 1997, Protein Engineering10:1-6), mature polypeptide is the amino acid 21 to 406 of SEQ ID NO:2.In yet another aspect, according to the amino acid/11 to 17 of prediction SEQ ID NO:4 (P244XW), are SignalP programs of signal peptide, mature polypeptide is the amino acid/11 8 to 360 of SEQ ID NO:4.In yet another aspect, according to the amino acid/11 to 18 of prediction SEQ ID NO:6 (P244Y1), are SignalP programs of signal peptide, mature polypeptide is the amino acid/11 9 to 376 of SEQ ID NO:6.In yet another aspect, according to the amino acid/11 to 22 of prediction SEQ ID NO:8 (P244Y2), are SignalP programs of signal peptide, mature polypeptide is the amino acid 23 to 367 of SEQ ID NO:8.In yet another aspect, according to the amino acid/11 to 18 of prediction SEQ ID NO:10 (P23DM4), are SignalP programs of signal peptide, mature polypeptide is the amino acid/11 9 to 326 of SEQ ID NO:10.In yet another aspect, according to the amino acid/11 to 20 of prediction SEQ ID NO:12 (P249XY), are SignalP programs of signal peptide, mature polypeptide is the amino acid 21 to 354 of SEQ ID NO:12.In yet another aspect, according to the amino acid/11 to 17 of prediction SEQ ID NO:14 (P24MCW), are SignalP programs of signal peptide, mature polypeptide is the amino acid/11 8 to 355 of SEQ ID NO:14.In yet another aspect, according to the amino acid/11 to 19 of prediction SEQ ID NO:16 (P24MCX), are SignalP programs of signal peptide, mature polypeptide is the amino acid 20 to 366 of SEQ ID NO:16.In yet another aspect, according to the amino acid/11 to 17 of prediction SEQ ID NO:18 (P24FVF), are SignalP programs of signal peptide, mature polypeptide is the amino acid/11 8 to 381 of SEQ ID NO:18.In yet another aspect, according to the amino acid/11 to 17 of prediction SEQ ID NO:20 (P241KU), are SignalP programs of signal peptide, mature polypeptide is the amino acid/11 8 to 362 of SEQ ID NO:20.Be known in the art the mixture that host cell can produce two or more different mature polypeptides (having different C end and/or N terminal amino acid) of being expressed by identical polynucleotide.

Mature polypeptide encoded sequence: term " mature polypeptide encoded sequence " means the polynucleotide that coding has the mature polypeptide of xylanase activity.In one aspect, according to the SignalP program (Nielsen etc. of Nucleotide 1 to the 60 coded signal peptide of prediction SEQ ID NO:1 (D822JR), 1997, on seeing), mature polypeptide encoded sequence is the Nucleotide 61 to 1311 of SEQ ID NO:1 or its cDNA sequence.In yet another aspect, according to the SignalP program of Nucleotide 1 to the 51 coded signal peptide of prediction SEQ ID NO:3 (D822JT), mature polypeptide encoded sequence is the Nucleotide 52 to 1347 of SEQ ID NO:3 or its cDNA sequence.In yet another aspect, according to the SignalP program of Nucleotide 1 to the 54 coded signal peptide of prediction SEQ ID NO:5 (D822JW), mature polypeptide encoded sequence is the Nucleotide 55 to 1196 of SEQ ID NO:5 or its cDNA sequence.In yet another aspect, according to the SignalP program of Nucleotide 1 to the 66 coded signal peptide of prediction SEQ ID NO:7 (D822JX), mature polypeptide encoded sequence is the Nucleotide 67 to 1101 of SEQ ID NO:7 or its cDNA sequence.In yet another aspect, according to the SignalP program of Nucleotide 1 to the 54 coded signal peptide of prediction SEQ ID NO:9 (D6RM), mature polypeptide encoded sequence is the Nucleotide 55 to 1620 of SEQ ID NO:9 or its cDNA sequence.In yet another aspect, according to the SignalP program of Nucleotide 1 to the 60 coded signal peptide of prediction SEQ ID NO:11 (D82DB2), mature polypeptide encoded sequence is the Nucleotide 61 to 1362 of SEQ ID NO:11 or its cDNA sequence.In yet another aspect, according to the SignalP program of Nucleotide 1 to the 51 coded signal peptide of prediction SEQ ID NO:13 (D1316T), mature polypeptide encoded sequence is the Nucleotide 52 to 1510 of SEQ ID NO:13 or its cDNA sequence.In yet another aspect, according to the SignalP program of Nucleotide 1 to the 57 coded signal peptide of prediction SEQ ID NO:15 (D1315U), mature polypeptide encoded sequence is the Nucleotide 58 to 1098 of SEQ ID NO:15 or its cDNA sequence.In yet another aspect, according to the SignalP program of Nucleotide 1 to the 51 coded signal peptide of prediction SEQ ID NO:17 (D82PQC), mature polypeptide encoded sequence is the Nucleotide 52 to 1362 of SEQ ID NO:17 or its cDNA sequence.In yet another aspect, according to the SignalP program of Nucleotide 1 to the 51 coded signal peptide of prediction SEQ ID NO:19 (D72UED), mature polypeptide encoded sequence is the Nucleotide 52 to 1165 of SEQ ID NO:19 or its cDNA sequence.

Medium stringent condition: term " medium stringent condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 35% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 55 ℃, solid support material finally to be washed three times, each 15 minutes.

Medium-Gao stringent condition: term " medium-Gao stringent condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 35% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 60 ℃, solid support material finally to be washed three times, each 15 minutes.

Nucleic acid construct: term " nucleic acid construct " means strand or double-stranded nucleic acid molecule, its separation is from naturally occurring gene, or it did not modifiedly contain the section of nucleic acid not originally to be present in the mode of (not otherwise exist) occurring in nature, or it is for what synthesize, it comprises one or more regulating and controlling sequences.

Be operably connected: term " is operably connected " and means such configuration, wherein regulating and controlling sequence be placed in to the appropriate location with respect to the encoding sequence of polynucleotide, make regulating and controlling sequence instruct the expression of encoding sequence.

The polypeptide with cellulolytic enhancing activity: term " polypeptide with cellulose decomposition enhancing " means catalysis and has the GH61 polypeptide of the enzyme of cellulolytic activity to the enhancing of the hydrolysis of cellulose materials.For the present invention, by measuring, come free cellulolytic enzyme to be hydrolyzed compare the reducing sugar increase of hydrolysis fiber cellulosic material or the total amount increase of cellobiose and glucose and to determine cellulolytic enhancing activity with contrast under the following conditions: Mierocrystalline cellulose in 1-50mg total protein/g PCS, the cellulose decomposition zymoprotein that wherein total protein comprises 50-99.5%w/w, and the protein of the GH61 polypeptide with cellulolytic enhancing activity of 0.5-50%w/w, in suitable temperature, for example 50 ℃, 55 ℃ or 60 ℃ and pH, for example 5.0 or 5.5 last 1-7 days, the total protein heap(ed) capacity of equivalent is used in contrast hydrolysis and cellulose-less decomposes enhanced activity (Mierocrystalline cellulose in 1-50mg cellulose decomposition albumen/g PCS) and carries out.One preferred aspect, use under the cellulase protein heap(ed) capacity existence of the aspergillus oryzae beta-glucosidase enzyme (generations of recombinate in aspergillus oryzae according to WO02/095014) of 2-3% of total protein weight or the Aspergillus fumigatus beta-glucosidase enzyme of the 2-3% of total protein quality (restructuring generation in aspergillus oryzae as described in WO2002/095014) 1.5L the mixture of (Novozymes A/S, Bagsvaerd, Denmark) is as the source of cellulolytic activity.

Having the amount that the GH61 polypeptide of cellulolytic enhancing activity reaches the required cellulolytic enzyme of same hydrolysis level by reduction strengthens by the hydrolysis with the enzymatic cellulose materials of cellulolytic activity, preferably reduce at least 1.01 times, for example at least 1.05 times, at least 1.10 times, at least 1.25 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 10 times, or at least 20 times.

Pretreated maize straw: term " PCS " or " pretreated maize straw " mean by processing by heat and dilute sulphuric acid, alkali pre-treatment or the pretreated cellulose materials that is derived from maize straw of neutrality.

Sequence identity: parameter " sequence identity " is described between two aminoacid sequences or the dependency between two nucleotide sequences.

For the present invention, sequence identity degree between two aminoacid sequences is used as EMBOSS software package (EMBOSS:The European Molecular Biology Open Software Suite, Rice etc., 2000, Trends Genet.16:276-277), preferably 3.0.0,5.0.0 version or more performed Needleman-Wunsch algorithm in the Needle program of highest version (Needleman and Wunsch, 1970, J.Mol.Biol.48:443-453) measure.The parameter of using is opened point penalty (gap open penalty) 10 for breach, and breach extends point penalty (gap extension penalty) 0.5 and EBLOSUM62 (the EMBOSS version of BLOSUM62) substitution matrix.Use Output rusults (acquisition of use-nobrief option) that Needle is labeled as " the highest identity (longest identity) " as identity per-cent, and be calculated as follows:

(same residue * 100)/(sum of breach in comparison length-comparison)

For the present invention, sequence identity degree between two nucleotide sequences is used as EMBOSS software package (EMBOSS:The European Molecular Biology Open Software Suite, Rice etc., 2000, see above), preferably 5.0.0 version or more performed Needleman-Wunsch algorithm in the Needle program of highest version (Needleman and Wunsch, 1970, see above) measure.The parameter of using is opened point penalty 10 for breach, and breach extends point penalty 0.5 and EDNAFULL (the EMBOSS version of NCBI NUC4.4) substitution matrix.Use Output rusults (acquisition of use-nobrief option) that Needle is labeled as " the highest identity " as identity per-cent, and be calculated as follows:

(same deoxyribonucleotide * 100)/(sum of breach in comparison length-comparison)

Subsequence: term " subsequence (subsequence) " for example means, from the polynucleotide of 5 ' and/or 3 ' end disappearance one or more (several) Nucleotide of mature polypeptide encoded sequence; Wherein said subsequence coding has the fragment of xylanase activity.In one aspect, at least 990 Nucleotide that subsequence contains SEQ ID NO:1, for example at least 1050 Nucleotide, or at least 1110 Nucleotide.In yet another aspect, at least 900 Nucleotide that subsequence contains SEQ ID NO:3, for example at least 945 Nucleotide or at least 990 Nucleotide.In yet another aspect, at least 900 Nucleotide that subsequence contains SEQ ID NO:5, for example at least 960 Nucleotide or at least 1020 Nucleotide.In yet another aspect, at least 900 Nucleotide that subsequence contains SEQ ID NO:7, for example at least 945 Nucleotide or at least 990 Nucleotide.In yet another aspect, at least 780 Nucleotide that subsequence contains SEQ ID NO:9, for example at least 825 Nucleotide or at least 870 Nucleotide.In yet another aspect, at least 870 Nucleotide that subsequence contains SEQ ID NO:11, for example at least 915 Nucleotide or at least 960 Nucleotide.In yet another aspect, at least 870 Nucleotide that subsequence contains SEQ ID NO:13, for example at least 915 Nucleotide or at least 960 Nucleotide.In yet another aspect, at least 900 Nucleotide that subsequence contains SEQ ID NO:15, for example at least 945 Nucleotide or at least 990 Nucleotide.In yet another aspect, at least 960 Nucleotide that subsequence contains SEQ ID NO:17, for example at least 1005 Nucleotide or at least 1050 Nucleotide.In yet another aspect, at least 900 Nucleotide that subsequence contains SEQ ID NO:19, for example at least 945 Nucleotide or at least 990 Nucleotide.

Variant: term " variant " means for example, to comprise change, the polypeptide with xylanase activity that replaces, inserts and/or lack in one or more (several) position.Replace and mean to occupy the different amino acid replacement for amino acid of certain position; Disappearance means to remove the amino acid that occupies certain position; And insert mean in abutting connection with and and then occupy the amino acid of certain position after add amino acid.

Very high stringent condition: term " very high stringent condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 50% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 70 ℃, solid support material finally to be washed three times, each 15 minutes.

Unusual low stringency condition: term " very low stringency condition " means the probe at least 100 Nucleotide of length, at 42 ℃, 5X SSPE, 0.3%SDS, 200 micrograms/ml sheared and the methane amide of the salmon sperm DNA of sex change and 25% in, according to the Southern blotting of standard, carry out prehybridization and hybridization 12 to 24 hours.Use 2X SSC, 0.2%SDS at 45 ℃, solid support material finally to be washed three times, each 15 minutes.

Containing xylan material: term " containing xylan material " means the material of any plant cell wall polysaccharides that comprises the xylose residues skeleton that contains β-(1-4) connect.The xylan of terrestrial plant is the heteropolymer with β-(1-4)-xylopyranose skeleton, and it has short sugar chain branch.They comprise D-glucuronic acid or its 4-O-methyl ether, L-arabinose and/or the multiple oligosaccharides that comprises D-wood sugar, L-arabinose, D-or L-semi-lactosi and D-Glucose.The polysaccharide of xylan type can be divided into equal xylan (homoxylan) and Heteroxylan (heteroxylan), the latter comprises glucuronoxylan, (Arab) glucuronoxylan, (glucuronic acid) araboxylan, araboxylan and compound Heteroxylan.Referring to, such as Ebringerova etc., 2005, Adv.Polym.Sci.186:1-67.

In technique of the present invention, can use any material that contains xylan.One preferred aspect, described containing xylan material be ligno-cellulose.

Xylan degrading activity or xylan degrading activity: term " xylan degrading is active " or " xylan degrading activity " mean hydrolysis containing the biologic activity of xylan material.Two kinds of basic methods of measuring xylan degrading activity comprise: (1) measures total pentosan degrading activity, and (2) measure independent xylan degrading activity (for example endo-xylanase, xylobiase, arabinofuranosidase, alpha-glucuronidase, acetyl xylan esterase, feruloyl esterase and α-glucuronic acid esterase (α-glucuronyl esterase)).The nearest in-progress summary in xylanase clastic enzyme assay method is in several open source literatures, comprise Biely and Puchard, Recent progress in the assays of xylanolytic enzymes, 2006, Journal of the Science of Food and Agriculture86 (11): 1636-1647; Spanikova and Biely, 2006, Glucuronoyl esterase-Novel carbohydrate esterase produced by Schizophyllum commune, FEBS Letters580 (19): 4597-4601; Herrmann, Vrsanska, Jurickova, Hirsch, Biely, and Kubicek, 1997, The beta-D-xylosidase of Trichoderma reesei is a multifunctional beta-D-xylan xylohydrolase, Biochemical Journal321:375-381.

Total pentosan degrading activity can be measured by determining from the reducing sugar of polytype xylan formation, described xylan comprises for example oat wheat (oat spelt), beech wood (beechwood) and Larch (larchwood) xylan, or can determine that the xylan fragment of the dyeing discharging from the xylan of multiple covalency dyeing measures by light-intensity method.The 4-O-methylglucuronic acid xylan of modal total pentosan degrading activity assay method based on from poly produces reducing sugar, as Bailey, Biely, Poutanen, 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology23 (3): described in 257-270.Xylanase activity also available 0.2%AZCL-araboxylan as substrate at 37 ℃ 0.01% in X-100 (4-(1,1,3,3-tetramethyl butyl) phenyl-polyoxyethylene glycol) and 200mM sodium phosphate buffer pH6, determine.The xylanase activity of Yi Ge unit is defined as at 37 ℃, and pH6 produces 1.0 micromole's azurins (azurine) from the 0.2%AZCL-araboxylan per minute as substrate in 200mM sodium phosphate pH6 damping fluid.

For the present invention, xylan degrading activity is birch xylan (the Sigma Chemical Co. being caused under following usual conditions by xylanolytic enzyme by measuring, Inc., St.Louis, MO, USA) increase of hydrolysis is determined: 1ml reaction, 5mg/ml substrate (total solid), 5mg xylan decomposing protein/g substrate, 50mM sodium acetate, pH5, 50 ℃, 24 hours, as Lever, 1972, A new reaction for colorimetric determination of carbohydrates, described in Anal.Biochem47:273-279, use P-hydroxybenzoic acid hydrazides (PHBAH) assay method to carry out glycan analysis.

Zytase: term " zytase " means Isosorbide-5-Nitrae-β-D-xylan-wood sugar lytic enzyme (Isosorbide-5-Nitrae-β-D-xylan-xylohydrolase) (E.C.3.2.1.8), the interior hydrolysis of Isosorbide-5-Nitrae-β-D-wood sugar glycosidic bond in its catalysis xylan.For the present invention, xylanase activity can with 0.2%AZCL-araboxylan as substrate at 37 ℃, pH6 is 0.01% in X-100 and 200mM sodium phosphate buffer or with 0.2%AZCL-xylan as substrate at 50 ℃, pH5.0 is 0.01% in X-100 and 20mM sodium acetate buffer, (referring to embodiment 17) determines.The xylanase activity of Yi Ge unit is defined as at 37 ℃, pH6 is from the 0.2%AZCL-araboxylan as substrate or at 50 ℃ in 200mM sodium phosphate pH6 damping fluid, and pH5 produces 1.0 mmoles (mmole) azurin from 0.2%AZCL-xylan per minute in 20mM sodium acetate buffer pH5.Or xylanase activity can be used birch xylan to determine as substrate according to embodiment 16.

In one aspect, polypeptide of the present invention has SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the cellulolytic enhancing activity of the mature polypeptide of SEQ ID NO:20 at least 20%, for example at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100%.

Detailed Description Of The Invention

The polypeptide with xylanase activity

In one embodiment, the present invention relates to isolated polypeptide, the mature polypeptide of itself and SEQ ID NO:2 has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 65% with the mature polypeptide of SEQ ID NO:12, for example at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 70% with the mature polypeptide of SEQ ID NO:4 or SEQ ID NO:10, for example at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 75% with the mature polypeptide of SEQ ID NO:14 or SEQ ID NO:16, for example at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 80% with the mature polypeptide of SEQ ID NO:6 or SEQ ID NO:8, for example at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 85% with the mature polypeptide of SEQ ID NO:20, for example at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 90% with the mature polypeptide of SEQ ID NO:18, for example at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Described polypeptide has xylanase activity.In one aspect, described polypeptide and SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the mature polypeptide of SEQ ID NO:20 differs 10 amino acid of as many as, for example 1,2,3,4,5,6,7,8,9 or 10 amino acid.

Polypeptide of the present invention preferably comprises or consists of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the aminoacid sequence of SEQ ID NO:20 or its allelic variant; Or there is the fragment of xylanase activity for it.In yet another aspect, described polypeptide comprises or consists of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the mature polypeptide of SEQ ID NO:20.In yet another aspect, described polypeptide comprises or consists of the amino acid 21 to 406 of SEQ ID NO:2, the amino acid/11 8 to 360 of SEQ ID NO:4, the amino acid/11 9 to 376 of SEQ ID NO:6, the amino acid 23 to 367 of SEQ ID NO:8, the amino acid/11 9 to 326 of SEQ ID NO:10, the amino acid 21 to 354 of SEQ ID NO:12, the amino acid/11 8 to 355 of SEQ ID NO:14, the amino acid 20 to 366 of SEQ ID NO:16, the amino acid/11 8 to 381 of SEQ ID NO:18, or the amino acid/11 8 to 362 of SEQ ID NO:20.

In another embodiment, the present invention relates to have the isolated polypeptide of xylanase activity, it is by polynucleotide encoding, described polynucleotide are at unusual low stringency condition, low stringency condition, medium stringent condition, medium-Gao stringent condition, high stringent condition, or hybridize with following under very high stringent condition: (i) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or the mature polypeptide encoded sequence of SEQ ID NO:19, (ii) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:17, or the cDNA sequence of SEQ ID NO:19, or (iii) (i) or total length complement (Sambrook etc. (ii), 1989, Molecular Cloning, A Laboratory Manual, the 2nd edition, Cold Spring Harbor, New York).

Can utilize SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or the polynucleotide of SEQ ID NO:19 or its subsequence, and SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the polypeptide of SEQ ID NO:20 or its mature polypeptide, or its fragment designing nucleic acid probe, the DNA of the polypeptide that there is xylanase activity with the identification of strains that never belongs to together or plant according to method well known in the art and clones coding.Particularly, according to the Southern trace method of standard, can by these probes for the genomic dna of interested cell or cDNA hybridization, with identify with from separated gene accordingly wherein.These probes can be significantly shorter than complete sequence, but should be at least 15 in length, for example at least 25, at least 35, or at least 70 Nucleotide.Preferably, described nucleic acid probe is the length of at least 100 Nucleotide, for example, at least 200 Nucleotide, at least 300 Nucleotide, at least 400 Nucleotide, at least 500 Nucleotide, at least 600 Nucleotide, at least 700 Nucleotide, at least 800 Nucleotide, or the length of at least 900 Nucleotide.The two all can be used DNA and rna probe.Conventionally probe mark (for example, is used to survey corresponding gene ³²p, ³h, ³⁵s, vitamin H or avidin (avidin) mark).These probes are covered by the present invention.

Can be from the genomic dna prepared by other such bacterial strain or cDNA library screening and above-mentioned probe hybridization and coding there is the DNA of the polypeptide of xylanase activity.Can pass through agarose or polyacrylamide gel electrophoresis, or pass through other isolation technique separation from genome or other DNA of these other bacterial strains.The DNA of the DNA from library or separation can be transferred to soluble cotton (nitrocellulose) or other suitable solid support material and be fixed thereon.In order to identify the NO:1 with SEQ ID, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or its mature polypeptide encoded sequence of SEQ ID NO:19, or clone or the DNA of its subsequence hybridization, described solid support material is used in Sounthern trace.

For the present invention, hybridization represents that polynucleotide are at the nucleic acid probe hybridization being low to moderate very much under very high stringent condition with mark, described nucleic acid probe is corresponding to (i) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:19, (ii) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or the mature polypeptide encoded sequence of SEQ ID NO:19, (iii) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:17, or the cDNA sequence of SEQ ID NO:19, (iv) their total length complement, or (v) their subsequence.Can use X-ray film (X-ray film) for example or other any detection meanss as known in the art to detect under these conditions the molecule with nucleic acid probe hybridization.

In one aspect, described nucleic acid probe is coding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the polypeptide of SEQ ID NO:20 or its mature polypeptide, or the polynucleotide of their fragment.In yet another aspect, described nucleic acid probe is SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:19 or SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:17, or the cDNA sequence of SEQ ID NO:19.

In another embodiment, the present invention relates to have the isolated polypeptide of xylanase activity, it is by polynucleotide encoding, the mature polypeptide encoded sequence of described polynucleotide and SEQ ID NO:1 or its cDNA sequence have at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 65% with mature polypeptide encoded sequence or its cDNA sequence of SEQ ID NO:11, for example at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 70% with the mature polypeptide encoded sequence of SEQ ID NO:3 or mature polypeptide encoded sequence or its cDNA sequence of its cDNA sequence or SEQ ID NO:9, for example at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 75% with the mature polypeptide encoded sequence of SEQ ID NO:13 or the mature polypeptide encoded sequence of its cDNA sequence or SEQ ID NO:15, for example at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 80% with the mature polypeptide encoded sequence of SEQ ID NO:5 or the mature polypeptide encoded sequence of its cDNA sequence or SEQ ID NO:7, for example at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 85% with mature polypeptide encoded sequence or its cDNA sequence of SEQ ID NO:19, for example at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or have at least 90% with mature polypeptide encoded sequence or its cDNA sequence of SEQ ID NO:17, for example at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, described polypeptide has xylanase activity.。

In another embodiment, the present invention relates to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the mature polypeptide of SEQ ID NO:20 for example, comprises the variant of replacement, disappearance and/or insertion in one or more (several) position.In one embodiment, import SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the quantity of aminoacid replacement, disappearance and/or the insertion of the mature polypeptide of SEQ ID NO:20 is 10 at the most, for example 1,2,3,4,5,6,7,8,9 or 10.Amino acid change can be less important in nature, i.e. conservative aminoacid replacement or insertion, its not remarkably influenced protein folding and/or active; Be generally 1 to about 30 amino acid whose little disappearances; Little amino or C-terminal extend, as N-terminal methionine residues; The little joint peptide of the about 20-25 of an as many as residue; Or by changing net charge or other function, promote the little extension of purifying, as polyhistidine sequence (poly histidine tract), epitope (antigenic epitope) or in conjunction with territory (binding domain).

The conservative example replacing is within following group: basic aminoacids group (arginine, Methionin and Histidine), acidic amino acid group (L-glutamic acid and aspartic acid), polare Aminosaeren group (glutamine and l-asparagine), hydrophobic amino acid group (leucine, Isoleucine and α-amino-isovaleric acid), aromatic amino acid group (phenylalanine, tryptophane and tyrosine) and p1 amino acid group (glycine, L-Ala, Serine, Threonine and methionine(Met)).Conventionally the aminoacid replacement that does not change specific activity (specific activity) is known in the art, and by for example H.Neurath and R.L.Hill, 1979, in The Proteins, Academic Press, describes in New York.The exchange the most generally occurring is Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly.

Or amino acid change has the character of the physics-chem characteristic change that causes polypeptide.For example, amino acid change can improve the thermostability of polypeptide, changes substrate specificity, changes optimal pH etc.

Can be according to methods known in the art, for example site-directed mutagenesis or L-Ala subregion mutagenesis (Cunningham and Wells, 1989, Science244:1081-1085) identify the indispensable amino acid in parent's polypeptide.In a rear technology, single alanine mutation is incorporated into each residue in molecule, and tests resulting mutating molecule and whether there is xylanase activity, to identify the amino-acid residue for the activity key of described molecule.Separately referring to Hilton etc., 1996, J.Biol.Chem.271:4699-4708.The reactive site of enzyme or other biological interaction also can pass through the physical analysis to structure, in conjunction with the amino acid whose sudden change in contact site for inferring, determine, structure is measured by following these technology: as nucleus magnetic resonance, crystallography, electron diffraction or photoaffinity labeling.Referring to such as de Vos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol.224:899-904; Wlodaver etc., 1992, FEBS Lett.309:59-64.Also can infer from the identity analysis with related polypeptide the identity of indispensable amino acid.

Can use known mutagenesis, restructuring and/or Shuffling Method, then carry out relevant screening process, as by Reidhaar-Olson and Sauer, 1988, Science241:53-57; Bowie and Sauer, 1989, Proc.Natl.Acad.Sci.USA86:2152-2156; WO95/17413; Or WO95/22625 disclosed those, carry out one or more aminoacid replacement, disappearance and/or insert and tested.Other spendable methods comprise that fallibility PCR, phage display are (such as Lowman etc., 1991, Biochemistry30:10832-10837; U.S. Patent number 5,223,409; WO92/06204) and region directed mutagenesis (region-directed mutagenesis) (Derbyshire etc., 1986, Gene46:145; Deng, 1988, DNA7:127).

Mutagenesis/Shuffling Method can combine to detect the activity (Ness etc., 1999, Nature Biotechnology17:893-896) by the polypeptide through clone, mutagenesis of host cell expression with high-throughput, auto-screening method.The DNA molecular through mutagenesis of coding active polypeptide can reclaim and use this area standard method to check order rapidly from host cell.These methods allow to determine fast the importance of single amino acids residue in polypeptide.

Described polypeptide can be hybrid polypeptide, and the region of one of them polypeptide is blended in N end or the C end in the region of another polypeptide.

Described polypeptide can be the fusion polypeptide that fusion polypeptide maybe can be cut, and wherein another polypeptide is blended in N end or the C end of polypeptide of the present invention.By being blended in to polynucleotide of the present invention, the polynucleotide of another polypeptide of coding produce fusion polypeptide.The technology that produces fusion polypeptide is known in the art, and comprises and connect the encoding sequence of coded polypeptide so that they meet frame (in frame), and makes the expression of fusion polypeptide under the control of identical promoters and terminator.Fusion rotein also can be used interior albumen (intein) technique construction, wherein fusions after translation, produce (Cooper etc., 1993, EMBO J.12:2575-2583; Dawson etc., 1994, Science266:776-779).

Fusion polypeptide also can comprise cleavage site between two polypeptide.When secretion fusion polypeptide, described site is just cut open, and discharges described two polypeptide.The example that cuts site includes, but not limited to be disclosed in Martin etc., 2003, J.Ind.Microbiol.Biotechnol.3:568-76; Svetina etc., 2000, J.Biotechnol.76:245-251; Rasmussen-Wilson etc., 1997, Appl.Environ.Microbiol.63:3488-3493; Ward etc., 1995, Biotechnology13:498-503; With Contreras etc., 1991, Biotechnology9:378-381; Eaton etc., 1986, Biochem.25:505-512); Collins-Racie etc., 1995, Biotechnology13:982-987; Carter etc., 1989, Proteins:Structure, Function, and Genetics6:240-248; And Stevens, the site in 2003, Drug Discovery World4:35-48.

The source with the polypeptide of xylanase activity

The polypeptide with xylanase activity of the present invention can obtain the microorganism from any genus.For the present invention, for relevant with given source herein term " obtain from ", the polypeptide that the meaning should be by polynucleotide encoding is produced by described source, or is produced by the bacterial strain wherein having inserted from the polynucleotide in described source.In one aspect, the polypeptide obtaining from given source is exocytosis.

In one aspect, described polypeptide is that capital spore belongs to (Scytalidium) polypeptide.In yet another aspect, described polypeptide is thermophilic capital spore (Scytalidium thermophilum) polypeptide.In yet another aspect, described polypeptide is Malbranchea polypeptide, and in yet another aspect, described polypeptide is camphor tree suede branch mould (Malbranchea cinnamomea) polypeptide.In yet another aspect, described polypeptide is that excellent softgel shell belongs to (Corynascus) polypeptide.In yet another aspect, described polypeptide is thermophilic excellent softgel shell (Corynascus thermophilus) polypeptide.In yet another aspect, described polypeptide is thermophilic excellent softgel shell CBS174.70 polypeptide.In yet another aspect, described polypeptide is Penicillium (Penicillium) polypeptide.In yet another aspect, described polypeptide is penicillium oxalicum (Penicillium oxalicum) polypeptide.

Will be understood that for aforesaid kind, the present invention comprises completely and the imperfect state (perfect and imperfect states), with other taxonomic equivalent (equivalent), anamorph (anamorph) for example, and their known kind names no matter.Those skilled in the art will easily identify the identity of applicable equivalent.

The bacterial strain of these kinds can easily be obtained for the public at many culture collections center, described preservation center such as American type culture collection (the American Type Culture Collection) (ATCC), Germany microorganism and cell culture preservation center (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) are (DSMZ), fungi strain preservation center (Centraalbureau Voor Schimmelcultures) (CBS) and research centre, North, agricultural research institute's patent culture collection center (Agricultural Research Service Patent Culture Collection, Northern Regional Research Center) (NRRL).

Can utilize above-mentioned probe to originate from other, for example comprise, from the separated microorganism of nature (, soil, compost, water etc.) or directly obtain for example, DNA sample from nature material (, soil, compost, water etc.), identify and obtain described polypeptide.Be used for is directly well known in the art from the technology of Natural habitat (habitat) separate microorganism and DNA.Can obtain by screening similarly the genomic dna of another kind of microorganism or the DNA sample of cDNA library or mixing the polynucleotide of coding said polypeptide subsequently.Once by probe in detecting to the polynucleotide of coded polypeptide, just can use technology known to persons of ordinary skill in the art by described polynucleotide separated or clone (referring to, for example, Sambrook etc., 1989, see above).

Polynucleotide

The present invention also relates to the coding separated polynucleotide of polypeptide of the present invention as described herein.

For separating of or the technology of clone's polynucleotide be well known in the art, and comprise from genomic dna or cDNA, or its combination is separated.Can be by for example using the polymerase chain reaction (PCR) know or the antibody screening of expression library to detect the cloned DNA fragment with apokoinou construction characteristic, thus realize from this genomic dna cloning polynucleotide.Referring to, for example, Innis etc., 1990, PCR:A Guide to Methods and Application, Academic Press, New York.Can use other nucleic acid amplification method, as (ligated activated transcription is transcribed in ligase chain reaction (LCR) (LCR), connection activation; LAT) amplification with based on polynucleotide (NASBA).Can be from the bacterial strain of capital spore genus, Malbranchea, excellent softgel shell genus or Penicillium, or related organisms is cloned described polynucleotide, therefore, for example can be described polynucleotide polypeptid coding area allele variant or plant between variant (species variant).

The polynucleotide of modifying code book invention polypeptide may be essential for similar polypeptide for synthetic and described polypeptide substantially.Term refers to described polypeptide " substantially similar " form that the non-natural of polypeptide exists.These polypeptide may be different from from its natural origin isolated polypeptide in some engineered modes, for example, and the different variants in aspect such as specific activity, thermostability, optimal pH.Can be as SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, the mature polypeptide encoded sequence of SEQ ID NO:17 or SEQ ID NO:19, or SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, on the basis of the polynucleotide that the cDNA sequence of the mature polypeptide encoded sequence of SEQ ID NO:17 or SEQ ID NO:19 presents and/or by introducing following Nucleotide, replace to build variant: described Nucleotide replaces the change that does not cause polypeptid acid sequence, but its codon that meets the host organisms that is intended to produce enzyme is selected, or described Nucleotide replaces can produce different aminoacid sequences.The general introduction replacing about Nucleotide, referring to, for example, Ford etc., 1991, Protein Expression and Purification2:95-107.

Nucleic acid construct

The invention still further relates to the nucleic acid construct that comprises polynucleotide of the present invention, described polynucleotide are operably connected with one or more regulating and controlling sequences, and described regulating and controlling sequence instructs the expression of encoding sequence in suitable host cell under the condition compatible with this regulating and controlling sequence.

Can be with being permitted described in multi-mode operation polynucleotide so that the expression of polypeptide.Depend on expression vector, it may be desirable or essential operating on it before by polynucleotide insertion vector.The technology of using recombinant DNA method to modify polynucleotide is well known in the art.

Regulating and controlling sequence can be promotor, and it is by the polynucleotide of identifying for expressing the host cell of the polynucleotide of coding polypeptide of the present invention.The transcription regulating nucleotide sequence that promotor contains the expression that mediates polypeptide.Promotor can be any polynucleotide that show transcriptional activity in host cell, comprises sudden change, brachymemma and promotor heterozygosis, and can the born of the same parents' gene acquisition or polypeptide in born of the same parents with host cell homology or allos from coding.

It for instructing the example of the suitable promotor that nucleic acid construct of the present invention transcribes at bacterial host cell, is the promotor from following acquisition: bacillus amyloliquefaciens alpha-amylase gene (amyQ), bacillus licheniformis alpha-amylase gene (amyL), Bacillus licheniformis penicillinase gene (penP), bacstearothermophilus produces malt amylase gene (amyM), subtilis type froctosan saccharase gene (sacB), subtilis xylA and xylB gene, bacillus thuringiensis cryIIIA gene (Agaisse and Lereclus, 1994, Molecular Microbiology13:97-107), intestinal bacteria lac operon, intestinal bacteria trc promotor (Egon etc., 1988, Gene69:301-315), sky blue streptomycete gelase gene (dagA) and protokaryon β-lactamase gene (Villa-Kamaroff etc., 1978, Proceedings of the National Academy of Sciences USA75:3727-3731), and tac promotor (DeBoer etc., 1983, Proc.Natl.Acad.Sci.USA80:21-25).Other promotor is at " Useful proteins from recombinant bacteria " in Gilbert etc., and 1980, Scientific American, in 242:74-94; With at Sambrook etc., 1989, middle description sees above.The example of Gene expression is disclosed in WO99/43835.

It for instructing nucleic acid construct of the present invention, at the example of the suitable promotor of filamentous fungal host cell transcription, is the promotor from the gene acquisition of following enzyme: Aspergillus nidulans acetamidase, aspergillus niger neutral alpha-amylase, aspergillus niger acid acceptance α-amylase, aspergillus niger or Aspergillus awamori glucoamylase (glaA), aspergillus oryzae TAKA amylase, aspergillus oryzae Sumizyme MP, aspergillus oryzae triose-phosphate isomerase, point sickle spore trypsin-like proteolytic enzyme (WO96/00787), empiecement sickle spore amyloglucosidase (WO00/56900), empiecement sickle spore Daria (WO00/56900), empiecement sickle spore Quinn (WO00/56900), Man Hegen Mucor (Rhizomucor miehei) lipase, Man Hegen Mucor aspartate protease, Trichodermareesei beta-glucosidase enzyme, Trichodermareesei cellobiohydrolase I, Trichodermareesei cellobiohydrolase II, trichoderma reesei endoglucanase I, trichoderma reesei endoglucanase II, trichoderma reesei endoglucanase III, trichoderma reesei endoglucanase V, Xylanase from Trichoderma reesei I, Xylanase from Trichoderma reesei II, Xylanase from Trichoderma reesei III, Trichodermareesei xylobiase, Trichodermareesei translation elongation factor, and NA2-tpi promotor (a kind of promotor of modification, it carrys out comfortable Aspergillus neutral alpha-amylase gene, and wherein untranslated leader sequence is substituted by the untranslated leader sequence of the gene of Aspergillus triose-phosphate isomerase, limiting examples comprises the promotor of modification, and it is from the gene of aspergillus niger neutral alpha-amylase, and wherein untranslated leader sequence is substituted by the untranslated leader sequence of the gene of Aspergillus nidulans or aspergillus oryzae triose-phosphate isomerase), with their sudden change, brachymemma and promotor heterozygosis.Other promotor is described in U.S. Patent number 6,011,147.

In yeast host, useful promotor obtains from following gene: yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae galactokinase (GAL1), yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), yeast saccharomyces cerevisiae triose-phosphate isomerase (TPI), brewing yeast metallothionein (CUP1) and yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase.For other useful promotor of yeast host cell, by Romanos etc., 1992, Yeast8:423-488 describes.

Regulating and controlling sequence can be also transcription terminator, and it is identified to stop transcribing by host cell.Described terminator is operably connected with 3 ' end of the polynucleotide of coding said polypeptide.In the present invention, can use any terminator that has function in host cell.

For the preferred terminator of bacterial host cell, from following gene, obtain: Bacillus clausii Sumizyme MP (aprH), bacillus licheniformis alpha-amylase (amyL) and intestinal bacteria ribosome-RNA(rRNA) (rrnB).

For the preferred terminator of filamentous fungal host cell, from the gene of following enzyme, obtain: Aspergillus nidulans acetamidase, Aspergillus nidulans o-amino benzoyl acid synthase, aspergillus niger glucoamylase, aspergillus niger alpha-glucosidase, aspergillus oryzae TAKA amylase, point sickle spore trypsin-like proteolytic enzyme, Trichodermareesei beta-glucosidase enzyme, Trichodermareesei cellobiohydrolase I, Trichodermareesei cellobiohydrolase II, trichoderma reesei endoglucanase I, trichoderma reesei endoglucanase II, trichoderma reesei endoglucanase III, trichoderma reesei endoglucanase V, Xylanase from Trichoderma reesei I, Xylanase from Trichoderma reesei II, Xylanase from Trichoderma reesei III, Trichodermareesei xylobiase and Trichodermareesei translation elongation factor.

For the preferred terminator of yeast host cell, from the gene of following enzyme, obtain: yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate, brewing yeast cell pigment C (CYC1) and yeast saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.For other useful terminator of yeast host cell by Romanos etc., 1992, description sees above.

Regulating and controlling sequence can also be the mRNA stabilization district of the encoding sequence upstream of promotor downstream and gene, and it increases the expression of described gene.

The example in suitable mRNA stabilization district obtains from following gene: bacillus thuringiensis cryIIIA gene (WO94/25612) and subtilis SP82 gene (Hue etc., 1995, Journal of Bacteriology177:3465-3471).

Regulating and controlling sequence also can be leader sequence, and it is for the important mRNA non-translational region of the translation of host cell.Leader sequence is operably connected to 5 '-end of the polynucleotide of coded polypeptide.Can use any leader sequence that has function in host cell.

For the preferred leader sequence of filamentous fungal host cell, from the gene of following enzyme, obtain: aspergillus oryzae TAKA amylase and Aspergillus nidulans triose-phosphate isomerase.

The leader sequence suitable for yeast host cell obtains from the gene of following enzyme: yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase, yeast saccharomyces cerevisiae alpha factor and yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).

Regulating and controlling sequence can be also polyadenylation sequence, and it is the sequence being operably connected with 3 ' end of polynucleotide, and when transcribing, host cell is identified as the signal that poly-adenosine residue is added into the mRNA transcribing.Can use any polyadenylation sequence that has function in host cell.

For the preferred polyadenylation sequence of filamentous fungal host cell, from the gene of following enzyme, obtain: Aspergillus nidulans o-amino benzoyl acid synthase, aspergillus niger glucoamylase, aspergillus niger alpha-glucosidase, aspergillus oryzae TAKA amylase and sharp sickle spore trypsin-like proteolytic enzyme.

For the useful polyadenylation sequence of yeast host cell, by Guo and Sherman, 1995, Mol.Cellular Biol.15:5983-5990 describes.

Regulating and controlling sequence can also be signal peptide coding region, and its coding holds with the N of polypeptide the signal peptide being connected, and and guides described polypeptide to enter emiocytosis approach.Encoding sequence 5 ' the end of polynucleotide can comprise signal coding sequence inherently, and it is connected in translation reading frame natively with together with the section of the encoding sequence of coding said polypeptide.Or encoding sequence 5 ' end can contain the signal coding sequence for described encoding sequence external source.When encoding sequence is natural while not containing signal coding sequence, external source signal coding sequence may be essential.Or, can directly with external source signal coding sequence, replace natural signals peptide-coding sequence to strengthen the secretion of polypeptide.Yet the polypeptide of can instruction expressing enters any signal coding sequence of the Secretory Pathway of host cell.

For the effective signal coding sequence of bacterial host cell, be the signal coding sequence from the gene acquisition of following enzyme: bacillus NCIB11837 produces maltogenic amylase, Bacillus licheniformis subtilisin (subtilisin), Bacillus licheniformis β-lactamase, bacillus stearothermophilus alpha-amylase, bacstearothermophilus neutral protease (nprT, nprS, nprM) and subtilis prsA.Other signal peptide is by Simonen and Palva, and 1993, Microbiological Reviews57:109-137 describes.

For the effective signal coding sequence of filamentous fungal host cell, be the signal coding sequence from the gene acquisition of following enzyme: aspergillus niger neutral starch enzyme, aspergillus niger glucoamylase, aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens EGV, thin cotton shape humicola lanuginosa lipase and Man Hegen Mucor aspartate protease.

The signal peptide useful for yeast host cell obtains from the gene of yeast saccharomyces cerevisiae alpha factor and yeast saccharomyces cerevisiae saccharase.Other useful signal coding sequence is by Romanos etc., and 1992, description sees above.

Regulating and controlling sequence can also be propeptide code sequence, and its coding is positioned at the propetide of polypeptide N end.Gained polypeptide is called proenzyme (proenzyme) or front polypeptide (propolypeptide) (or being called in some cases proenzyme (zymogen)).Front polypeptide is non-activity normally, and catalysis that can be by propetide or autocatalysis cutting in the past polypeptide be converted into active polypeptide.Can obtain propeptide code sequence from the gene of bacillus subtilis alkali proteinase (aprE), subtilis neutral protease (nprT), thermophilic fungus destroyed wire laccase (WO95/33836), Man Hegen Mucor aspartate protease and yeast saccharomyces cerevisiae alpha factor.

When the two all exists when signal peptide and propeptide sequence, and then propeptide sequence is placed in to the N end of (next to) polypeptide, and signal peptide sequence is placed in to the and then N end of propeptide sequence.

It is desirable to equally add regulating sequence, its growth with respect to host cell regulates the expression of polypeptide.The example that regulates sequence is to cause genetic expression response chemistry or physical stimulation thing, comprises those systems that regulate the existence of compound and open or close.Adjusting sequence in prokaryotic system comprises lac, tac and trp operator gene system.In yeast, can use ADH2 system or GAL1 system.In filamentous fungus, can use aspergillus niger glucoamylase promotor, aspergillus oryzae TAKA α-amylase promotor and aspergillus oryzae glucoamylase promotor, Trichodermareesei cellobiohydrolase I promotor and Trichodermareesei cellobiohydrolase II promotor.Other example that regulates sequence is those sequences that allow gene amplification.In eukaryotic system, these regulate sequence to be included in the dihydrofolate reductase gene that methotrexate (methotrexate) exists lower amplification, and the metallothionein gene increasing with heavy metal (with heavy metal).In these cases, the polynucleotide of coded polypeptide will be operably connected with regulating sequence.

Expression vector

The invention still further relates to recombinant expression vector, described recombinant expression vector comprises polynucleotide of the present invention, promotor and transcribes and translation termination signal.Multiple Nucleotide and regulating and controlling sequence can combine to produce recombinant expression vector, and described expression vector can comprise that one or more restriction sites are easily to allow to insert or replace in these sites the polynucleotide of coded polypeptide.Or, can insert the nucleic acid construct or the polynucleotide that comprise described polynucleotide by the carrier for expressing suitable and express described polynucleotide.In preparing the process of expression vector, encoding sequence is placed in to carrier, thereby this encoding sequence is operably connected for expression with suitable regulating and controlling sequence.

Recombinant expression vector can be anyly can carry out easily recombinant DNA step, and can produce the carrier (for example, plasmid or virus) of the expression of polynucleotide.The selection of carrier will conventionally depend on carrier and will introduce the consistency of the host cell of this carrier.Carrier can be wire or closed hoop plasmid.

Carrier can be autonomously replicationg vector, that is, the carrier existing as the outer entity (entity) of karyomit(e), it copies and is independent of chromosome duplication, for example, plasmid, extra-chromosomal element, minichromosome (minichromosome) or artificial chromosome.Carrier can contain any for guaranteeing the means (means) of self-replacation.Or carrier can be a kind of in being introduced into host cell time, is incorporated in genome and the carrier having copied together with having integrated the karyomit(e) of this carrier.In addition, can use independent carrier or plasmid or two or more carriers or plasmid, the global DNA (total DNA) that it contains host cell gene group to be introduced jointly, maybe can be used transposon (transposon).

Described carrier preferably contains one or more selected markers, so that easily select the cell through conversion, transfection, transduction etc.Selected marker is such gene, and its product provides biocide or virus resistance, to the resistance of heavy metal, to auxotrophic prototrophy (prototrophy to auxotrophs) etc.

The example of selective bacterium mark is Bacillus licheniformis or subtilis dal gene, or gives the mark of antibiotics resistance, and described antibiotics resistance is penbritin, paraxin, kantlex, Liu Suanyan NEOMYCIN SULPHATE, spectinomycin or tetracyclin resistance for example.For the suitable mark of yeast host cell, include but not limited to ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3.Selected marker for filamentous fungal host cell includes but not limited to adeA (ribose phosphoric acid aminooimidazole amber carboxylic acid amides synthase, phosphoribosyl aminoimidazole-succinocarboxamide synthase), adeB (ribose phosphoric acid aminooimidazole synthase, phosphoribosyl-aminoimidazole synthase), amdS (acetamidase), argB (ornithine transcarbamylase), bar (careless ammonium phosphine (phosphinothricin) Transacetylase), hph (hygromix phosphotransferase), niaD (nitrate reductase) (nitrate reductase), pyrG (Orotidine-5 '-'-phosphate decarboxylase) (orotidine-5 '-phosphate decarboxylase), sC (sulfate adenylyl transferase) and trpC (o-amino benzoyl acid synthase (anthranilate synthase)) and their equivalent.Preferably be used in Aspergillus cell is Aspergillus nidulans or aspergillus oryzae amdS and pyrG gene and streptomyces hygroscopicus (Streptomyces hygroscopicus) bar gene.What be preferred for Trichoderma cell is adeA, adeB, amdS, hph and pyrG gene.

Selected marker can be the double selection Mk system described in WO2010/039889.In one aspect, described double selection mark is hph-tk double selection Mk system.

Described carrier preferably contains and allows carrier to be integrated into the element that host cell gene group or carrier are independent of genomic self-replicating in cell.

In order to be integrated into host cell gene group, the sequence of the polynucleotide of the responsible coded polypeptide of carrier or for enter genomic any other carrier element by homology or non-homogeneous recombination and integration.Or carrier can contain and is used in reference to conducting and crosses the extra polynucleotide that homologous recombination is integrated into the exact position in host cell gene group chromosome.The possibility of integrating in order to be increased in exact position, what integrated element should contain sufficient amount has the nucleic acid of height sequence identity with corresponding target sequence, as 100 to 10,000 base pair, 400 to 10,000 base pairs, with 800 to 10,000 base pairs, to improve the probability of homologous recombination.Integrated element can be the sequence of the target sequence homology in any and host cell gene group.In addition, integrated element can be the polynucleotide of non-coding or coding.On the other hand, carrier can be passed through to non-homogeneous recombination and integration in the genome of host cell.

For self-replicating, carrier can also comprise replication orgin, and it can independently copy carrier in described host cell.Replication orgin can be any plasmid replicon (replicator) of bringing into play the mediation self-replicating of function in cell.Term " replication orgin " or " plasmid replicon " mean to make the polynucleotide that copy in plasmid or carrier body.

The example of bacterium replication orgin is the replication orgin that allows plasmid pBR322, pUC19, pACYC177 and the pACYC184 copy in intestinal bacteria, and allows the replication orgin of plasmid pUB110, the pE194, pTA1060 and the pAM β 1 that copy in bacillus.

The example that is used for the replication orgin of yeast host cell is 2 microns of replication orgin, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.

In filamentous fungal cells, the example of useful replication orgin is AMA1 and ANS1 (Gems etc., 1991, Gene98:61-67; Cullen etc., 1987, Nucleic Acids Res.15:9163-9175; WO00/24883).Plasmid or carrier that separation of AM A1 gene and structure comprise this gene can complete according to disclosed method in WO00/24883.

Can be by the polynucleotide Insertion Into Host Cell of the present invention of more than one copy to increase the generation of polypeptide.The increase of polynucleotide copies number can obtain by the following method: the sequence of at least one additional copy is integrated into host cell gene group, or the selected marker that can increase is included in polynucleotide, under wherein can existing by the selective agent suitable (selectable agent), culturing cell is selected the amplification copy that contains selected marker, and contains thus the cell of the additional copy of polynucleotide.

For connect said elements with build the method for recombinant expression vector of the present invention be well known to those skilled in the art (referring to, for example, Sambrook etc., 1989, see above).

Host cell

The invention still further relates to recombinant host cell, it comprises polynucleotide of the present invention and is operably connected to one or more regulating and controlling sequences that instruct the generation of polypeptide of the present invention.The construct that comprises polynucleotide or carrier are introduced to host cell, described construct or carrier are maintained as chromosomal integration body or as carrier outside the karyomit(e) of self-replacation as previously mentioned.Term " host cell " comprises that any sudden change owing to occurring in reproduction process of parental cell is different from the offspring of parental cell.The selection of host cell will depend on gene and the source thereof of coded polypeptide to a great extent.

Host cell can be useful any cell in the restructuring of polypeptide of the present invention produces, for example, and protokaryon or eukaryotic cell.

Prokaryotic host cell can be any Gram-positive or gram negative bacterium.Gram positive bacterium includes but not limited to, bacillus, fusobacterium, enterococcus spp, ground bacillus genus, lactobacillus, lactococcus, bacillus marinus genus, Staphylococcus, streptococcus and streptomyces.Gram negative bacterium includes but not limited to, campylobacter, intestinal bacteria, Flavobacterium, Fusobacterium, Helicobacterium, mud Bacillaceae, eisseria, Rhodopseudomonas, salmonella and Ureaplasma.

Bacterial host cell can be any bacillus cell, includes but not limited to Alkaliphilic bacillus, bacillus amyloliquefaciens, bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, bacillus firmus, bacillus lautus, bacillus lentus, Bacillus licheniformis, bacillus megaterium, bacillus pumilus, bacstearothermophilus, subtilis and bacillus thuringiensis cell.

Bacterial host cell also can be any streptococcus cell, includes but not limited to streptococcus equisimilis, streptococcus pyogenes, streptococcus uberis and streptococcus equi beast pest subspecies cell.

Bacterial host cell also can be any streptomyces cell, includes but not limited to, does not produce look streptomycete, deinsectization streptomycete, sky blue streptomycete, streptomyces griseus and shallow Streptomyces glaucoviolaceus cell.

Can realize DNA is incorporated into bacillus cell by the following method: protoplast transformation (referring to, for example, Chang and Cohen, 1979, Mol.Gen.Genet.168:111-115), competent cell conversion (referring to, for example, Young and Spizizen, 1961, J.Bacteriol.81:823-829 or Dubnau and Davidoff-Abelson, 1971, J.Mol.Biol.56:209-221), electroporation (referring to, for example, Shigekawa and Dower, 1988, Biotechniques6:742-751) or engage (referring to, for example, Koehler and Thorne, 1987, J.Bacteriol.169:5771-5278).Can realize DNA is incorporated into Bacillus coli cells by the following method: protoplast transformation (referring to, for example, Hanahan, 1983, J.Mol.Biol.166:557-580) or electroporation (referring to, for example, Dower etc., 1988, Nucleic Acids Res.16:6127-6145).Can realize by the following method DNA is incorporated into streptomyces cell: protoplast transformation, electroporation (referring to, for example, Gong etc., 2004, Folia Microbiol. (Praha) 49:399-405), engage (referring to, for example, Mazodier etc., 1989, J.Bacteriol.171:3583-3585), or transduction (referring to, for example, Burke etc., 2001, Proc.Natl.Acad.Sci.USA98:6289-6294).Can realize by the following method DNA is incorporated into Rhodopseudomonas cell: electroporation (referring to, for example, Choi etc., 2006, J.Microbiol.Methods64:391-397) or engage (referring to, for example, Pinedo and Smets, 2005, Appl.Environ.Microbiol.71:51-57).Can realize by the following method DNA is incorporated into streptococcus cell: natural competence (natural competence) (referring to, for example, Perry and Kuramitsu, 1981, Infect.Immun.32:1295-1297), protoplast transformation (referring to, for example, Catt and Jollick, 1991, Microbios.68:189-207), electroporation (referring to, for example, Buckley etc., 1999, Appl.Environ.Microbiol.65:3800-3804) or engage (referring to, for example, Clewell, 1981, Microbiol.Rev.45:409-436).Yet, can use any method of DNA being introduced to host cell known in the art.

Host cell also can be eukaryote, as Mammals, insect, plant or fungal cell.

Host cell can be fungal cell." fungi " is used in and comprises herein with Xiamen: Ascomycota (Ascomycota), Basidiomycota (Basidiomycota), chytrid door (Chytridiomycota) and Zygomycota (Zygomycota) and oomycetes door (Oomycota) and all mitospore fungies (mitosporic fungi) are (as by Hawksworth etc., in Ainsworth and Bisby ' s Dictionary of The Fungi, the 8th edition, 1995, CAB International, University Press, Cambridge, defines in UK).

Fungal host cells can be yeast cell." yeast " is used in the yeast that comprises ascosporogenous yeast (ascosporogenous yeast) (Endomycetale (Endomycetales)), product load yeast (basidiosporogenous yeast) herein and belong to imperfect fungi (Fungi Imperfecti) (gemma guiding principle (Blastomycetes)).Owing to may changing in future that is sorted in of yeast, for the present invention, yeast is defined as to (the Skinner as Biology and Activities of Yeast, Passmore, compile Soc.App.Bacteriol.Symposium Series No.9,1980 with Davenport) described in.

Yeast host cell can be mycocandida, Hansenula (Hansenula), genus kluyveromyces, Pichia, yeast belong, Schizosaccharomyces or the mould genus cell of Western alpine yarrow, as Kluyveromyces lactis (Kluyveromyces lactis), saccharomyces carlsbergensis, yeast saccharomyces cerevisiae, saccharomyces diastaticus, Doug Laplace yeast, Crewe not yeast, promise ground yeast, ellipsoideus yeast or separate fat the West alpine yarrow mould (Yarrowia lipolytica) cell.

Fungal host cells can be filamentous fungal cells." filamentous fungus " comprise Mycophyta (Eumycota) and oomycetes door subphylum (as by Hawksworth etc., 1995, see above, define) all thread form.The common mycelia body wall being formed by chitin (chitin), Mierocrystalline cellulose, dextran, chitosan (chitosan), mannosans and other complicated polysaccharide that is characterised in that of filamentous fungus.By mycelia, extend into row and nourish and grow, and carbon katabolism is obligate aerobic.On the contrary, the yeast for example gemmation (budding) of nourishing and growing by unicellular thalline of yeast saccharomyces cerevisiae carries out, and carbon katabolism can be fermentable.

Filamentous fungal host cell can be a mould genus of top spore, Aspergillus, aureobasidium genus, the mould genus of smoke pipe (Bjerkandera), intend wax Pseudomonas, Chrysosporium, Coprinus (Coprinus), Coriolus Qu61 (Coriolus), genera cryptococcus, Filibasidium, fusarium, Humicola, Magnaporthe grisea belongs to, Mucor, myceliophthora, the mould genus of Xin Kaoma fat, Neurospora, paecilomyces, Penicillium, flat lead fungi belongs to (Phanerochaete), penetrate arteries and veins Pseudomonas (Phlebia), cud Chytridium, pleurotus (Pleurotus), Schizophyllum, Talaromyces, thermophilic ascomycete belongs to, the mould genus of shuttle spore, Tolypocladium, trametes (Trametes) or Trichoderma cell.

For example, filamentous fungal host cell can be Aspergillus awamori, Aspergillus fumigatus, smelly aspergillus, aspergillus japonicus, Aspergillus nidulans, aspergillus niger, aspergillus oryzae, black thorn smoke pipe bacterium (Bjerkandera adusta), dry plan wax bacterium (Ceriporiopsis aneirina), Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, worm is intended wax bacterium (Ceriporiopsis subvermispora), Chrysosporium inops, chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, felt gold pityrosporion ovale, Chrysosporium queenslandicum, chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus (Coprinus cinereus), hairy fungus (Coriolus hirsutus), bar spore shape sickle spore, F.graminearum schw, storehouse prestige sickle spore, machete sickle spore, fusarium graminaria, the red sickle spore of standing grain, different spore sickle spore, albizzia sickle spore, point sickle spore, racemosus sickle spore, pink sickle spore, Williams Elder Twig sickle spore, colour of skin sickle spore, intend branch spore sickle spore, sulphur look sickle spore, circle sickle spore, intend silk spore sickle spore, empiecement sickle spore, Humicola insolens, dredge cotton shape humicola lanuginosa, rice black wool is mould, thermophilic fungus destroyed wire, Neuraspora crassa, penicillium purpurogenum, the yellow flat lead fungi of spore (Phanerochaete chrysosporium), arteries and veins bacterium (Phlebia radiata) is penetrated in radiation, eryngo pick up the ears (Pleurotus eryngii), thermophilic capital spore, autochthonal shuttle spore is mould, long wool hair bolt bacterium (Trametes villosa), variable color bolt bacterium (Trametes versicolor), trichoderma harziarum, healthy and free from worry wood is mould, long shoot wood is mould, Trichodermareesei or viride cell.

Fungal cell can be transformed in known mode own by relating to the method for protoplastis formation, protoplast transformation and cell walls regeneration.The appropriate method that is used for transforming Aspergillus and Trichoderma host cell is at EP238023 and Yelton etc., and 1984, Proc.Natl.Acad.Sci.USA81:1470-1474 and Christensen etc., describe in 1988, Bio/Technology6:1419-1422.For the appropriate method that transforms fusarium bacterial classification, by Malardier etc., 1989, Gene78:147-156 and WO96/00787 describe.Can use the method transformed yeast by following document description: Becker and Guarente, in Abelson, J.N. and Simon, M.I. compiles, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume194, pp182-187, Academic Press, Inc., New York; Ito etc., 1983, J.Bacteriol.153:163; With Hinnen etc., 1978, Proc.Natl.Acad.Sci.USA75:1920.

Production method

The invention still further relates to the method for generation of polypeptide of the present invention, it comprises: (a) contributing to produce culturing cell under the condition of polypeptide, described cell produces described polypeptide with its wild-type form; Optionally (b) reclaims described polypeptide.In one aspect, described cell is that capital spore belongs to cell.In yet another aspect, described cell is thermophilic capital spore cell.In yet another aspect, described cell is Malbranchea cell.In yet another aspect, described cell is the mould cell of camphor tree suede branch.In yet another aspect, described cell is that excellent softgel shell belongs to cell.In yet another aspect, described cell is thermophilic excellent softgel shell cell.In yet another aspect, described cell is thermophilic excellent softgel shell CBS174.70 cell.In yet another aspect, described cell is Penicillium cell.In yet another aspect, described cell is penicillium oxalicum cell.

The invention still further relates to the method for generation of polypeptide of the present invention, it comprises: (a) cultivate recombinant host cell of the present invention contributing to produce under the condition of polypeptide; Optionally (b) reclaims described polypeptide.

Described host cell is used methods known in the art to cultivate in being suitable for producing the nutritional medium of described polypeptide.For example; can be by suitable culture medium and allow the shake-flask culture under the condition of expression and/or separated described polypeptide, or the small-scale in laboratory or industrial fermentation tank or large scale fermentation (comprise continuously, in batches, fed-batch or solid state fermentation) carry out culturing cell.Use methods known in the art to cultivate in suitable nutritional medium, described nutritional medium comprises Carbon and nitrogen sources and inorganic salt.Suitable substratum can obtain or can prepare (for example,, in the catalogue of American type culture collection) according to disclosed composition from commercial supplier.If polypeptide is secreted in nutritional medium, this polypeptide can directly reclaim from described substratum.If polypeptide is not secreted, it can reclaim from cell lysate (lysate).

Can detect polypeptide by the method for described polypeptid specificity known in the art.These detection methods include but not limited to use, the formation of enzyme product or the disappearance of enzyme substrates of specific antibody.For example, enzyme assay (enzyme assay) can be used for determining the activity of polypeptide.

Polypeptide can be used methods known in the art to reclaim.For example, polypeptide can reclaim by ordinary method from nutritional medium, described ordinary method includes but not limited to collect, centrifugal, filter, extract, spraying is dry, evaporation or precipitation.In one aspect, reclaimed the whole beer that comprises polypeptide of the present invention.

Polypeptide can be by multiple methods known in the art purifying to obtain substantially pure polypeptide, described method includes but not limited to that chromatography (for example, ion-exchange, affine, hydrophobic, chromatofocusing and size exclusion), electrophoresis method (for example, preparative (preparative) isoelectrofocusing), differential solubleness (for example, ammonium sulfate precipitation), SDS-PAGE or extraction (referring to, for example, Protein Purification, Janson and Ryden compile, VCH Publishers, New York, 1989).

In yet another aspect, do not reclaim polypeptide, but use, express the host cell of the present invention of described polypeptide as the source of described polypeptide.

Plant

The invention still further relates to separated plant, for example, transgenic plant, plant part or vegetable cell, it comprises polynucleotide of the present invention, thereby reaches and produce described polypeptide with callable scale.Polypeptide can reclaim from plant or plant part.Or, in statu quo (as such) by the plant that contains this polypeptide or plant part for improvement of food or quality of the fodder, for example, improve nutritive value, palatability (palatability) and rheological property (rheological properties), or for destroying antinutritional factor.

Transgenic plant can be dicots (dicotyledonss) or monocotyledonous (monocotyledons).Monocotyledonous example is grass (grasses), as English grass (meadow grass) (bluegrass (blue grass), Poa L. (Poa)); Forage grass (forage grass) is as festuca (Festuca), lolium (Lolium); Cold ground type herbage (temperate grass), as Agrostis (Bentgrass); And cereal, for example, wheat, oat, rye, barley, rice (rice), Chinese sorghum and Zea mays (maize) (corn).

The example of dicotyledons is tobacco (tobacco), beans (legumes), as lupine (lupins), potato, sugar beet (sugar beet), pea, (cruciferous) plant of beans (bean) and soybean (soybean) and Cruciferae (Cruciferae (family Brassicaceae)), as Cauliflower (cauliflower), Semen Brassicae campestris (rape seed) and the model organism Arabidopis thaliana (Arabidopsis thaliana) being closely related.

The example of plant part is stem (stem), callus (callus), leaf (leaf), root (root), fruit (fruit), seed (seed) and stem tuber (tuber), and the independent body that comprises these parts, for example, epidermis (epidermis), mesophyll (mesophyll), parenchyma (parenchyme), vascular tissue (vascular tissue), meristematic tissue (meristem).Concrete vegetable cell compartment (compartments), as chloroplast(id) (chloroplast), apoplast (apoplast), plastosome (mitochondria), vacuole (vacuole), peroxysome (peroxisome) and tenuigenin (cytoplasm) are also considered to plant part.In addition, any vegetable cell, whatsoever tissue-derived, be all considered to plant part.Similarly, plant part, as separated, be used for promoting that the concrete tissue of application of the present invention and cell are also considered to plant part, for example embryo (embryo), endosperm (endosperm), aleuron (aleurone) and kind skin (seed coat).

Be contained in equally the offspring who also has these plants, plant part and vegetable cell in the scope of the invention.

The transgenic plant of express polypeptide or vegetable cell can build according to means known in the art.In brief, build by the following method described plant or vegetable cell: one or more expression construct of coded polypeptide are imported to plant host genome or chloroplast gene group, and be transgenic plant or vegetable cell by the modified plant of gained or vegetable cell breeding.

Expression construct is the nucleic acid construct of the polynucleotide that comprise coded polypeptide expediently, described polynucleotide with in plant selecting or plant part, express the required suitable adjusting sequence of these polynucleotide and be operably connected.In addition, expression construct can comprise for the useful selected marker of plant identification cell, has integrated expression construct and this construct is incorporated into necessary DNA sequence dna in described plant (the latter depends on the DNA introducing method of use) in described vegetable cell.

Regulate the selection of sequence, for example promotor and terminator sequence and the optionally selection of signal or transit sequence, for instance, based on when, where expecting and express polypeptide and determining how.For example, the expression of the gene of coded polypeptide can be composing type or induction type, can be maybe growth, stage or tissue-specific, and can the target specific tissue of gene product or plant part be as seed or leaf.Regulate sequence by such as Tague etc., described in 1988, Plant Physiology86:506.

For constructive expression, can use 35S-CaMV, corn ubiquitin 1 or rice Actin muscle 1 promotor (Franck etc., 1980, Cell21:285-294, Christensen etc., 1992, Plant Mo.Biol.18:675-689; Zhang etc., 1991, Plant Cell3:1155-1165).Organ specific promoters can be for example for example, from storage tissue (storage sink tissue) seed, the promotor of potato tuber and fruit (Edwards and Coruzzi, 1990, Ann.Rev.Genet.24:275-303), or from metabolic pool tissue (metabolic sink tissue) such as merismatic promotor (Ito etc., 1994, Plant Mol.Biol.24:863-878), seed specific promoters is such as the gluten from rice (glutelin), prolamine (prolamin), sphaeroprotein (globulin) or albumin (albumin) promotor (Wu etc., 1998, Plant Cell Physiol.39:885-889), broad bean promotor (Conrad etc. from the unknown Seed Storage Protein gene of legumin (legumin) B4 and broad bean (Vicia faba), 1998, J.Plant Physiol.152:708-711), promotor (Chen etc. from seed oil body protein (oil body protein), 1998, Plant Cell Physiol.39:935-941), storage protein napA promotor from colea (Brassica napus), or the promotor of any other seed-specific well-known in the art, for example, described in WO91/14772.In addition, promotor can be the specific promotor of leaf, as the rbcs promotor (Kyozuka etc. from rice or tomato, 1993, Plant Physiol.102:991-1000), chlorella virus (chlorella virus) VITAMIN B4 methyltransgerase (adenine methyltransferase) gene promoter (Mitra and Higgins, 1994, Plant Mol.Biol.26:85-93), aldP gene promoter (Kagaya etc. from rice, 1995, Mol.Gen.Genet.248:668-674), or the promotor of wound induction, as potato pin2 promotor (Xu etc., 1993, Plant Mol.Biol.22:573-588).Similarly, described promotor can be induced by abiotic processing, described abiotic processing such as temperature, arid or salinity change, or the material of the described promotor of activation applying by external source is induced, for example ethanol, oestrogenic hormon (oestrogens), plant hormone (plant hormones) be as ethene, dormin (abscisic acid) and gibberic acid (gibberellic acid), and heavy metal.

Promotor enhancer element also can for realize polypeptide in plant compared with high expression level.For example, promotor enhancer element can be intron, and it is placed between promotor and the polynucleotide of coded polypeptide.Such as Xu etc., 1993, see above, disclose and used the First Intron of rice Actin muscle 1 gene to express to strengthen.

Any other parts of selected marker and expression construct can be selected from available those in this area.

Nucleic acid construct is imported to Plant Genome according to routine techniques known in the art, described routine techniques comprises that the conversion of Agrobacterium (Agrobacterium) mediation, virus-mediated conversion, microinjection (microinjection), particle bombardment, biological projectile transform and electroporation (Gasser etc., 1990, Science244:1293; Potrykus, 1990, Bio/Technology8:535; Shimamoto etc., 1989, Nature338:274).

The transgenosis (gene transfer) of Agrobacterium tumefaciens (Agrobacterium tumefaciens) mediation, it is a kind of generation transgenosis dicotyledons (its summary, referring to Hooykas and Schilperoort, 1992, Plant Mol.Biol.19:15-38), with the method for transforming monocots, although can use other method for transformation for these plants.A kind of monocotyledonous method of generation transgenosis is with particle (gold of the microcosmic applying with transfering DNA or tungsten particle) bombardment embryo callus (embryonic calli) or developmental embryo (developing embryos) (Christou, 1992, Plant J.2:275-281; Shimamoto, 1994, Curr.Opin.Biotechnol.5:158-162; Vasil etc., 1992, Bio/Technology10:667-674).A kind of alternative method of transforming monocots is based on protoplast transformation, and as by Omirulleh etc., 1993, Plant Mol.Biol.21:415-428 is described.Other method for transformation comprises and is described in U.S. Patent number 6,395, those (both are all incorporated to herein by carrying stating with its integral body) in 966 and 7,151,204.

After conversion, the transformant and the regeneration that according to method selection well known in the art, have the expression construct of importing become complete plant.Conventionally design method for transformation is for eliminating Select gene at regeneration period or in follow-up generation selectivity by the following method: for example, use with two independently T-DNA construct cotransformation or by specificity recombinase-site specific excise Select gene.

Except direct use construct of the present invention directly transforms concrete plant gene type, also can be by the plant with construct be prepared to transgenic plant with the second plant hybridization that lacks this construct.For example, the construct of coded polypeptide can be introduced to specified plant kind by hybridizing, and at all without directly transforming the plant of this given kind.Therefore, the present invention is not only contained from the plant of the cell Direct Regeneration through transforming according to the present invention, also comprises the offspring (progeny) of this type of plant.As for herein, offspring can refer to the descendant (offspring) of any generation of mother plant of preparing according to the present invention.This kind of offspring can comprise the DNA construct of preparing according to the present invention.Hybridization causes transgenosis to be passed through initial germline donor plant germline crossing pollination and introduced plant germline.The limiting examples of this type of step is described in U.S. Patent number 7,151,204.

Plant generates by the method for transformation that backcrosses.For example, this plant comprises the plant of genotype, germline, inbreeding body (inbred) or crossbred (hybrid) that being called backcrosses transforms.

Can use genetic marker to assist one or more transgenosiss of the present invention to infiltrate (introgression) to another from a genetic background gene.The selection that mark is assisted provides the advantage with respect to conventional breeding, is that it can be used for avoiding the mistake being caused by phenotypic variation.Further, genetic marker can provide the data of relevant breeding germplasm relative extent in the individual offspring of specific cross.For example, when this not (otherwise) there is the required genetic background of non-agronomy but there is the plant of required proterties and when breeding parent is hybridized, useful genetic marker selects not only to have objective trait, also has the offspring of the required germplasm of relatively large ratio.In this way, making one or more character genes infiltrate the required generation number of specific genetic background is minimized.

The present invention also relates to the method that produces polypeptide of the present invention, and it comprises: (a) cultivate transgenic plant or vegetable cell, the polynucleotide that described plant or vegetable cell comprise coded polypeptide contributing to produce under the condition of described polypeptide; Optionally (b) reclaims described polypeptide.

Remove or minimizing xylanase activity

The invention still further relates to the method for generation of parental cell mutant, it comprises polynucleotide or its part of destroying or lacking coding polypeptide of the present invention, when described method causes cultivating under the same conditions, the cell of comparing sudden change with parental cell produces less described polypeptide.

Can use method well known in the art (for example, insert, destroy, substitute or disappearance) to build mutant cells by reducing or eliminating the expression of polynucleotide.One preferred aspect, described polynucleotide are inactivations.Polynucleotide to be finished or inactivation can be, for example, coding region or its be to active crucial part, or express the required regulatory element in coding region.The example of this adjusting or regulating and controlling sequence can be promoter sequence or its funtion part,, is enough to affect the part that polynucleotide are expressed that is.Other regulating and controlling sequence for possible modification includes but not limited to leader sequence, polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator and transcription activator.

Can be by imposing mutagenesis to parental cell, and the mutant cell of selecting wherein the expression of polynucleotide have been reduced or eliminated carries out modification or the inactivation of polynucleotide.Mutagenesis may be specific or random, can be by for example using suitable physics or chemical mutagen to carry out, and by using suitable oligonucleotide to carry out, or by described DNA sequence dna being carried out to the mutagenesis of PCR generation.In addition, can carry out mutagenesis by any combination with these mutagenic compound.

Be suitable for the physics of the object of the invention or the example of chemical mutagen comprise ultraviolet ray (UV) irradiation, azanol, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulfonate (ethyl methane sulphonate) (EMS), sodium bisulfite, formic acid and nucleotide analog.

When using these reagent, conventionally carry out by the following method described mutagenesis: incubation parental cell to be mutagenic while there are selected mutagenic compound under conditions suitable, and screening and/or select shows that genetic expression reduces or without the mutant cells of genetic expression.

The modification of polynucleotide or inactivation also can transcribe or translate required controlling element by the one or more Nucleotide in insertion, replacement or missing gene or its and realize.For example, thereby can insert or remove Nucleotide, cause introducing terminator codon, remove initiator codon, or frame is opened in change.The mutagenesis producing by site-directed mutagenesis or PCR according to methods known in the art can realize this modification or inactivation.Although described in theory modification can be carried out in vivo, that is, directly on the cell of expressing polynucleotide to be finished, carry out, the face that is preferably as follows is exemplified carries out described modification like that in vitro.

The example of the convenient manner that elimination or minimizing polynucleotide are expressed has based on gene replacement, genetically deficient, or the technology of gene disruption.For example, in gene disruption method, the nucleotide sequence corresponding to endogenous polynucleotide is carried out to mutagenesis in vitro to produce the nucleotide sequence of defective, be then transformed in parental cell to produce dcc gene.By homologous recombination, described defective nucleotide sequence has substituted endogenous polynucleotide.May it is desirable to also coded markings of described defective polynucleotide, it can be used for selecting the transformant that wherein polynucleotide are modified or destroyed.In one aspect, with selectable mark (as described herein those), destroy described polynucleotide.

The present invention also relates in cell the method for the expression of the polypeptide that suppresses to have xylanase activity, and it comprises to cell uses or at cells double-stranded RNA (dsRNA) molecule, the subsequence that wherein said dsRNA comprises polynucleotide of the present invention.One preferred aspect, described dsRNA length is approximately 15,16,17,18,19,20,21,22,23,24,25 or more duplex Nucleotide.

Described dsRNA is preferably siRNA (siRNA) or microRNA (miRNA).One preferred aspect, described dsRNA is the siRNA for suppressing to transcribe.Another preferred aspect, described dsRNA be for suppress translation microRNA.

The present invention also relates to such double-stranded RNA (dsRNA) molecule, it comprises SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or a part for the mature polypeptide encoded sequence of SEQ ID NO:19, for the expression that suppresses described polypeptide in cell.Although the present invention is not subject to the restriction of any concrete mechanism of action, described dsRNA can enter cell and cause the single stranded RNA (ssRNA) of similar or identical sequence, comprises the degraded of endogenous mRNA.When cell is exposed to dsRNA, from homogenic mRNA, by being called RNA, disturb the process of (RNAi) to be subject to degradation selectivity.

DsRNA of the present invention can be used for gene silencing.In one aspect, the invention provides the method for using dsRNAi degradation selectivity RNA of the present invention.The method can be in vitro, implement in vitro or body.In one aspect, described dsRNA molecule is used in the sudden change that in cell, organ or animal, systematic function is lost.For the preparation of being as known in the art with using the method for dsRNA molecular selectivity degradation of rna, referring to, for example U.S. Patent number 6,489, and 127; 6,506,559; 6,511,824; With 6,515,109.

The invention further relates to the mutant cells of parental cell, the silence of the gene of the polynucleotide that it comprises coded polypeptide or the destruction of its regulating and controlling sequence or disappearance or coding said polypeptide, this causes comparing with parental cell mutant cells and produces polypeptide still less or do not produce polypeptide.

Polypeptide defective type mutant cell is natural particularly useful with host cell heterologous polypeptide as expressing.So, the invention further relates to the method for producing natural or heterologous polypeptide, it comprises: (a) cultivate mutant cell contributing to produce under the condition of polypeptide; (b) reclaim described polypeptide.It is not natural polypeptide that term " heterologous polypeptide " means host cell, for example, and the variant of native protein.Host cell can comprise the polynucleotide that surpass the described natural or heterologous polypeptide of the coding of a copy.

For cultivating with the method for the interested product of purifying and can being undertaken by methods known in the art.

The present invention is for example to make us especially interesting in the generation of enzyme for generation of the method for the product of essentially no xylanase activity at eucaryon polypeptide, particularly Fungal Protein.Zytase deficient cells also can be for expressing significant heterologous protein such as hormone, somatomedin, acceptor etc. in pharmacy.Term " eucaryon polypeptide " not only comprises natural polypeptides, also comprises by aminoacid replacement, disappearance or interpolation or other such modification and has been modified to strengthen the polypeptide of activity, thermostability, pH tolerance etc., for example enzyme.

In other respects, the present invention relates to the protein of essentially no xylanase activity, it produces by method of the present invention.

Fermented liquid formulation or cell composition

The present invention also relates to fermented liquid formulation and cell composition, and it comprises polypeptide of the present invention.Described fermented liquid product further comprises other composition for zymotechnique, cell (host cell that comprises the gene that contains the polypeptide of the present invention of encoding, it is for generation of interested polypeptide) for example, cell debris, biomass, fermention medium and/or tunning.In some embodiments, described composition is containing organic acid, to have killed the full nutrient solution of cell, the cell being killed and/or cell debris, and substratum.

Term " fermented liquid " produces, does not experience or only experience the recovery of minimum and/or the prepared product of purifying for this paper middle finger by cell fermentation.For example, saturated when microorganisms cultures is grown to, under the condition of restriction carbon, incubation, to allow albumen synthetic (for example, by host cell expression enzyme), and while being secreted into cell culture medium, produces fermented liquid.Described fermented liquid can contain the not classification of the fermented material obtaining when fermentation stops or the inclusion of classification.Typically, fermented liquid is unassorted, and comprises the substratum of using and cell debris that removal (for example, by centrifugal) microorganism cells (for example filamentous fungal cells) exists afterwards.In some embodiments, described fermented liquid is containing the cell culture medium of useful mistake, extracellular enzyme, and (the viable and/or nonviable) microorganism cells that can survive and/or can not survive.

In one embodiment, described fermented liquid formulation and cell composition comprise the first organic acid composition and the second organic acid composition, the organic acid that described the first organic acid composition comprises at least one 1-5 carbon and/or its salt, and organic acid and/or its salt that described the second organic acid composition comprises at least one 6 or more carbon.In a specific embodiments, described the first organic acid composition is acetic acid, formic acid, propionic acid, their salt, or aforementioned two or more mixture, and described the second organic acid composition is phenylformic acid, hexahydrobenzoic acid, 4-methylvaleric acid, toluylic acid, their salt, or aforementioned two or more mixture.

In one aspect, described composition contains organic acid, and optionally further contains cell and/or the cell debris being killed.In one embodiment, the cell being killed described in removing from kill the full nutrient solution of cell and/or cell debris are to provide not the composition containing these components.

Described fermented liquid formulation or cell composition can further comprise sanitas and/or antimicrobial (for example antibacterial) agent, include but not limited to sorbyl alcohol, sodium-chlor, potassium sorbate and other is as known in the art.

Described fermented liquid formulation or cell composition can further comprise plurality of enzymes activity, for example, as one or more (several) are selected from the enzyme of lower group: cellulase, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.Described fermented liquid formulation or cell composition also can comprise one or more (for example several) and be selected from the enzyme of lower group: lytic enzyme, isomerase, ligase enzyme, lyase, oxygen is enzyme or transferring enzyme also, alpha-galactosidase for example, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase enzymes, beta-glucosidase enzyme, xylobiase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, at, Maltose 4-glucosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, saccharase, laccase, lipase, mannosidase, become glycanase, oxydase, pectin decomposing enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic ferment, rnase, trans-glutaminases or zytase.

The described full nutrient solution of cell or the not classification inclusion that composition can contain the fermented material obtaining when fermentation stops killed.Typically, the described full nutrient solution of having killed cell or composition contain microorganism cells (for example filamentous fungal cells) are being grown to saturated, and for example, there is afterwards to allow albumen to synthesize (, expressing cellulase and Polyglucosidase) substratum and the cell debris of using in incubation under the condition of restriction carbon.In some embodiments, the described full nutrient solution of cell or the cell culture medium that composition contains useful mistake, the extracellular enzyme, and the filamentous fungal cells being killed killed.In some embodiments, the microorganism cells existing in killing the full nutrient solution of cell or composition can be used method osmotic as known in the art and/or cracking.

Full nutrient solution or cell composition are generally liquid as described herein, but can contain insoluble component, as the cell being killed, cell debris, nutrient media components and/or insoluble enzyme.In some embodiments, can remove insoluble component so that the liquid composition of clarification to be provided.

Full nutrient solution formulation of the present invention and cell composition can produce by the method for describing in WO90/15861 or WO2010/096673.

Below provided the embodiment of the preferable use of composition of the present invention.Other condition that the dosage of described composition and composition are used can be determined based on means known in the art.

Enzyme composition

The invention still further relates to the composition that comprises polypeptide of the present invention.Preferably, described composition enrichment this peptide species.Term " enrichment " shows that the endoglucanase activity of described composition increases with for example at least 1.1 enrichment factor.

Described composition for example can comprise polypeptide of the present invention, as Major Enzymes component, single-component composition.Or, described composition can comprise plurality of enzymes activity, as is selected from one or more (for example several) enzymes of lower group: cellulase, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.Described composition also can comprise one or more (for example several) and be selected from the enzyme of lower group: lytic enzyme, isomerase, ligase enzyme, lyase, oxygen is enzyme or transferring enzyme also, alpha-galactosidase for example, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase enzymes, beta-glucosidase enzyme, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, at, Maltose 4-glucosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, saccharase, laccase, lipase, mannosidase, become glycanase, oxydase, pectin decomposing enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic ferment, rnase, trans-glutaminases, or zytase.Described composition can be prepared according to method as known in the art, and can be the form of liquid or dry composition.Described composition can be according to method stabilization as known in the art.

Hereinafter provide the example of the preferable use of composition of the present invention.Other condition that the dosage of composition and composition are used can give methods known in the art and determine.

Purposes

The invention still further relates to the technique that following use has polypeptide or its composition of xylanase activity.

The invention still further relates to degradation of fibers cellulosic material or containing the method for xylan material, it comprises: under the existence of the polypeptide with xylanase activity of the present invention, with enzyme composition, process cellulose materials or containing xylan material.In one aspect, described technique further comprises that recovery has been degraded or the cellulose materials that transforms or containing xylan material.Described cellulose materials or containing the degraded of xylan material or the soluble product of conversion can with insoluble fibre cellulosic material or separated containing xylan materials'use methods known in the art, as for example centrifugal, filtration or gravity settling.

The invention still further relates to the technique that produces tunning, it comprises: (a) under the existence of the polypeptide with xylanase activity of the present invention, by enzyme composition diastatic fiber cellulosic material or containing xylan material; (b) with the fermentation of one or more (for example several) organism of fermentation through the cellulose materials of saccharification or containing xylan material to produce tunning; (c) from fermentation, reclaim tunning.

The invention still further relates to fermented cellulose material or containing the technique of xylan material, it comprises: for example, with one or more (several) organism of fermentation fermented cellulose materials or containing xylan material, and wherein said cellulose materials or be with enzyme composition saccharification under the existence of the polypeptide with xylanase activity of the present invention containing xylan material.In one aspect, cellulose materials or produce tunning containing the fermentation of xylan material.In yet another aspect, described technique also comprises from fermentation recovery tunning.

Technique of the present invention can be for becoming fermentable sugars by cellulose materials or containing the saccharification of xylan material, and fermentable sugars is changed into a lot of useful tunnings, such as fuel, drinking alcohol and/or platform chemicals (platform chemical) (such as acid, alcohol, ketone, gas etc.).From cellulose materials or containing the tunning of xylan material production expectation, be usually directed to pre-treatment, enzymic hydrolysis (saccharification) and fermentation.

According to cellulose materials of the present invention or containing the processing of xylan material, can use the ordinary method of this area to complete.In addition, technique of the present invention can be used any conventional biomass processing equipment being configured to according to invention operation to carry out.

Hydrolysis (saccharification) and fermentation, minute other or simultaneously, include but not limited to, hydrolysis and the common fermentation (HHCF) of separated hydrolysis and fermentation (SHF), synchronous glycosylation and fermentation (SSF), synchronous glycosylation and common fermentation (SSCF), the hydrolysis that mixes and fermentation (HHF), separated hydrolysis and common fermentation (SHCF), mixing, with direct microbial transformation (DMC), sometimes also referred to as associating biological processing (consolidated bioprocessing, CBP).First SHF is used separated treatment step take is fermentable sugars by enzymatic hydrolysis of cellulosic material, for example, glucose, cellobiose and pentose monomer, then become ethanol by fermentable sugars fermentation.In SSF, the fermentation that the enzymic hydrolysis of cellulose materials and sugar become ethanol is combined in (Philippidis, G.P., 1996 in a step, Cellulose bioconversion technology, in Handbook on Bioethanol:Production and Utilization, Wyman, C.E compiles, Taylor & Francis, Washington, DC, 179-212).SSCF comprises the common fermentation (Sheehan of multiple sugar, J. and Himmel, M., 1999, Enzymes, energy and the environment:A strategic perspective on the U.S.Department of Energy ' s research and development activities for bioethanol, Biotechnol.Prog.15:817-827).HHF outside saccharification and hydrolysing step, also comprises independent hydrolysing step at the same time, and described each step can be carried out in same reactor.Step in HHF process can be carried out in different temperature, that is, the saccharification of high temperature enzyme process, the lesser temps that then can tolerate at fermentation strain carries out SSF.DMC for example, has combined all three processes (enzyme produces, is hydrolyzed and fermentation) in one or more (several) step, wherein use identical organism to produce for cellulose materials being changed into fermentable sugars and fermentable sugars being changed into enzyme (the Lynd L.R. of end product, Weimer, P.J., van Zyl, W.H., and Pretorius, I.S., 2002, Microbial cellulose utilization:Fundamentals and biotechnology, Microbiol.Mol.Biol.Reviews66:506-577).Herein, be understandable that, any method as known in the art, comprises pre-treatment, enzymic hydrolysis (saccharification), fermentation, or their combination, all can be used for implementing technique of the present invention.

Conventional equipment can comprise fed-batch formula stirred reactor, batch-type stirred reactor, have Continuous Flow stirred reactor and/or continuous piston flow column reactor (the Fernanda de Castilhos Corazza of ultrafiltration, Fl á vio Faria de Moraes, Gisella Maria Zanin and Ivo Neitzel, 2003, Optimal control in fed-batch reactor for the cellobiose hydrolysis, Acta Scientiarum.Technology25:33-38, Gusakov, A.V. and Sinitsyn, A.P., 1985, Kinetics of the enzymatic hydrolysis of cellulose:1.A mathematical model for a batch reactor process, Enz.Microb.Technol.7:346-352), griding reaction device (Ryu, S.K. and Lee, J.M., 1983, Bioconversion of waste cellulose by using an attrition bioreactor, Biotechnol.Bioeng.25:53-65), or there is the intensively stirred reactor (Gusakov being caused by electromagnetic field, A.V., Sinitsyn, A.P., Davydkin, I.Y., Davydkin, V.Y., Protas, O.V., 1996, Enhancement of enzymatic cellulose hydrolysis using a novel type of bioreactor with intensive stirring induced by electromagnetic field, Appl.Biochem.Biotechnol.56:141-153).Other type of reactor comprises: fluidized-bed, up-flow layer (upflow blanket), immobilization and the reactor of extruding type for being hydrolyzed and/or fermenting.

pre-treatment.In the enforcement of technique of the present invention, can use any preprocessing process known in the art destroy the cellulose materials of plant cell wall or contain xylan material component (Chandra etc., 2007, Substrate pretreatment:The key to effective enzymatic hydrolysis of lignocellulosics? Adv.Biochem.Engin./Biotechnol.108:67-93; Galbe and Zacchi, 2007, Pretreatment of lignocellulosic materials for efficient bioethanol production, Adv.Biochem.Engin./Biotechnol.108:41-65; Hendriks and Zeeman, 2009, Pretreatments to enhance the digestibility of lignocellulosic biomass, Bioresource Technol.100:10-18; Mosier etc., 2005, Features of promising technologies for pretreatment of lignocellulosic biomass, Bioresource Technol.96:673-686; Taherzadeh and Karimi, 2008, Pretreatment of lignocellulosic wastes to improve ethanol and biogas production:A review, Int.J.of Mol.Sci.9:1621-1651; Yang and Wyman, 2008, Pretreatment:the key to unlocking low-cost cellulosic ethanol, Biofuels Bioproducts and Biorefining-Biofpr.2:26-40).

Cellulose materials or also can use method as known in the art to carry out particle size reduction, screening, pre-soaking, wetting, washing and/or conditioning (conditioning) before pre-treatment containing xylan material.

Conventional pre-treatment includes but not limited to, steam pre-treatment (following or do not follow explosion), dilute acid pretreatment, hot-water pretreatment, alkali pre-treatment, Calx preconditioning, wet oxidation, wet explosion, the explosion of ammonia fiber, organic solvent pre-treatment and Biological Pretreatment.Other pre-treatment comprises ammonia diafiltration, ultrasonic, electroporation, microwave, supercritical CO ₂, overcritical H ₂o, ozone, ionic liquid and gamma-radiation pre-treatment.

Can be before hydrolysis and/or fermentation pretreatment of fiber cellulosic material or containing xylan material.Pre-treatment is preferably carried out before hydrolysis.Or pre-treatment can carry out discharging fermentable sugars with enzymic hydrolysis, as glucose, wood sugar and/or cellobiose simultaneously.In most of the cases, pre-treatment step itself makes some Wood Adhesives from Biomass become fermentable sugars (even in the situation that not there is not enzyme).

Steam pre-treatment.In steam pre-treatment, heat cellulose materials or contain xylan material to destroy plant cell wall composition, comprise xylogen, hemicellulose and Mierocrystalline cellulose, make Mierocrystalline cellulose and other fraction, for example hemicellulose, can be touched by enzyme.By cellulose materials or containing xylan material process or by reaction vessel, the temperature and pressure that wherein injecting steam extremely needs to increase temperature, and the reaction times of maintenance expectation therein.Steam pre-treatment is preferably at 140-250 ℃, and for example 160-200 ℃, or 170-190 ℃ is carried out, and wherein optimum temperature range depends on the interpolation of chemical catalyst.The preferred 1-60 minute of the residence time of steam pre-treatment, 1-30 minute for example, 1-20 minute, 3-12 minute, or 4-10 minute, wherein the optimum residence time depends on the interpolation of temperature range and chemical catalyst.Steam pre-treatment allows relatively high solid substance heap(ed) capacity, to such an extent as to cellulose materials or mostly just become moist containing xylan material in preprocessing process.Steam pre-treatment often combines with the explosion blowing (explosive discharge) of pretreated material, this is called steam explosion,, flickering is to the turbulent flow of normal atmosphere and material fast, with surface-area (Duff and the Murray that can contact by broken increase, 1996, Bioresource Technology855:1-33; Galbe and Zacchi, 2002, Appl.Microbiol.Biotechnol.59:618-628; U.S. Patent application No.20020164730).In steam pre-treatment process, hemicellulose acetyl group is cut open, and the sour autocatalysis hemicellulose partial hydrolysis obtaining becomes monose and oligosaccharides.Xylogen is only removed with limited degree.

Chemical Pretreatment: term " chemical treatment " refers to promote any chemical treatment of Mierocrystalline cellulose, hemicellulose and/or lignin separation and/or release.This kind of pre-treatment can be converted into amorphous cellulose by crystal fibre element.The example of suitable Chemical Pretreatment technique comprises for example dilute acid pretreatment, Calx preconditioning, wet oxidation, ammonia fiber/freezing explosion (AFEX), ammonia diafiltration (APR), ionic liquid and organic solvent pre-treatment.

Before the steam pre-treatment of being everlasting, add catalyzer as H ₂sO ₄or SO ₂(common 0.3 to 5%w/w), it can reduce the time, reduces temperature, increases the rate of recovery, and improves enzymic hydrolysis (Ballesteros etc., 2006, Appl.Biochem.Biotechnol.129-132:496-508; Varga etc., 2004, Appl.Biochem.Biotechnol.113-116:509-523; Sassner etc., 2006, Enzyme Microb.Technol.39:756-762).In dilute acid pretreatment, by cellulose materials or containing xylan material and diluted acid (H normally ₂sO ₄) and water mix to form slurry, by the temperature that is steam heated to expectation, and after one period of residence time flickering to normal atmosphere.Can carry out dilute acid pretreatment by a lot of reactor design forms, for example, plug flow reactor, counter-current reactor or continuous countercurrent shrink bed bioreactor (Duff and Murray, 1996, supra; Schell etc., 2004, Bioresource Technol.91:179-188; Lee etc., 1999, Adv.Biochem.Eng.Biotechnol.65:93-115).

Can also use several pretreatment processs under alkaline condition.These alkali pre-treatment include, but not limited to sodium hydroxide, lime, wet oxidation, ammonia diafiltration (APR) and ammonia fiber/freezing explosion (AFEX).

With calcium oxide or calcium hydroxide, the temperature of 85-150 ℃, carry out Calx preconditioning, the residence time was from 1 hour to several days (Wyman etc., 2005, Bioresource Technol.96:1959-1966; Mosier etc., 2005, Bioresource Technol.96:673-686).WO2006/110891, WO2006/110899, WO2006/110900 and WO2006/110901 disclose the pretreatment process that uses ammonia.

Wet oxidation is a kind of hot pre-treatment, conventionally at 180-200 ℃, carries out 5-15 minute, adds oxygenant as hydrogen peroxide or overvoltage oxygen (Schmidt and Thomsen, 1998, Bioresource Technol.64:139-151; Palonen etc., 2004, Appl.Biochem.Biotechnol.117:1-17; Varga etc., 2004, Biotechnol.Bioeng.88:567-574; Martin etc., 2006, J.Chem.Technol.Biotechnol.81:1669-1677).Pre-treatment is with preferred 1-40% dry-matter, and for example 2-30% dry-matter, or 5-20% dry-matter carries out, and often by add alkali as sodium carbonate increases initial pH.

The amending method of wet oxidation pretreatment process, is called wet explosion (combination of wet oxidation and steam explosion), can process the dry-matter up to 30%.In wet explosion, in preprocessing process, after certain residence time, introduce oxygenant.Then by flickering to normal atmosphere, finish pre-treatment (WO2006/032282).

Ammonia fiber explosion (AFEX) relates in moderate temperature if 90-150 ℃ and high pressure are as 17-20bar, with liquefied ammonia or ammonia by cellulose materials or containing xylan material processing 5-10 minute, wherein dry matter content can be up to 60% (Gollapalli etc., 2002, Appl.Biochem.Biotechnol.98:23-35; Chundawat etc., 2007, Biotechnol.Bioeng.96:219-231; Alizadeh etc., 2005, Appl.Biochem.Biotechnol.121:1133-1141; Teymouri etc., 2005, Bioresource Technol.96:2014-2018).In AFEX preprocessing process, Mierocrystalline cellulose keeps relative complete with hemicellulose.Xylogen-saccharide complex is cut open.

Organic solvent pre-treatment is by using aqueous ethanol (40-60% ethanol) 160-200 ℃ of extraction 30-60 minute and by cellulose materials or containing xylan material delignification (Pan etc., 2005, Biotechnol.Bioeng.90:473-481; Pan etc., 2006, Biotechnol.Bioeng.94:851-861; Kurabi etc., 2005, Appl.Biochem.Biotechnol.121:219-230).Often add sulfuric acid as catalyzer.In organic solvent pre-treatment, most of hemicellulose and xylogen are removed.

Other examples of suitable pretreatment process are as Schell etc., 2003, Appl.Biochem and Biotechn.Vol.105-108:69-85, with Mosier etc., 2005, Bioresource Technology96:673-686, and the U.S. openly applies for described in 2002/0164730.

In one aspect, Chemical Pretreatment is preferably as dilute acid pretreatment, and more preferably the continuous dilute acid pretreatment of conduct carries out.Acid is sulfuric acid normally, but also can use other acid, as acetic acid, citric acid, nitric acid, phosphoric acid, tartrate, succsinic acid, hydrogenchloride or its mixture.Weak acid (mild acid) is processed at preferred 1-5, and the pH scope of for example 1-4, or 1-2.5 is carried out.In one aspect, acid concentration for example, in preferably 0.01 to 10wt% acid, the scope of 0.05 to 5wt% acid or 0.1 to 2wt% acid.Acid is contacted with cellulose materials or containing xylan material, and at preferred 140-200 ℃, for example the temperature of 165-190 ℃ of scope keeps the time of 1 to 60 minute.

In yet another aspect, pre-treatment occurs in aqueous slurry.Aspect preferred, in preprocessing process cellulose materials or containing xylan material with preferred 10-80wt%, for example 20-70wt% or 30-60wt%, the amount of 40wt% exists according to appointment.Pretreated cellulose materials or can not wash or use this area any known method washing containing xylan material, for example, washes with water.

Mechanical pretreatment or physics pre-treatment: term " mechanical pretreatment " or " physics pre-treatment " refer to the pre-treatment that any promotion granular size reduces.For example, this kind of pre-treatment can relate to various types of grindings (grinding) or grind (milling) (for example, dry grinding, wet-milling or vibratory milling).

Cellulose materials or containing xylan material can through physics (machinery) and Chemical Pretreatment the two.Machinery or physics pre-treatment can with following coupling: decatize/steam explosion, aquathermolysis (hydrothermolysis), diluted acid or weak acid processing, high temperature, autoclaving, radiation (for example microwave radiation), or its combination.In one aspect, high end finger is preferably approximately 100 to about 400psi, for example the pressure of approximately 150 scopes to about 250psi.In yet another aspect, high temperature refers to approximately 100 to 300 ℃, for example the temperature of approximately 140 to approximately 200 ℃ of scopes.One preferred aspect, machinery or physics pre-treatment utilize in use in the batchwise process of the vapor gun hydrolyzer system of high temperature and high pressure (for example, from Sunds Defibrator AB, the Sunds Hydrolyzer of Sweden) as defined above to be carried out.Described physics and chemistry pre-treatment can optionally sequentially be carried out or carry out simultaneously.

Therefore, one preferred aspect, to cellulose materials or containing xylan material, carry out physics (machinery) or Chemical Pretreatment, or their any combination, to promote the separated of Mierocrystalline cellulose, hemicellulose and/or xylogen and/or to discharge.

Biological Pretreatment: term " Biological Pretreatment " refers to promote Mierocrystalline cellulose, hemicellulose and/or xylogen from cellulose materials or containing any Biological Pretreatment of xylan material separation and/or release.Biological Pretreatment Techniques can comprise apply the microorganism of dissolved lignin and/or enzyme (referring to, for example, Hsu, T.-A., 1996, Pretreatment of biomass, in Handbook on Bioethanol:Production and Utilization, Wyman, C.E compiles, Taylor & Francis, Washington, DC, 179-212; Ghosh and Singh, 1993, Physicochemical and biological treatments for enzymatic/microbial conversion of lignocellulosic biomass, Adv.Appl.Microbiol.39:295-333; McMillan, J.D., 1994, Pretreating lignocellulosic biomass:a review, in Enzymatic Conversion of Biomass for Fuels Production, Himmel, M.E., Baker, J.O., and Overend, R.P., compiles, ACS Symposium Series566, American Chemical Society, Washington, DC, the 15th chapter; Gong, C.S., Cao, N.J., Du, J., and Tsao, G.T., 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering/Biotechnology, Scheper, T., compile Springer-Verlag Berlin Heidelberg, Germany, 65:207-241; Olsson and Hahn-Hagerdal, 1996, Fermentation of lignocellulosic hydrolysates for ethanol production, Enz.Microb.Tech.18:312-331; With Vallander and Eriksson, 1990, Production of ethanol from lignocellulosic materials:State of the art, Adv.Biochem.Eng./Biotechnol.42:63-95).

saccharification.In hydrolysing step, by cellulose materials or containing xylan material, for example pretreated cellulose materials or containing xylan material hydrolysis so that Mierocrystalline cellulose and hemicellulose are resolved into fermentable sugars, as glucose, cellobiose, wood sugar, xylulose, pectinose, seminose, semi-lactosi and/or soluble oligosaccharides.Hydrolysis utilizes enzyme composition in the present invention, to have under the existence of polypeptide of xylanase activity enzymatic as described herein to carry out.The enzyme component of composition can also add simultaneously or sequentially.

Enzymic hydrolysis preferably, under the condition of easily being determined by those skilled in the art, is carried out in suitable aqueous environment.In one aspect, hydrolysis is in the activity that is suitable for enzyme component, for carrying out under enzyme component optimal conditions.Hydrolysis can be carried out with fed-batch or continuous process, in successive processes, by cellulose materials or containing xylan material, fills into gradually, for example, fills in the hydrating solution containing enzyme.

Saccharification is carried out conventionally in stirred-tank reactor or fermentor tank under controlled pH, temperature and mixing condition.Suitable treatment time, temperature and pH condition can easily be determined by those skilled in the art.For example, saccharification is sustainable reaches 200 hours, but conventionally carries out preferably approximately 12 to approximately 120 hours, and for example approximately 16 to approximately 72 hours, or approximately 24 to approximately 48 hours.Temperature is at preferably approximately 25 ℃ to approximately 70 ℃, and for example approximately 30 ℃ to approximately 65 ℃, approximately 40 ℃ to approximately 60 ℃, or the scope of approximately 50 ℃ to 55 ℃.PH is preferably approximately 3 to approximately 8, and for example approximately 3.5 to approximately 7, approximately 4 to approximately 6, or approximately 5.0 to approximately 5.5 scope.Dry solid content is preferred approximately 5 to about 50wt%, and for example approximately 10 to about 40wt%, or approximately 20 scopes to about 30wt%.

Enzyme composition can comprise any albumen that can be used for degradation of fibers cellulosic material or contain xylan material.

In one aspect, described enzyme composition comprises or also comprises one or more (for example several) and is selected from the albumen of lower group: cellulase, have the GH61 polypeptide of cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.In yet another aspect, described cellulase for example, is selected from the enzyme of lower group for preferred one or more (several): endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.In yet another aspect, described hemicellulase for example, is selected from the enzyme of lower group for preferred one or more (several): acetyl mannan esterase, acetyl xylan esterase, arabanase, arabinofuranosidase, coumaric acid esterase, feruloyl esterase, tilactase, glucuronidase, glucuronic acid esterase, mannonase mannosidase, zytase and xylosidase.

In yet another aspect, described enzyme composition comprises one or more (for example several) cellulolytic enzymes.In yet another aspect, described enzyme composition comprises or further comprises one or more (for example several) hemicellulose lytic enzymes.In yet another aspect, described enzyme composition comprises one or more (for example several) cellulolytic enzymes and one or more (for example several) hemicellulose lytic enzymes.In yet another aspect, described enzyme composition comprises one or more (for example several) and is selected from the enzyme of lower group: cellulolytic enzyme and hemicellulose lytic enzyme.In yet another aspect, described enzyme composition comprises endoglucanase.In yet another aspect, described enzyme composition comprises cellobiohydrolase.In yet another aspect, described enzyme composition comprises beta-glucosidase enzyme.In yet another aspect, described enzyme composition comprises the polypeptide with cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises endoglucanase and the polypeptide with cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises cellobiohydrolase and the polypeptide with cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises beta-glucosidase enzyme and the polypeptide with cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises endoglucanase and cellobiohydrolase.In yet another aspect, described enzyme composition comprises endoglucanase and beta-glucosidase enzyme.In yet another aspect, described enzyme composition comprises cellobiohydrolase and beta-glucosidase enzyme.In yet another aspect, described enzyme composition comprises endoglucanase, cellobiohydrolase and has the polypeptide of cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises endoglucanase, beta-glucosidase enzyme and has the polypeptide of cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises cellobiohydrolase, beta-glucosidase enzyme and has the polypeptide of cellulolytic enhancing activity.In yet another aspect, described enzyme composition comprises endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.In yet another aspect, described enzyme composition comprises endoglucanase, cellobiohydrolase, beta-glucosidase enzyme and has the polypeptide of cellulolytic enhancing activity.

In yet another aspect, described enzyme composition comprises acetyl mannan esterase.In yet another aspect, described enzyme composition comprises acetyl xylan esterase.In yet another aspect, described enzyme composition comprises arabanase (for example α-L-arabanase).In yet another aspect, described enzyme composition comprises arabinofuranosidase (for example α-l-arabfuranglycosidase).In yet another aspect, described enzyme composition comprises coumaric acid esterase.In yet another aspect, described enzyme composition comprises feruloyl esterase.In yet another aspect, described enzyme composition comprises tilactase (for example alpha-galactosidase and/or beta-galactosidase enzymes).In yet another aspect, described enzyme composition comprises glucuronidase (for example α-D-glucuronidase).In yet another aspect, described enzyme composition comprises glucuronic acid esterase.In yet another aspect, described enzyme composition comprises mannase.In yet another aspect, described enzyme composition comprises mannosidase (for example beta-Mannosidase).In yet another aspect, described enzyme composition comprises zytase.One preferred aspect, described zytase is family's 10 zytases.In yet another aspect, described enzyme composition comprises xylosidase (for example xylobiase).

In yet another aspect, described enzyme composition comprises esterase.In yet another aspect, described enzyme composition comprises claviformin.In yet another aspect, described enzyme composition comprises laccase.In yet another aspect, described enzyme composition comprises lignin decomposition enzyme.Another preferred aspect, described lignin decomposition enzyme is manganese peroxidase.Another preferred aspect, described lignin decomposition enzyme is lignin peroxidase.Another preferred aspect, described lignin decomposition enzyme produces H ₂o ₂enzyme.In yet another aspect, described enzyme composition comprises polygalacturonase.In yet another aspect, described enzyme composition comprises peroxidase.In yet another aspect, described enzyme composition comprises proteolytic enzyme.In yet another aspect, described enzyme composition comprises swollenin.

In technique of the present invention, enzyme can be in saccharification, saccharification and fermentation, or add before fermentation or in process.

One or more of described enzyme composition (for example several) component can be the combination of wild-type protein, recombinant protein or wild-type protein and recombinant protein.For example, one or more (for example several) components can be the native protein of cell, and it is one or more (for example several) other components with recombinant expressed enzyme composition as host cell.One or more (for example several) components of enzyme composition can be produced as independent component, then be combined to form enzyme composition.Described enzyme composition can be the combination of polycomponent and single component albumen prepared product.

For the enzyme of technique of the present invention, can be any applicable form, fermented liquid formulation for example, cell composition, containing or not containing the cell pyrolysis liquid of cell debris, the enzyme prepared product of half purifying or purifying, or as the host cell in the source of enzyme.Described enzyme composition can be dry powder or particle, non-dusting particle, liquid, the shielded enzyme of stabilization liquid or stabilization.Liquid enzymes prepared product can be according to the technique of establishing, and for example, by adding stablizer as sugar, sugar alcohol or other polyvalent alcohols, and/or lactic acid or other organic acids carry out stabilization.

There is the enzyme of xylanase activity and the optimal dose of polypeptide depends on several factors, it includes but not limited to, the mixture of cellulose decomposition and/or hemicellulose lytic enzyme component, cellulose materials or containing xylan material, cellulose materials or containing the concentration of xylan material, cellulose materials or for example, containing pre-treatment, temperature, time, the pH of xylan material with comprise fermenting organism body (, the yeast of synchronous glycosylation and fermentation).

In one aspect, cellulolytic enzyme or hemicellulose lytic enzyme are approximately 0.5 to about 50mg for cellulose materials or containing the significant quantity of xylan material, for example approximately 0.5 to about 40mg, approximately 0.5 to about 25mg, approximately 0.75 to about 20mg, approximately 0.75 to about 15mg, and approximately 0.5 to about 10mg, or approximately 2.5 to about 10mg every g cellulose materialss or containing xylan material.

In yet another aspect, the polypeptide with xylanase activity is approximately 0.01 to about 50.0mg for cellulose materials or containing the significant quantity of xylan material, and for example approximately 0.01 to about 40mg, approximately 0.01 to about 30mg, approximately 0.01 to about 20mg, and approximately 0.01 to about 10mg, and approximately 0.01 to about 5mg, approximately 0.025 to about 1.5mg, approximately 0.05 to about 1.25mg, and approximately 0.075 to about 1.25mg, and approximately 0.1 to about 1.25mg, approximately 0.15 to about 1.25mg, or approximately 0.25 to about 1.0mg every g cellulose materials or containing xylan material.

In yet another aspect, the polypeptide with xylanase activity is approximately 0.005 to about 1.0g for the significant quantity of cellulolytic enzyme or hemicellulose lytic enzyme, for example approximately 0.01 to about 1.0g, approximately 0.15 to about 0.75g, approximately 0.15 to about 0.5g, approximately 0.1 to about 0.5g, and approximately 0.1 to about 0.25g, or approximately 0.05 to about 0.2g every g cellulolytic enzyme or hemicellulose lytic enzyme.

The polypeptide with cellulose decomposition enzymic activity or hemicellulose lytic enzyme activity, and other protein/polypeptide that can be used for cellulose materials or contain the degraded of xylan material, the GH61 polypeptide (being referred to as in this article " polypeptide with enzymic activity ") for example with cellulolytic enhancing activity can be derived from or obtain from any suitable source, comprises bacterium, fungi, yeast, plant or Mammals source.Term " acquisition " also means in this article this enzyme and can in host living beings, use described method restructuring to produce herein, the enzyme wherein producing through restructuring is natural or external source for host living beings, or there is the aminoacid sequence of modification, for example, the amino acid that there is one or more (for example several) disappearance, inserts and/or replace, the enzyme that restructuring produces, it is fragment and/or mutant or the enzyme producing by amino acid Shuffling Method known in the art of natural acid sequence.What in the implication of natural enzyme, contain is natural variant, and what in the implication of external enzyme, contain is the variant that restructuring (as by site-directed mutagenesis or rearrangement) obtains.

The polypeptide with enzymic activity can be bacterial peptide.For example, described polypeptide can be that gram positive bacterium polypeptide is as bacillus (Bacillus), streptococcus (Streptococcus), streptomyces (Streptomyces), Staphylococcus (Staphylococcus), enterococcus spp (Enterococcus), lactobacillus (Lactobacillus), lactococcus (Lactococcus), fusobacterium (Clostridium), ground bacillus belongs to (Geobacillus), pyrolysis Mierocrystalline cellulose Pseudomonas (Caldicellulosiruptor), hot acid Pseudomonas (Acidothermus), Thermobifidia or bacillus marinus belong to (Oceanobacillus) polypeptide, described polypeptide has enzymic activity, or gram negative bacterium polypeptide, as intestinal bacteria, Rhodopseudomonas (Pseudomonas), salmonella (Salmonella), campylobacter (Campylobacter), Helicobacterium (Helicobacter), Flavobacterium (Flavobacterium), Fusobacterium (Fusobacterium), mud Bacillaceae (Ilyobacter), eisseria (Neisseria) or Ureaplasma (Ureaplasma) polypeptide, described polypeptide has enzymic activity.

In one aspect, described polypeptide is Alkaliphilic bacillus, bacillus amyloliquefaciens, bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, bacillus firmus, bacillus lautus, bacillus lentus, Bacillus licheniformis, bacillus megaterium, bacillus pumilus, bacstearothermophilus, subtilis or the bacillus thuringiensis polypeptide with enzymic activity.

Another preferred aspect, described polypeptide is streptococcus equisimilis, streptococcus pyogenes, streptococcus uberis or the streptococcus equi beast pest subspecies polypeptide with enzymic activity.

Another preferred aspect, described polypeptide be there is enzymic activity do not produce look streptomycete, deinsectization streptomycete, sky blue streptomycete, streptomyces griseus or shallow Streptomyces glaucoviolaceus polypeptide.

The polypeptide with enzymic activity can be also fungi polypeptide, and more preferably yeast polypeptides genus polypeptide as mould in mycocandida, genus kluyveromyces, Pichia, yeast belong, Schizosaccharomyces or Western alpine yarrow, and it has enzymic activity, or more preferably filamentous fungus polypeptide as the mould genus of branch top spore, Agaricus, Alternaria, Aspergillus, aureobasidium genus, Botryospaeria, intend wax Pseudomonas, Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinus, Coptotermes, rod softgel shell belongs to, the red shell Pseudomonas of hidden clump, genera cryptococcus, Diplodia, Exidia, Filibasidium, fusarium, Gibberella, full flagellum Eimeria, Humicola, rake teeth Pseudomonas, Agaricus, Leptospaeria, Magnaporthe grisea belongs to, Melanocarpus, Polyporus, Mucor, myceliophthora, the mould genus of Xin Kaoma fat, Neurospora, paecilomyces, Penicillium, flat lead fungi belongs to, cud Chytridium, Poitrasia, false black Peziza, Pseudotrichonympha, Rhizomucor, Schizophyllum, capital spore belongs to, Talaromyces, thermophilic ascomycete belongs to, the mould genus of shuttle spore, Tolypocladium, Trichoderma, Peziza becomes mildewed, Verticillium, Volvaria or Xylaria polypeptide, it has enzymic activity.

In one aspect, described polypeptide is the saccharomyces carlsbergensis with enzymic activity, yeast saccharomyces cerevisiae, saccharomyces diastaticus, Doug Laplace yeast, Crewe not yeast, promise ground yeast or ellipsoideus yeast polypeptide.

In yet another aspect, described polypeptide is that to have the solution fiber branch top spore of enzymic activity mould, microorganism Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, smelly aspergillus, aspergillus japonicus, Aspergillus nidulans, aspergillus niger, aspergillus oryzae, chrysosporium keratinophilum, Chrysosporium lucknowense, chrysosporium tropicum, Chrysosporium merdarium, Chrysosporium inops, felt gold pityrosporion ovale, Chrysosporium queenslandicum, Chrysosporium zonatum, bar spore shape sickle spore, F.graminearum schw, storehouse prestige sickle spore, machete sickle spore, fusarium graminaria, the red sickle spore of standing grain, different spore sickle spore, albizzia sickle spore, point sickle spore, racemosus sickle spore, pink sickle spore, Williams Elder Twig sickle spore, colour of skin sickle spore, intend branch spore sickle spore, sulphur look sickle spore, circle sickle spore, intend silk spore sickle spore, empiecement sickle spore, ash humicola lanuginosa, Humicola insolens, dredge cotton shape humicola lanuginosa, white rake teeth bacterium, rice black wool is mould, thermophilic fungus destroyed wire, Neuraspora crassa, penicillium funiculosum, penicillium purpurogenum, the flat lead fungi of yellow spore, thermophilic capital spore, Thielavia achromatica, Thielavia albomyces, Thielavia albopilosa, Australia shuttle spore is mould, Thielavia fimeti, little spore shuttle spore is mould, ovum spore shuttle spore is mould, Thielavia peruviana, knurl spore shuttle spore is mould, hair shuttle spore is mould, Thielavia subthermophila, autochthonal shuttle spore is mould, trichoderma harziarum, healthy and free from worry wood is mould, long shoot wood is mould, Trichodermareesei, viride or brown spore cup fungi (Trichophaea saccata) polypeptide that becomes mildewed.

Can also use the mutant through chemically modified or protein engineering transformation of the polypeptide with enzymic activity.

One or more of described composition (for example several) component can be restructuring component, that is, by described in clones coding separately the DNA sequence dna of component and subsequently with this DNA sequence dna transformant expression in host (referring to, for example, WO91/17243 and WO91/17244) and produce.Described host is heterologous host (enzyme is external source to host) preferably, but this host can be also homology host (enzyme is natural to host) under certain condition.Monocomponent fibre element decomposition of protein can also be prepared by such protein of purifying from fermented liquid.

In one aspect, described one or more (for example several) cellulolytic enzymes comprise commercial cellulolytic enzyme prepared product.The example that is applicable to the cellulolytic enzyme prepared product of business of the present invention comprises, for example, and CELLIC ^tMcTec (Novozymes A/S), CELLIC ^tMcTec2 (Novozymes A/S), cTec3 (Novozymes A/S), CELLUCLAST ^tM(Novozymes A/S), NOVOZYM ^tM188 (Novozymes A/S), CELLUZYME ^tM(Novozymes A/S), CEREFLO ^tM(Novozymes A/S) and ULTRAFLO ^tM(Novozymes A/S), ACCELERASE ^tM(Genencor Int.), LAMINEX ^tM(Genencor Int.), SPEZYME ^tMcP (Genencor Int.), nL (DSM), s/L100 (DSM), ROHAMENT ^tM7069W lDI (Dyadic International, Inc.), lBR (Dyadic International, Inc.) or 150L (Dyadic International, Inc.).Described cellulose enzyme with solid substance approximately 0.001 to about 5.0wt%, for example approximately 0.025 of solid substance to about 4.0wt%, or approximately 0.005 significant quantity to about 2.0wt% of solid is added.

Can include but are not limited to for the example of the bacterium endoglucanase of technique of the present invention, separate fiber hot acid bacterium (Acidothermus cellulolyticus) endoglucanase (WO91/05039; WO93/15186; United States Patent (USP) 5,275,944; WO96/02551; United States Patent (USP) 5,536,655, WO00/70031, WO05/093050); Thermobifida fusca EG III (WO05/093050); With Thermobifida fusca EGV (WO05/093050).

Can include but are not limited to for the example of fungi endoglucanase of the present invention trichoderma reesei endoglucanase I (Penttila etc., 1986, Gene45:253-263, Trichodermareesei Cel7B endoglucanase i (GENBANK ^tMaccession number M15665); Trichoderma reesei endoglucanase II (Saloheimo etc., 1988, Gene63:11-22), Trichodermareesei Cel5A EG II (GENBANK ^tMaccession number M19373); Trichoderma reesei endoglucanase III (Okada etc., 1988, Appl.Environ.Microbiol.64:555-563; GENBANK ^tMaccession number AB003694); Trichoderma reesei endoglucanase V (Saloheimo etc., 1994, Molecular Microbiology13:219-228; GENBANK ^tMaccession number Z33381); Microorganism Aspergillus aculeatus endoglucanase (Ooi etc., 1990, Nucleic Acids Research18:5884); Valley aspergillus (Aspergillus kawachii) endoglucanase (Sakamoto etc., 1995, Current Genetics27:435-439); Carrot soft rot Erwinia (Erwinia carotovara) endoglucanase (Saarilahti etc., 1990, Gene90:9-14); Point sickle spore endoglucanase (GENBANK ^tMaccession number L29381); Ash humicola lanuginosa thermoidea mutation endoglucanase (GENBANK ^tMaccession number AB003107); Melanocarpus albomyces endoglucanase (GENBANK ^tMaccession number MAL515703); Neuraspora crassa endoglucanase (GENBANK ^tMaccession number XM_324477); Humicola insolens EGV; Thermophilic fungus destroyed wire CBS117.65 endoglucanase; Basidiomycetes (basidiomycete) CBS495.95 endoglucanase; Basidiomycetes CBS494.95 endoglucanase; The mould NRRL8126CEL6B endoglucanase of autochthonal shuttle spore; The mould NRRL8126CEL6C endoglucanase of autochthonal shuttle spore; The mould NRRL8126CEL7C endoglucanase of autochthonal shuttle spore; The mould NRRL8126CEL7E endoglucanase of autochthonal shuttle spore; The mould NRRL8126CEL7F endoglucanase of autochthonal shuttle spore; Cladorrhinum foecundissimum ATCC62373CEL7A endoglucanase; And Li's Trichoderma strains No.VTT-D-80133 endoglucanase (GENBANK ^tMaccession number M15665).

The example that can be used for cellobiohydrolase of the present invention includes but are not limited to, microorganism Aspergillus aculeatus cellobiohydrolase II (WO2011/059740), chaetomium thermophilum (Chaetomium thermophilum) cellobiohydrolase I, chaetomium thermophilum cellobiohydrolase II, Humicola insolens cellobiohydrolase I, thermophilic fungus destroyed wire cellobiohydrolase II, (WO2009/042871), Thielavia hyrcanie cellobiohydrolase II (WO2010/141325), the mould cellobiohydrolase II of autochthonal shuttle spore (CEL6A, WO2006/074435), Trichodermareesei cellobiohydrolase I, Trichodermareesei cellobiohydrolase II, and the brown spore cup fungi cellobiohydrolase II (WO2010/057086) that becomes mildewed.

The example that can be used for beta-glucosidase enzyme of the present invention includes but are not limited to from microorganism Aspergillus aculeatus (Kawaguchi etc., 1996, Gene173:287-288), Aspergillus fumigatus (WO2005/047499), aspergillus niger (Dan etc., 2000, J.Biol.Chem.275:4973-4980), the become mildewed beta-glucosidase enzyme of cup fungi (WO2007/019442) of aspergillus oryzae (WO2002/095014), Brazilian mould IBT20888 (WO2007/019442 and WO2010/088387), autochthonal shuttle spore mould (WO2011/035029) and brown spore.

Described beta-glucosidase enzyme can be fusion rotein.In one aspect, described beta-glucosidase enzyme is WO aspergillus oryzae beta-glucosidase enzyme variant BG fusion rotein (WO2008/057637) or aspergillus oryzae beta-glucosidase enzyme fusion rotein (2008/057637).

Other available endoglucanase, cellobiohydrolase and beta-glucosidase enzyme are disclosed in and use according to Henrissat B., 1991, A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem.J.280:309-316 and Henrissat B. and Bairoch A., 1996, Updating the sequence-based classification of glycosyl hydrolases, in many glycosyl hydrolase families of the classification of Biochem.J.316:695-696.

Other can be used for cellulolytic enzyme of the present invention and is described in WO98/13465, WO98/015619, WO98/015633, WO99/06574, WO99/10481, WO99/025847, WO99/031255, WO2002/101078, WO2003/027306, WO2003/052054, WO2003/052055, WO2003/052056, WO2003/052057, WO2003/052118, WO2004/016760, WO2004/043980, WO2004/048592, WO2005/001065, WO2005/028636, WO2005/093050, WO2005/093073, WO2006/074005, WO2006/117432, WO2007/071818, WO2007/071820, WO2008/008070, WO2008/008793, U.S. Patent No. 5, 457, 046, U.S. Patent No. 5, 648, 263 and U.S. Patent No. 5, 686, 593.

In one aspect, described in there is cellulolytic enhancing activity GH61 polypeptide at the solubility activation divalent metal described in WO2008/151043, for example under the existence of manganous sulfate or copper sulfate, use.

The GH61 polypeptide in yet another aspect, with cellulolytic enhancing activity is used under the existence of titanium dioxide compound, bicyclic compound, heterogeneous ring compound, nitrogenous compound, naphtoquinone compounds, sulfocompound or the liquor that obtains as pretreated maize straw (PCS) from pretreated cellulose materials.

The GH61 polypeptide in one aspect, with cellulolytic enhancing activity is used under the existence of titanium dioxide compound, bicyclic compound, heterogeneous ring compound, nitrogenous compound, naphtoquinone compounds, sulfocompound or the liquor that obtains as pretreated maize straw (PCS) from pretreated cellulose materials.

Described titanium dioxide compound can comprise any suitable combination thing that contains two or more Sauerstoffatoms.In some respects, described titanium dioxide compound contains the aryl module (moiety) replacing as described herein.Described titanium dioxide compound can comprise one or more (for example several) hydroxyl and/or hydroxy derivatives, but also comprises the aryl module of the replacement that lacks hydroxyl and hydroxy derivatives.The non-limiting example of titanium dioxide compound comprises pyrocatechol or catechol; Coffic acid; PCA; The 4-tertiary butyl-5-methoxyl group-1,2-dihydroxy-benzene; Pyrogallol; Gallic acid; Methyl-Gallic Acid; 2,3,4-trihydroxybenzophenone; 2,6-syringol; Sinapinic acid; 3,5-resorcylic acid; 4-is chloro-1,2-dihydroxy-benzene; 4-nitro-1,2-dihydroxy-benzene; Tannic acid; Progallin A; Hydroxyethanoic acid methyl esters; Dihydroxyl fumaric acid; 2-butyne-Isosorbide-5-Nitrae-glycol; Croconic acid; 1,3-PD; Tartrate; 2,4-pentanediol; 3-oxyethyl group-1,2-PD; 2,4,4 '-trihydroxybenzophenone; Cis-2-butene-Isosorbide-5-Nitrae-glycol; Squaric acid; Otan; Acetyl acrolein (acrolein acetal); Methyl-4-HBA; 4-HBA; And methyl-3,5-dimethoxy-4 '-hydroxy-benzoic acid; Or their salt or solvate (solvate).

Described bicyclic compound can comprise any suitable replacement carbocyclic fused ring system as described herein.Described compound can comprise one or more (for example several) other ring, and unless otherwise specified, be not limited to concrete number of rings.In one aspect, described bicyclic compound is flavonoid.In yet another aspect, described bicyclic compound is the optional isoflavonoid (isoflavonoid) replacing.In yet another aspect, described bicyclic compound is the optional pattern replacing ion (flavylium ion), as the cyanidin(e) of optional replacement or the optional anthocyanogen replacing, or derivatives thereof.The non-limiting example of bicyclic compound comprises l-Epicatechol (epicatechin); Quercetin (quercetin); Myricetin (myricetin); Taxifolin (taxifolin); Kaempferol (kaempferol); Sang Su (morin); Acacetin (acacetin); Naringenin (naringenin); Isorhamnetin (isorhamnetin); Apigenin (apigenin); Anthocyanidin (cyanidin); Anthocyanin (cyanin); Kuromanin; Keracyanin (keracyanin); Or their salt or solvate.

Described heterogeneous ring compound can be any suitable compound, as described herein optional replace comprise heteroatomic aromatic ring or non-aromatic ring.In one aspect, described heterocycle is the compound of the Heterocyclylalkyl module that comprises optional replacement or the heteroaryl module optionally replacing.In yet another aspect, the Heterocyclylalkyl module of described optional replacement or the optional heteroaryl module replacing are the optional five-membered ring alkyl replacing or the optional quinary heteroaryl module replacing.In yet another aspect, the optional Heterocyclylalkyl replacing or the optional heteroaryl module replacing are the modules that is selected from following optional replacement: pyrazolyl, furyl, imidazolyl, isoxazolyl, oxadiazolyl, oxazolyl, pyrryl, pyridyl, pyrimidyl, pyridazinyl, thiazolyl, triazolyl, thienyl (thienyl), dihydro-thiophene-pyrazolyl (dihydrothieno-pyrazolyl), thianaphthenyl, carbazyl, benzimidazolyl-, benzothienyl (benzothienyl), benzofuryl, indyl, quinolyl, benzotriazole base, benzothiazolyl, benzoxazolyl (benzooxazolyl), benzimidazolyl-, isoquinolyl, pseudoindoyl, acridyl, benzoisoxazole base (benzoisazolyl), T10, pyrazinyl, tetrahydrofuran base, pyrrolinyl, pyrrolidyl, morpholinyl, indyl, diazacyclo heptantriene base (diazepinyl), nitrogen heterocyclic heptantriene base (azepinyl), thia cycloheptatriene base (thiepinyl), piperidyl and oxepin base (oxepinyl).The Heterocyclylalkyl module of described optional replacement or the optional heteroaryl module replacing are the optional furyls replacing in yet another aspect.The non-limiting example of heterogeneous ring compound comprises (1,2-dihydroxy ethyl)-3,4-dihydrofuran-2 (5H)-one; 4-hydroxy-5-methyl base-3-furanone; 5-hydroxyl-2 (5H)-furanone; [1,2-dihydroxy ethyl] furans-2,3,4 (5H)-triketones; Alpha-hydroxy-gamma-butyrolactone; Ribonic acid gamma lactone; Hexanal saccharic acid gamma lactone (aldohexuronicaldohexuronic acid γ-lactone); Glucopyrone; 4 hydroxy coumarin; Dihydrobenzofuranes; 5-(methylol) furfural; Furoin (furoin); 2 (5H)-furanones; 5,6-dihydro-2H-pyran-2-one; With 5,6-dihydro-4-hydroxyl-6-methyl-2H-pyran-2-one; Or their salt or solvate.

Described nitrogenous compound can be any suitable combination thing with one or more nitrogen-atoms.In one aspect, described nitrogenous compound comprises amine, imines, azanol or Nitrous Oxide (nitroxide) module.The non-limiting example of nitrogenous compound comprises acetoxime; Violuric acid; Pyridine-2-aldoxime; Ortho-Aminophenol; 1,2-phenylenediamine; 2,2,6,6-tetramethyl--piperidino oxygen (piperidinyloxy); 5,6,7,8-tetrahydrobiopterin; 6,7-dimethyl-5,6,7,8-tetrahydrochysene pterin; And maleinamic acid; Or their salt or solvate.

Described naphtoquinone compounds can be any described suitable compound that comprises quinone module herein.The non-limiting example of naphtoquinone compounds comprises Isosorbide-5-Nitrae-benzoquinones; 1,4-naphthoquinone; 2 hydroxy 1,4 naphthoquinone (lawsone); 2,3-dimethoxy-5-methyl isophthalic acid, 4-benzoquinones or ubiquinone ₀; 2,3,5,6-tetramethyl--Isosorbide-5-Nitrae-benzoquinones or duroquinone; Isosorbide-5-Nitrae-dihydroxyanthraquinone; 3-hydroxyl-1-methyl-5,6-indoline diketone or carbazochrome; The 4-tertiary butyl-5-methoxyl group-1,2-benzoquinones; Pyrroloquinoline quinone (pyrroloquinoline quinone); Or their salt or solvate.

Described sulfocompound can be any suitable compound that comprises one or more sulphur atoms.In one aspect, described sulfocompound comprises and is selected from following module: thionyl, thioether, sulfinyl, sulphonyl, sulphamide (sulfamide), sulphonamide (sulfonamide), sulfonic acid and sulphonate.The non-limiting example of sulfocompound comprises sulfur alcohol; 2-propylmercaptan; 2-propylene-1-mercaptan; Mistabrom; Benzenethiol; Benzene-1,2-bis-mercaptan; Halfcystine; Methionine(Met); Gsh; Gelucystine; Or their salt or solvate.

In one aspect, this kind of compound as above significant quantity to cellulose materials, in the molar ratio to cellulose sugar unit, is approximately 10 ^-6to approximately 10, for example approximately 10 ^-6to approximately 7.5, approximately 10 ^-6to approximately 5, approximately 10 ^-6to approximately 2.5, approximately 10 ^-6to approximately 1, approximately 10 ^-5to approximately 1, approximately 10 ^-5to approximately 10 ^-1, approximately 10 ^-4to approximately 10 ^-1, approximately 10 ^-3to approximately 10 ^-1, or approximately 10 ^-3to approximately 10 ^-2.In yet another aspect, the significant quantity of compound as above is extremely about 1M of approximately 0.1 μ M, and for example approximately 0.5 μ M is to about 0.75M, and approximately 0.75 μ M is to about 0.5M, approximately 1 μ M is to about 0.25M, approximately 1 μ M is to about 0.1M, and approximately 5 μ M are to about 50mM, and approximately 10 μ M are to about 25mM, approximately 50 μ M are to about 25mM, approximately 10 μ M are to about 10mM, and approximately 5 μ M are to about 5mM, or about 0.1mM is to about 1mM.

Term " liquor (liquor) " means under described in this article condition, by processing ligno-cellulose and/or the hemicellulosic materials in slurry, or its monose such as wood sugar, pectinose, seminose etc., the solution phase producing, be water, organic phase or its combination, and solubility inclusion.The liquor that is used for the cellulose decomposition enhancing of GH61 polypeptide can pass through, optionally at catalyzer for example under the existence of acid, optional under the existence of organic solvent, and optional and by applying heat and/or pressure, process cellulose materials or hemicellulosic materials (or raw material) to the physical damage of described material is combined, then produce solution is separated with residual solid.This type of conditional decision the degree that the obtainable cellulose decomposition of the combination by liquor and GH61 polypeptide strengthens in the process by cellulase prepared product hydrolysis fiber cellulosic material.Described liquor can be used standard method in this area as filtration, deposition or centrifugal from treated material separation.

In one aspect, described liquor is approximately 10 to cellulosic significant quantity ^-6to the every g Mierocrystalline cellulose of about 10g, for example approximately 10 ^-6to about 7.5g, approximately 10 ^-6to approximately 5, approximately 10 ^-6to about 2.5g, approximately 10 ^-6to about 1g, approximately 10 ^-5to about 1g, approximately 10 ^-5to approximately 10 ^-1g, approximately 10 ^-4to approximately 10 ^-1g, approximately 10 ^-3to approximately 10 ^-1g, or approximately 10 ^-3to approximately 10 ^-2the every g Mierocrystalline cellulose of g.

In one aspect, described one or more (for example several) hemicellulose lytic enzymes comprise commercial hemicellulose lytic enzyme prepared product.The example that is applicable to commercial hemicellulose lytic enzyme prepared product of the present invention comprises, for example SHEARZYME ^tM(Novozymes A/S), hTec (Novozymes A/S), htec2 (Novozymes A/S), hTec3 (Novozymes A/S), (Novozymes A/S), (Novozymes A/S), hC (Novozymes A/S), xylanase (Genencor), xY (Genencor), xC (Genencor), tX-200A (AB Enzymes), HSP6000Xylanase (DSM), DEPOL ^tM333P (Biocatalysts Limit, Wales, UK), DEPOL ^tM740L (Biocatalysts Limit, Wales, UK) and DEPOL ^tM762P (Biocatalysts Limit, Wales, UK).

The example that can be used for the zytase of technique of the present invention includes but not limited to from microorganism Aspergillus aculeatus (Aspergillus aculeatus) (GeneSeqP:AAR63790; WO94/21785), Aspergillus fumigatus (Aspergillus fumigatus) (WO2006/078256), have a liking for the become mildewed zytase of cup fungi GH10 (WO2011/057083) of loose mould (WO2011/041405), Penicillium bacterial classification (WO2010/126772), mould (Thielavia terrestris) NRRL8126 of autochthonal shuttle spore (WO2009/079210) and brown spore.

The example that can be used for the xylobiase of technique of the present invention includes but not limited to the xylobiase from Neuraspora crassa (Neurospora crassa) (SwissProt accession number Q7SOW4), Trichodermareesei (Trichoderma reesei) (UniProtKB/TrEMBL accession number Q92458) and Ai Mosen ankle joint bacterium (Talaromyces emersonii) (SwissProt accession number Q8X212).

The example that can be used for the acetyl xylan esterase of technique of the present invention includes but not limited to from microorganism Aspergillus aculeatus (WO2010/108918), chaetomium globosum (Chaetomium globosum) (Uniprot accession number Q2GWX4), thin beautiful chaetomium (Chaetomium gracile) (GeneSeqP accession number AAB82124), Humicola insolens (Humicola insolens) DSM1800 (WO2009/073709), Hypocrea jecorina (Hypocrea jecorina) (WO2005/001036), thermophilic fungus destroyed wire (Wo2010/014880), Neuraspora crassa (UniProt accession number q7s259), the acetyl xylan esterase of grain husk withered septoria musiva (Phaeosphaeria nodorum) (Uniprot accession number Q0UHJ1) and the mould NRRL8126 of autochthonal shuttle spore (WO2009/042846).

The example that can be used for the feruloyl esterase of technique of the present invention includes but not limited to the feruloyl esterase from Humicola insolens DSM1800 (WO2009/076122), Fei Xixinsatuo bacterium (Neosartorya fischer) (UniProt accession number A1D9T4), Neuraspora crassa (UniProt accession number Q9HGR3), tangerine ash mould (WO2009/127729) and autochthonal shuttle spore mould (WO2010/053838 and WO2010/065448).

The example that can be used for the arabinofuranosidase of technique of the present invention includes but not limited to from aspergillus niger (Aspergillus niger) (GeneSeqP accession number AAR94170), Humicola insolens (Humicola insolens) DSM1800 (WO2006/114094 and WO2009/073383) and huge pore fungus (M.giganteus) arabinofuranosidase (WO2006/114094).

The example that can be used for the alpha-glucuronidase of the inventive method includes but not limited to from excellent aspergillus (Aspergillus clavatus) (UniProt accession number alcc12), Aspergillus fumigatus (SwissProt accession number Q4WW45), aspergillus niger (Uniprot accession number Q96WX9), terreus (Aspergillus terreus) (SwissProt accession number Q0CJP9), Humicola insolens (WO2010/014706), tangerine ash mould (WO2009/068565), the alpha-glucuronidase of Ai Mosen ankle joint bacterium (UniProt accession number Q8X211) and Trichodermareesei (Uniprot accession number Q99024).

The polypeptide with enzymic activity for technique of the present invention can be by the nutritional medium containing suitable Carbon and nitrogen sources and inorganic salt, use means known in the art (referring to, Bennett for example, J.W. and LaSure, L. (volume), More Gene Manipulations in Fungi, Academic Press, CA, 1991) the above-mentioned microorganism strains of pointing out that ferments produces.Suitable substratum Ke Cong supplier obtains, or can for example, according to published composition preparation (catalogue of American type culture collection).Be suitable for temperature range that growth and enzyme produce and other conditions and in this area be known (referring to, Bailey for example, J.E. and Ollis, D.F., Biochemical Engineering Fundamentals, McGraw-Hill Book Company, NY, 1986).

Described fermentation can be any method that causes the culturing cell of enzyme or protein expression or separation.Therefore, fermentation can be understood as be included in suitable substratum and allow described enzyme expressed or separated condition under the shake-flask culture that carries out, or in laboratory or industrial fermentation tank little-or large scale fermentation (comprise continuously, in batches, fed-batch or solid state fermentation).The enzyme of the gained producing by aforesaid method can reclaim and pass through ordinary method purifying from fermention medium.

fermentation.The organism of fermentation fermentation that can for example, sugar directly or indirectly can be fermented into required tunning by one or more (several) the hang oneself cellulose materials of hydrolysis or the fermentable sugars obtaining containing xylan material." fermentation " or " fermentation process " refers to any fermentation process or any method that comprises fermentation step.Fermentation process also comprises for example, for example, fermentation process for the industry of consumer's goods alcohol (, beer and grape wine), Dairy industry (, fermented milk prod), leather industry and tobacco.Fermentation condition depends on tunning and the fermenting organism body of expectation, and can easily be determined by those skilled in the art.

In fermentation step, as the result of pre-treatment and enzyme hydrolysis step, from cellulose materials or the sugar that discharges containing xylan material, by fermenting organism body (as yeast) fermentation, become product, for example, ethanol.As described herein, hydrolysis (saccharification) and fermentation can be separately or simultaneously.

In implementing fermentation step of the present invention, can use any suitable cellulose materials through hydrolysis or contain xylan material.Conventionally according to required leavened prod (that is, the material that obtain from fermentation) and the method for use, select described material, as known in the art.

Term " fermention medium " can be regarded as in this article and refers to add organism of fermentation substratum before, as, the substratum being produced by saccharifying, and the substratum using in synchronous glycosylation and fermentation process (SSF).

" organism of fermentation " refers to be applicable to any microorganism that desirable fermentation process produces tunning, comprises bacterium and fungal organism.Fermenting organism body can be hexose and/or pentose fermentation organism, or their combination.Hexose and pentose fermentation organism are all known in this area.Suitable organism of fermentation sugar (as glucose, wood sugar, xylulose, pectinose, maltose, seminose, semi-lactosi and/or oligosaccharides) can ferment directly or indirectly (that is, conversion) become required leavened prod.Can produce the bacterium of ethanol and the example of fungi fermentation organism as Lin etc., described in 2006, Appl.Microbiol.Biotechnol.69:627-642.

The example of the organism of fermentation of energy zymohexose comprises bacterium and fungal organism, as yeast.Preferred yeast comprises mycocandida, genus kluyveromyces and yeast belong, for example the bacterial strain of Candida sonorensis, kluyveromyces marxianus and yeast saccharomyces cerevisiae.

Example with the fermenting organism body of its native state energy ferment pentoses comprises bacterium and fungal organism, as some yeast.Preferred wood-sugar fermentation yeast comprises mycocandida, preferably shehatae candida (Candida sheatae) or Candida sonorensis; And Pichia, the bacterial strain of preferred pichia stipitis (Pichia stipitis), as the bacterial strain of pichia stipitis CBS5773.Preferred pentose fermentation yeast comprises pipe capsule yeast belong (Pachysolen), the preferably bacterial strain of pachysolen tannophilus (Pachysolen tannophilus).Can not ferment pentoses as the biology of wood sugar and pectinose can be by means known in the art genetic modification and ferment pentoses.

Can effectively hexose be become the bacterium of ethanol to comprise with pentose fermentation, for example, Bacillus coagulans (Bacillus coagulans), clostridium acetobutylicum (Clostridium acetobutylicum), thermal fiber clostridium (Clostridium thermocellum), Clostridium phytofermentans, ground bacillus belong to bacterial classification, separate sugared hot anaerobic bacillus(cillus anaerobicus) (Thermoanaerobacter saccharolyticum) and zymomonas mobilis (Zymomonas mobilis) (Philippidis, 1996, see above).

Other fermenting organism comprises bacillus, as Bacillus coagulans; Mycocandida, as Candida sonorensis, C.methanosorbosa, Di Dansi candiyeast (Candida diddensii), Candida parapsilosis (Candida parapsilosis), C.naedodendra, C.blankii, C.entomophilia, rape candiyeast (C.brassicae), candida pseudotropicalis (Candida pseudotropicalis), Candida boidinii (Candida boidinii), Candida utilis (Candida utilis) and shehatae candida (C.scehatae); Fusobacterium, as clostridium acetobutylicum, thermal fiber clostridium and C.phytofermentans; Intestinal bacteria, the coli strain that particularly genetically modified promotion ethanol produces; Ground bacillus belongs to bacterial classification; Hansenula, as Hansenula anomala (Hansenula anomala); Klebsiella (Klebsiella), as acid-producing Klebsiella bacterium (Klebsiella oxytoca); Genus kluyveromyces, as kluyveromyces marxianus, Kluyveromyces lactis (K.lactis), K.thermotolerans and Kluyveromyces fragilis; Schizosaccharomyces, as schizosaccharomyces pombe (S.pombe); Hot anaerobic bacillus(cillus anaerobicus) belongs to (Thermoanaerobacter), as separates sugared hot anaerobic bacillus(cillus anaerobicus), and zymomonas (Zymomonas), as the bacterial strain of zymomonas mobilis.

One preferred aspect, yeast is that Brettanomyces belongs to (Bretannomyces).One preferred aspect, yeast is Ke Laosen Brettanomyces (Bretannomyces clausenii).In another more preferred aspect, yeast is candiyeast.In another more preferred aspect, yeast is Candida sonorensis.In another more preferred aspect, yeast is Candida boidinii.In another more preferred aspect, yeast is Candida blankii.In another more preferred aspect, yeast is rape candiyeast.In another more preferred aspect, yeast is Di Dansi candiyeast.In another more preferred aspect, yeast is Candida entomophiliia.In another more preferred aspect, yeast is candida pseudotropicalis.In another more preferred aspect, yeast is shehatae candida.In another more preferred aspect, yeast is Candida utilis.Another preferred aspect, yeast is excellent spore yeast belong (Clavispora).In another more preferred aspect, yeast is Clavispora lusitaniae yeast (Clavispora lusitaniae).In another more preferred aspect, yeast is Root and stem of Cholla rod spore yeast (Clavispora opuntiae).Another preferred aspect, yeast is kluyveromyces.In another more preferred aspect, yeast is Kluyveromyces fragilis.In another more preferred aspect, yeast is kluyveromyces marxianus.In another more preferred aspect, yeast is Kluyveromyces thermotolerans.Another preferred aspect, yeast be pipe capsule yeast belong (Pachysolen).In another more preferred aspect, yeast is pachysolen tannophilus.Another preferred aspect, yeast is pichia spp.In another more preferred aspect, yeast is pichia stipitis.Another preferred aspect, yeast is yeast belong bacterial classification.Another preferred aspect, yeast is yeast saccharomyces cerevisiae.In another more preferred aspect, yeast is saccharomyces diastaticus (Saccharomyces distaticus).In another more preferred aspect, yeast is saccharomyces uvarum (Saccharomyces uvarum).

One preferred aspect, bacterium is bacillus.One preferred aspect, bacterium is Bacillus coagulans.In another more preferred aspect, bacterium is fusobacterium.In another more preferred aspect, bacterium is clostridium acetobutylicum.In another more preferred aspect, bacterium is Clostridium phytofermentans.In another more preferred aspect, bacterium is thermal fiber clostridium.In another more preferred aspect, bacterium is that ground bacillus belongs to bacterial classification.In another more preferred aspect, bacterium is that hot anaerobic bacillus(cillus anaerobicus) belongs to.In another more preferred aspect, bacterium is to separate sugared hot anaerobic bacillus(cillus anaerobicus).In another more preferred aspect, bacterium is zymomonas.In another more preferred aspect, bacterium is zymomonas mobilis.

The yeast that commercially available applicable ethanol produces comprises, for example BIOFERM ^tMaFT and XR (NABC-North American Bioproducts Corporation, GA, USA), ETHANOL RED ^tMyeast (Red Star/Lesaffre, USA), FALI ^tM(Fleischmann ' s Yeast, Burns Philp Food Inc., USA), FERMIOL ^tM(DSM Specialties), GERT STRAND ^tM(Gert Strand AB, Sweden) and SUPERSTART ^tMand THERMOSACC ^tMfresh yeast (Ethanol Technology, WI, USA).

One preferred aspect, thereby organism of fermentation provides the ability of ferment pentoses through genetic modification, as utilizes wood sugar, utilizes pectinose and jointly utilizes the microorganism of wood sugar and pectinose.

By heterologous gene being cloned into multiple organism of fermentation, having built and hexose and pentose can have been changed into organism (Chen and the Ho of ethanol (fermentation altogether), 1993, Cloning and improving the expression of Pichia stipitis xylose reductase gene in Saccharomyces cerevisiae, Appl.Biochem.Biotechnol.39-40:135-147; Ho etc., 1998, Genetically engineered Saccharomyces yeast capable of effectively cofermenting glucose and xylose, Appl.Environ.Microbiol.64:1852-1859; Kotter and Ciriacy, 1993, Xylose fermentation by Saccharomyces cerevisiae, Appl.Microbiol.Biotechnol.38:776-783; Walfridsson etc., 1995, Xylose-metabolizing Saccharomyces cerevisiae strains overexpressing the TKL1and TAL1genes encoding the pentose phosphate pathway enzymes transketolase and transaldolase, Appl.Environ.Microbiol.61:4184-4190; Kuyper etc., 2004, Minimal metabolic engineering of Saccharomyces cerevisiae for efficient anaerobic xylose fermentation:a proof of principle, FEMS Yeast Research4:655-664; Beall etc., 1991, Parametric studies of ethanol production from xylose and other sugars by recombinant Escherichia coli, Biotech.Bioeng.38:296-303; Ingram etc., 1998, Metabolic engineering of bacteria for ethanol production, Biotechnol.Bioeng.58:204-214; Zhang etc., 1995, Metabolic engineering of a pentose metabolism pathway in ethanologenic Zymomonas mobilis, Science267:240-243; Deanda etc., 1996, Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering, Appl.Environ.Microbiol.62:4465-4470; WO2003/062430, xylose isomerase).

One preferred aspect, through the organism of fermentation of genetic modification, be Candida sonorensi.Another preferred aspect, through the organism of fermentation of genetic modification, be intestinal bacteria.Another preferred aspect, through the organism of fermentation of genetic modification, be acid-producing Klebsiella bacterium.Another preferred aspect, described genetically modified organism of fermentation is kluyveromyces marxianus.Another preferred aspect, described genetically modified organism of fermentation is yeast saccharomyces cerevisiae.Another preferred aspect, through the organism of fermentation of genetic modification, be zymomonas mobilis.

As known in the art, above-mentioned organism can also be for generation of other material, as described herein.

Conventionally to the cellulose materials of degrading or containing xylan material or hydrolyzate, add organism of fermentation, and carry out approximately 8 to approximately 96 hours, for example fermentation in approximately 24 to approximately 60 hours.Temperature is generally approximately 26 ℃ to approximately 60 ℃, for example approximately 32 ℃ or 50 ℃, and at about pH3 for example, to about pH8, about pH4-5,6 or 7.

In one aspect, to the cellulose materials of degraded or containing xylan material, use yeast and/or another kind of microorganism, and carry out approximately 12 to approximately 96 hours, as be generally fermentation in 24-60 hour.In yet another aspect, temperature is preferably approximately 20 ℃ to approximately 60 ℃, and for example approximately 25 ℃ to approximately 50 ℃, and approximately 32 ℃ to approximately 50 ℃, approximately 32 ℃ to approximately 50 ℃, and pH is generally about pH3 to about pH7, and for example about pH4 is to about pH7.Yet some fermenting organism styles, as bacterium, have the suitableeest higher leavening temperature.Yeast or another kind of microorganism are preferably with approximately 10 ⁵-10 ¹², preferred approximately 10 ⁷-10 ¹⁰, about 2x10 particularly ⁸the amount of the every ml fermented liquid of viable count is used.About using the further guidance that yeast ferments to be for example found in " The Alcohol Textbook " (K.Jacques, T.P.Lyons and D.R.Kelsall compile, Nottingham University Press, United Kingdom1999), it is incorporated to herein by carrying stating.

Fermentation stimulating substance can be used with any Combination of Methods as herein described, further to improve zymotechnique, particularly improves the performance of organism of fermentation, as, speed increases and alcohol getting rate." fermentation stimulating substance " refers to the stimulant for organism of fermentation (particularly yeast) growth.Preferably for the fermentation stimulating substance of growing, comprise VITAMIN and mineral substance.The example of VITAMIN comprises multivitamin, vitamin H, pantothenic acid (salt), nicotinic acid, meso-inositol (meso-inositol), VitB1, pyridoxol (pyridoxine), para-amino benzoic acid, folic acid, riboflavin and vitamin A, B, C, D and E.Referring to, for example, Alfenore etc., Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer-Verlag (2002), it is incorporated to herein by carrying stating.The example of mineral substance comprises can provide nutraceutical mineral substance and mineral salt, and described nutrition comprises P, K, Mg, S, Ca, Fe, Zn, Mn and Cu.

tunning: tunning can be any material that is derived from fermentation.Tunning can be to be not limited to alcohol (for example, arabitol, propyl carbinol, isopropylcarbinol, ethanol, glycerine, methyl alcohol, ethylene glycol, 1,3-PD (propylene glycol), butyleneglycol, glycerol, sorbyl alcohol and Xylitol); Alkane (for example pentane, hexane, heptane, octane, nonane, decane, undecane and dodecane); Naphthenic hydrocarbon (for example pentamethylene, hexanaphthene, suberane and cyclooctane); Alkene (for example amylene, hexene, heptene and octene); Amino acid (for example, aspartic acid, L-glutamic acid, glycine, Methionin, Serine and Threonine); Gas (for example, methane, hydrogen (H ₂), carbonic acid gas (CO ₂) and carbon monoxide (CO)); Isoprene; Ketone (for example, acetone); Organic acid (for example, acetic acid, acetonic acid, hexanodioic acid, xitix, citric acid, 2,5-diketone-D-glyconic acid, formic acid, FUMARIC ACID TECH GRADE, saccharic acid, glyconic acid, glucuronic acid, pentanedioic acid, 3-hydroxy-propionic acid, methylene-succinic acid, lactic acid, oxysuccinic acid, propanedioic acid, oxalic acid, oxaloacetic acid, propionic acid, succsinic acid and xylosic acid); And polyketide.Tunning can also be the protein as high-value product.

One preferred aspect, tunning is alcohol.Will be understood that, term " alcohol " comprises the material that comprises one or more oh groups.Aspect preferred, described alcohol is propyl carbinol.In another more preferred aspect, described alcohol is isopropylcarbinol.In another more preferred aspect, described alcohol is ethanol.In another more preferred aspect, described alcohol is methyl alcohol.In another more preferred aspect, described alcohol is arabitol.In another more preferred aspect, described alcohol is butyleneglycol.In another more preferred aspect, described alcohol is ethylene glycol.In another more preferred aspect, described alcohol is glycerol (glycerin).In another more preferred aspect, described alcohol is glycerine (glycerol).In another more preferred aspect, described alcohol is 1,3-PD.In another more preferred aspect, described alcohol is sorbyl alcohol.In another more preferred aspect, described alcohol is Xylitol.Referring to, for example, Gong, C.S., Cao, N.J., Du, J., and Tsao, G.T., 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering/Biotechnology, Scheper, T. compiles, Springer-Verlag Berlin Heidelberg, Germany, 65:207-241; Silveira, M.M., and Jonas, R., 2002, The biotechnological production of sorbitol, Appl.Microbiol.Biotechnol.59:400-408; Nigam, P. and Singh, D., 1995, Processes for fermentative production of xylitol – a sugar substitute, Process Biochemistry30 (2): 117-124; Ezeji, T.C., Qureshi, N. and Blaschek, H.P., 2003, Production of acetone, butanol and ethanol by Clostridium beijerinckii BA101and in situ recovery by gas stripping, World Journal of Microbiology and Biotechnology19 (6): 595-603.

Another preferred aspect, described tunning is alkane.Described alkane is the alkane of branching or branching not.In another more preferred aspect, described alkane is pentane.In another more preferred aspect, described alkane is hexane.In another more preferred aspect, described alkane is heptane.In another more preferred aspect, described alkane is octane.In another more preferred aspect, described alkane is nonane.In another more preferred aspect, described alkane is decane.In another more preferred aspect, described alkane is undecane.In another more preferred aspect, described alkane is dodecane.

Another preferred aspect, described tunning is naphthenic hydrocarbon.In another more preferred aspect, described naphthenic hydrocarbon is pentamethylene.In another more preferred aspect, described naphthenic hydrocarbon is hexanaphthene.In another more preferred aspect, described naphthenic hydrocarbon is suberane.In another more preferred aspect, described naphthenic hydrocarbon is cyclooctane.

Another preferred aspect, described tunning is alkene.Described alkene can be the alkene of branching not or branching.In another more preferred aspect, described alkene is amylene.In another more preferred aspect, described alkene is hexene.In another more preferred aspect, described alkene is heptene.In another more preferred aspect, described alkene is octene.

Another preferred aspect, described tunning is amino acid.In another more preferred aspect, described organic acid is aspartic acid.In another more preferred aspect, described amino acid is L-glutamic acid.In another more preferred aspect, described amino acid is glycine.In another more preferred aspect, described amino acid is Methionin.In another more preferred aspect, described amino acid is Serine.In another more preferred aspect, described amino acid is Threonine.Referring to, for example, Richard, A. and Margaritis, A., 2004, Empirical modeling of batch fermentation kinetics for poly (glutamic acid) production and other microbial biopolymers, Biotechnology and Bioengineering87 (4): 501-515.

Another preferred aspect, described material is gas.In another more preferred aspect, described gas is methane.In another more preferred aspect, described gas is H ₂.In another more preferred aspect, described gas is CO ₂.In another more preferred aspect, described gas is CO.Referring to, for example, Kataoka, N., A.Miya, and K.Kiriyama, 1997, Studies on hydrogen production by continuous culture system of hydrogen-producing anaerobic bacteria, Water Science and Technology36 (6-7): 41-47; And Gunaseelan, V.N., in Biomass and Bioenergy, Vol.13 (1-2), pp83-114,1997, Anaerobic digestion of biomass for methane production:A review.

Another preferred aspect, described tunning is isoprene.

Another preferred aspect, described tunning is ketone.It should be understood that term " ketone " contained the ketone that contains one or more ketone modules.In another more preferred aspect, described ketone is acetone.Referring to, for example Qureshi and Blaschek, 2003, see above.

Another preferred aspect, described tunning is organic acid.In another more preferred aspect, described organic acid is acetic acid.In another more preferred aspect, described organic acid is acetonic acid.In another more preferred aspect, described organic acid is hexanodioic acid.In another more preferred aspect, described organic acid is xitix.In another more preferred aspect, described organic acid is citric acid.In another more preferred aspect, described organic acid is 2,5-diketone-D-glyconic acid.In another more preferred aspect, described organic acid is formic acid.In another more preferred aspect, described organic acid is FUMARIC ACID TECH GRADE.In another more preferred aspect, described organic acid is saccharic acid.In another more preferred aspect, described organic acid is glyconic acid.In another more preferred aspect, described organic acid is glucuronic acid.In another more preferred aspect, described organic acid is pentanedioic acid.Another preferred aspect, described organic acid is 3-hydroxy-propionic acid.In another more preferred aspect, described organic acid is methylene-succinic acid.In another more preferred aspect, described organic acid is lactic acid.In another more preferred aspect, described organic acid is oxysuccinic acid.In another more preferred aspect, described organic acid is propanedioic acid.In another more preferred aspect, described organic acid is oxalic acid.In another more preferred aspect, described organic acid is propionic acid.In another more preferred aspect, described organic acid is succsinic acid.In another more preferred aspect, described organic acid is xylosic acid.Referring to, for example, Chen, R. and Lee, Y.Y., 1997, Membrane-mediated extractive fermentation for lactic acid production from cellulosic biomass, Appl.Biochem.Biotechnol.63-65:435-448.

Another preferred aspect, described material is polyketide.

reclaimcan use any method known in the art, optionally from fermention medium, reclaim tunning, described method includes, but not limited to chromatography, electrophoresis method, differential solubleness, distillation or extraction.For example, by conventional distillating method from the cellulose materials of fermentation or containing xylan material separation purified alcohols.Can obtain purity up to the ethanol of about 96vol.%, it can be used as, for example, and alcohol fuel, drinking alcohol (that is, drinkable neutral alcoholic drinks), or industrial alcohol.

Signal peptide

The invention still further relates to the separated polynucleotide of coded signal peptide, described signal peptide comprises or consists of the amino acid/11 to 20 of SEQ ID NO:2, the amino acid/11 to 17 of SEQ ID NO:4, the amino acid/11 to 18 of SEQ ID NO:6, the amino acid/11 to 22 of SEQ ID NO:8, the amino acid/11 to 18 of SEQ ID NO:10, the amino acid/11 to 20 of SEQ ID NO:12, the amino acid/11 to 17 of SEQ ID NO:14, the amino acid/11 to 19 of SEQ ID NO:16, the amino acid/11 to 17 of SEQ ID NO:18, or the amino acid/11 to 17 of SEQ ID NO:20.Described polynucleotide can further comprise the gene of proteins encoded, and it is operably connected to signal peptide.Described albumen is preferably external source for described signal peptide.In one aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 60 of SEQ ID NO:1.In yet another aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 51 of SEQ ID NO:3.In yet another aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 54 of SEQ ID NO:5.In yet another aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 66 of SEQ ID NO:7.In yet another aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 54 of SEQ ID NO:9.In yet another aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 60 of SEQ ID NO:11.In yet another aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 51 of SEQ ID NO:13.In yet another aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 57 of SEQ ID NO:15.In yet another aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 51 of SEQ ID NO:17.In yet another aspect, the encode polynucleotide of described signal peptide are the Nucleotide 1 to 51 of SEQ ID NO:19.

The invention still further relates to the nucleic acid construct, expression vector and the recombinant host cell that comprise this kind of polynucleotide.

The invention still further relates to for generation of method of protein, comprising: (a) cultivate the recombinant host cell that comprises this kind of polynucleotide; Optionally (b) reclaims described protein.

Described protein can be natural or allos for host cell.Term " protein " does not refer to the coded product of length-specific in the meaning herein, and therefore contains peptide, oligopeptides and polypeptide.Term " protein " is also contained through combination to form the two or more polypeptide of coded product.Described protein also comprises hybrid polypeptide and fusion polypeptide.

Preferred protein is hormone, enzyme, acceptor or its part, antibody or its part, or reporter protein (reporter).For example, described protein can be lytic enzyme, isomerase, ligase enzyme, lyase (lyase), oxydo-reductase or transferring enzyme, alpha-galactosidase for example, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase enzymes, beta-glucosidase enzyme, xylobiase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, at, Maltose 4-glucosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, saccharase, laccase, lipase, mannosidase, become glycanase (mutanase), oxydase, pectin decomposing enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic ferment, rnase, trans-glutaminases, or zytase.

Gene can obtain from any protokaryon, eucaryon or other source.

By following examples, the present invention is further described, but should not be understood as limitation of the scope of the invention.

Embodiment

Bacterial strain

The fungal bacterial strain of called after NN047338 by 45 ℃ on PDA flat board dilution then by shifting single conidium to separated from the pedotheque of economizing from Hunan China on YG agar plate.This bacterial strain NN047338 is thermophilic capital spore based on morphological specificity and ITS rDNA Sequence Identification.

The fungal bacterial strain of called after NN051564 is separated by the compost sample of collecting in China from PCS agar plate.Bacterial strain NN051564 is that camphor tree suede branch is mould based on morphological specificity and ITS rDNA Sequence Identification.

The fungal bacterial strain of called after NN044758 by 45 ℃ on PDA flat board dilution then by shifting single conidium to purifying on YG agar plate, come the pedotheque from collecting in China separated.Bacterial strain NN044758 is that camphor tree suede branch is mould based on morphological specificity and ITS rDNA Sequence Identification.

From fungi strain preservation center, (Centraalbureau Voor Schimmelcultures) obtains (being numbered CBS174.70) to the fungal bacterial strain of called after NN000308.Bacterial strain NN000308 is thermophilic excellent softgel shell (different name Myceliophthora fergusii of the same race (Myceliophthora fergusii)) based on morphological specificity and ITS rDNA Sequence Identification.

The fungi strain of called after NN051380 is separated from the pedotheque of collecting in China.Bacterial strain NN051380 is penicillium oxalicum based on morphological specificity and ITS rDNA Sequence Identification.

Substratum

PDA flat board adds to 1 liter by the potato dextrose agar of 39 grams and deionized water and forms.

YG agar plate is by the yeast extract of 5g, the glucose of 10g, and the agar of 20g, and deionized water adds to 1 liter of formation.

PCS agar plate is by the PCS of 25g, the agar of 20g, the Bacto Peptone (bactopeptone) of 1g, the yeast extract of 5g, the glucose of 2.5g, the NaNO of 5g ₃, the NH of 3g ₄cl, the MES of 2g, the citric acid of 2.5g, the CaCl of 0.2g ₂2H ₂o, the MgSO of 0.2g ₄7H ₂o, the K of 4g ₂hPO ₄, the COVE trace element solution of 1ml, and deionized water adds to 1 liter of formation.

COVE trace element solution is by the Na of 0.04g ₂b ₄o ₇10H ₂o, the CuSO of 0.4g ₄5H ₂o, the FeSO of 1.2g ₄7H ₂o, the MnSO of 0.7g ₄h ₂o, the Na of 0.8g ₂moO ₂2H ₂o, the ZnSO of 10g ₄7H ₂o, and deionized water adds to 1 liter of formation.

0.4% the yeast extract of YPG substratum in deionized water, 0.1% KH ₂pO ₄, 0.05% MgSO ₄7H ₂o, and 1.5% glucose forms.

1% the yeast extract of YPM substratum in deionized water, 2% peptone, and 2% maltose forms.

The sucrose of the 30g of Czapek ' s substratum in the deionized water of 1 liter of final volume, the NaNO of 3g ₃, the MgSO of 0.5g ₄7H ₂o, the FeSO of 0.01g ₄7H ₂o, the K of 1g ₂hPO ₄form with the KCl of 0.5g.PH is adjusted to pH4 with 1M HCl.

Minimum medium flat board is by the sucrose of 342g, the salts solution of 20ml, and the agar of 20g, and deionized water adds to 1 liter of formation.Salts solution is by 2.6%KCl, 2.6%MgSO ₄7H ₂o, 7.6%KH ₂pO ₄, 2ppm Na ₂b ₄o ₇10H ₂o, 20ppm CuSO ₄5H ₂o, 40ppm FeSO ₄7H ₂o, 40ppm MnSO ₄2H ₂o, 40ppm Na ₂moO ₄2H ₂o, and 400ppm ZnSO ₄7H ₂o forms.

NNCYP-PCS substratum is by the NaNO of 5.0g ₃, the NH of 3.0g ₄cl, the MES of 2.0g, the citric acid of 2.5g, the CaCl of 0.2g ₂2H ₂o, the bactopeptone of 1.0g, the yeast extract of 5.0g, the MgSO of 0.2g ₄7H ₂o, the K of 4.0g ₂hPO ₄, the COVE trace element solution of 1.0ml, the glucose of 2.5g, the PCS of 25.0g, and deionized water adds to 1 liter of formation.

Embodiment 1: extracting genome DNA

Thermophilic capital spore bacterial strain NN047338 is inoculated on PDA flat board and 45 ℃ of lucifuge incubations 3 days.Several mycelium-PDA bolt kinds are entered to contain to the 500ml shaking flask of the YPG substratum of 100ml.By bottle at 45 ℃ of incubations 3 days under 160rpm vibration.Mycelium by via (Calbiochem, La Jolla, CA, USA) filters and collects and freeze in liquid nitrogen.The mycelium freezing is milled to fine powder by mortar and pestle, and uses plant Maxi Kit (QIAGEN GmbH, Hilden, Germany) follows manufacturer's indication isolation of genomic DNA.

The mould NN051564 of camphor tree suede branch is inoculated on PDA flat board and 37 ℃ of incubation 4-5 days under 160rpm vibration.Mycelium is directly being collected into the mortar of sterilizing and is freezing under liquid nitrogen from agar plate.The mycelium freezing is milled to fine powder by mortar and pestle, and uses plant Mini Kit isolation of genomic DNA.

Camphor tree suede branch trichoderma strain NN044758 is inoculated on PDA flat board and 45 ℃ of lucifuge incubations 3 days.Several mycelium-PDA bolt kinds are entered to contain to the 500ml shaking flask of the YPG substratum of 100ml.By bottle at 45 ℃ of incubations 3 days under 160rpm vibration.Mycelium by via filter and collect and freeze in liquid nitrogen.The mycelium freezing is milled to fine powder by mortar and pestle, and uses Large-Scale Column Fungal DNAout (BAOMAN BIOTECHNOLOGY, Shanghai, China) according to manufacturer's indication isolation of genomic DNA.

Thermophilic excellent softgel shell bacterial strain NN000308 is inoculated on PDA flat board and 45 ℃ of lucifuge incubations 3 days.Several mycelium-PDA bolt kinds are entered to contain to the 500ml shaking flask of the YPG substratum of 100ml.By bottle at 45 ℃ of incubations 4 days under 160rpm vibration.Mycelium by via filter and collect and freeze in liquid nitrogen.The mycelium freezing is milled to fine powder by mortar and pestle, and uses plant Maxi Kit isolation of genomic DNA.

Penicillium oxalicum bacterial strain NN051380 is inoculated on PDA flat board and 25 ℃ of lucifuge incubations 5 days.Several mycelium-PDA bolt kinds are entered to contain to the 500ml shaking flask of Czapek ' the s substratum of 100ml.By bottle at 30 ℃ of incubations 3 days under 160rpm vibration.Mycelium by via filter and collect and freeze in liquid nitrogen.The mycelium freezing is milled to fine powder by mortar and pestle, and uses plant Maxi Kit isolation of genomic DNA.

Embodiment 2: the evaluation of camphor tree suede branch trichoderma strain NN051564GH10 zytase encoding sequence

The signal capture that the mould GH10 zytase of camphor tree suede branch encoding sequence is assisted by the transposon of the cDNA library of camphor tree suede branch trichoderma strain NN051564 is identified.

Camphor tree suede branch trichoderma strain is inoculated on PDA flat board and 45 ℃ of lucifuge incubations 4 days.Several mycelium-PDA bolt kinds are entered to contain to the 500ml shaking flask of the NNCYP-PCS substratum of 100ml.By bottle at 45 ℃ of incubations 6 days under 160rpm vibration.On the 3rd, the 4th, the 5th and the 6th, collect respectively mycelium.Then the mycelium from every day freezed in liquid nitrogen and be stored in-80 ℃ of refrigerated tanks until use.The mycelium freezing is transferred to mortar and the pestle of Liquid nitrogen precooler, and is milled to fine powder.From pulverous mycelium of every day, by using TRIzol reagent (Invitrogen Corporation, Carlsbad, CA, USA) to extract, prepare total RNA.The RNA of polyA enrichment passes through mTRAP ^tMtotal Kit (Active Motif, Carlsbad, CA, USA) separation.Double-stranded cDNA from every day is synthetic with SMART cDNA Library Construct Kit (Takara Bio Inc., Otsu, Shiga, Japan).By Sfi I cutting for cDNA, and cDNA is passed through to use 44mM Tris alkali, 44mM boric acid, 0.8% agarose gel electrophoresis size fractionation of 0.5mM edta buffer liquid.500bp and larger cDNA fraction are cut out and used from gel pCR DNA and Gel Band Purification Kit (GE Healthcare, Piscataway, NJ, USA) is according to manufacturer's indication purifying.Then the cDNA from every day of equivalent is collected for library construction.

Then the cDNA of preparation is carried out to directed cloning by the pMHas7 (WO2009/037253) that uses T4 ligase enzyme (New England Biolabs, Inc., Beverly, MA, USA) to connect into through Sfi I cutting according to manufacturer's indication.To connect mixture and use GENE and Pulse Controller (Bio-Rad Laboratories, Inc., Hercules, CA, USA) is with 25 μ F, 25mAmp, and 1.8kV enters intestinal bacteria ELECTROMAX with 1mm interval cuvette (cuvette) according to manufacturer's step electroporation ^tMdH10B ^tMcell (Invitrogen Corporation, Carlsbad, CA, USA).

Cell through electroporation is plated on the LB flat board of the kantlex that supplements every liter of 50mg.100,000 each the total transformant that connect from original pMHas7 carrier are prepared cDNA plasmid storehouse.Use Plasmid Kit (QIAGEN GmbH, Hilden, Germany) directly to prepare plasmid DNA from the bacterium colony in this storehouse.

The signal acquisition methods that transposon is assisted is described in WO2001/77315.Checked order by SinoGenoMax Company Limited (Beijing, China) in TAST plasmid storehouse.From the cDNA Sequence Identification being discharged by SinoGenoMax, gone out the frame of opening of camphor tree suede branch trichoderma strain NN051564GH10 zytase.The cDNA sequence of the mould GH10 zytase of camphor tree suede branch is identified by carrying out TFasty retrieval for several known GH10 zytase protein sequences as search sequence (query).TFasty compares protein sequence for DNA sequence data storehouse, calculates similarity, and allow the frameshit in codon at frameshit to forward and inverted orientation.Tfasty is a part of FASTA3 suite of programs (Pearson etc., 2000, Methods Mol.Biol.132:185-219).The cDNA sequence identifying is classified SEQ ID NO:21 as.

Embodiment 3: thermophilic capital spore bacterial strain NN047338, camphor tree suede branch trichoderma strain NN044758, gene order-checking, compilation and the annotation of thermophilic excellent softgel shell bacterial strain NN000308 and penicillium oxalicum bacterial strain NN051380

The genome DNA sample of extraction is delivered to Beijing Genome Institute (BGI, Shenzhen, China) for use the gene order-checking of GA2System (Illumina, Inc., San Diego, CA, USA).Skimming reading is taken to BGI and uses SOAPdenovo program (Li etc., 2010, Genome Research20 (2): 265-72) collect.Use standard biological Informatics Method to analyze for gene search (gene finding) and function prediction the sequence of compilation.In brief, use geneID (Parra etc., 2000, Genome Research10 (4): 511-515) carry out predictive genes.Use Blastall version 2 .2.10 (Altschul etc., 1990, J.Mol.Biol.215 (3): 403-410, National Center for Biotechnology Information (NCBI), Bethesda, MD, USA) and HMMER version 2 .1.1 (National Center for Biotechnology Information (NCBI), Bethesda, MD, USA) based on structural homology forecast function.GH10 xylan is by the analysis Direct Identification of Blast result.Use Agene program (Munch and Krogh, 2006, BMC Bioinformatics7:263) and SignalP program (Nielsen etc., 1997, Protein Engineering10:1-6) to identify initiator codon.Further use SignalP program predicted signal peptide.Use Pepstats (Rice etc., 2000, Trends Genet.16 (6): iso-electric point and the molecular weight of the aminoacid sequence that 276-277) prediction is derived.

Embodiment 4: from the thermophilic capital spore of genomic dna cloning bacterial strain NN047338GH10 zytase encoding sequence

Select the thermophilic capital spore bacterial strain NN047338GH10 zytase encoding sequence shown in four following tables 1 for clone.

Table 1:GH10 xylanase gene

Gene title	DNA sequence dna	Protein sequence
			GH10_ZY577198_20	SEQ?ID?NO:1	SEQ?ID?NO:2
GH10_ZY577319_22	SEQ?ID?NO:3	SEQ?ID?NO:4
			GH10_ZY577226_23	SEQ?ID?NO:5	SEQ?ID?NO:6
GH10_ZY577198_133	SEQ?ID?NO:7	SEQ?ID?NO:8

DNA information based on obtaining from gene order-checking (SEQ ID NO:1,3,5, and 7) has designed the Oligonucleolide primers that time shows with four the GH10 zytase encoding sequences of genomic dna amplification from thermophilic capital spore NN047338.Primer is by Invitrogen, Beijing, and China is synthetic.

SEQ ID1_ forward:

ACACAACTGGGGATCCACCatggcgaggctc(SEQ?ID?NO:22)

SEQ ID1_ is reverse:

GTCACCCTCTAGATCTcgacccccaaagaaatgggta(SEQ?ID?NO:23)

SEQ ID3_ forward:

ACACAACTGGGGATCCACCatgcgtttctccgcc(SEQ?ID?NO:24)

SEQ ID3_ is reverse:

GTCACCCTCTAGATCTaaattgcggtcacagagtccag(SEQ?ID?NO:25)

SEQ ID5_ forward:

ACACAACTGGGGATCCACCatgcatctcgcttcgtcgc(SEQ?ID?NO:26)

SEQ ID5_ is reverse:

GTCACCCTCTAGATCTaagtctccacccgcatcgac(SEQ?ID?NO:27)

SEQ ID7_ forward:

ACACAACTGGGGATCCACCatgagagctccgtc(SEQ?ID?NO:28)

SEQ ID7_ is reverse:

GTCACCCTCTAGATCT?gacaaatcttcacacagcccaatg(SEQ?ID?NO:29)

Lowercase represents the encoding sequence of gene in forward primer, and in reverse primer, represents the flanking region of gene, and capitalization portion homologous is in the insertion point of the pPFJO355 carrier described in WO2011005867.

For each gene, each primer pair of 20 picomole (forward and reverse primer) is reacted for PCR, described reaction is by the thermophilic capital spore NN047338 genomic dna of 2 μ l, 5X GC Buffer (the Finnzymes Oy of 10 μ l, Espoo, Finland), the DMSO of 1.5 μ l, the dATP of each 2.5mM, dTTP, dGTP and dCTP, the PHUSION of He0.6 unit ^tMhigh-Fidelity DNA Polymerase (Finnzymes Oy, Espoo, Finland) forms, and final volume is 50 μ l.Peltier Thermal Cycler (MJ Research Inc. is used in amplification, South San Francisco, CA, USA) carry out, its program is as follows: 98 ℃ of sex change 1 minute, and 6 circulations, each was 98 ℃ of sex change 15 seconds, 63 ℃ of annealing 30 seconds, every circulation reduced by 1 ℃, and extended 100 seconds at 72 ℃; 23 circulations, each carries out 15 seconds at 98 ℃, at 62 ℃, carries out 30 seconds, and 72 ℃ are carried out 100 seconds; And 72 ℃ of final extensions 7 minutes.Then heat block enters 4 ℃ of infusion.

PCR product, by using 90mM Tris-boric acid separated with 1.0% agarose gel electrophoresis of 1mM EDTA (TBE) damping fluid, is wherein observed from each PCR and is reacted product band as shown in table 2.Then use ILLUSTRA ^tMgFX ^tMpCR DNA and Gel Band Purification Kit (GE Healthcare, Buckinghamshire, UK) according to manufacturer's indication from solution purification PCR product.

The size of table 2:PCR product

Gene title	The size of PCR product
		GH10_ZY577198_20	1.4kb
GH10_ZY577319_22	1.4kb
		GH10_ZY577226_23	1.2kb
GH10_ZY577198_133	1.1kb

By Bam HI and Bgl II digestion for plasmid pPFJO355, by using 1.0% agarose gel electrophoresis of tbe buffer liquid separated, and use ILLUSTRA ^tMgFX ^tMpCR DNA and Gel Band Purification Kit is according to manufacturer's indication purifying.

Table 3: plasmid

Gene title	Plasmid	DNA figure
			GH10_ZY577198_20	pGH10_ZY577198_20	Fig. 1
GH10_ZY577319_22	pGH10_ZY577319_22	Fig. 2
			GH10_ZY577226_23	pGH10_ZY577226_23	Fig. 3
GH10_ZY577198_133	pGH10_ZY577198_133	Fig. 4

The plasmid of PCR product and digestion is used cF Dry-down PCR Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA, USA) link together, obtain plasmid (table 3) pGH10_ZY577198_20 (Fig. 1), pGH10_ZY577319_22 (Fig. 2), pGH10_ZY577226_23 (Fig. 3), and pGH10_ZY577198_133 (Fig. 4), wherein thermophilic capital spore GH10 zytase encoding sequence transcribes under the regulation and control in aspergillus oryzae alpha-amylase gene promotor.For each ligation, by the pPFJO355 with Bam HI and Bgl II digestion of 30ng, be added into independent reaction bottle with each thermophilic capital spore GH10 zytase PCR product of the purifying of 60ng, and by adding deionized water, be resuspended in the final volume of 10 μ l.To react 37 ℃ of incubations 15 minutes then 50 ℃ of incubations 15 minutes.Use each reaction of three μ l to transform intestinal bacteria TOP10 competent cells (TIANGEN Biotech (Beijing) Co.Ltd., Beijing, China).The intestinal bacteria transformant that contains every kind of expression construct detects by bacterium colony PCR.Bacterium colony PCR is the method for inserting from intestinal bacteria bacterium colony rapid screening plasmid for directly.In brief, the premixed PCR solution aliquots containig in each PCR pipe (comprises PCR damping fluid, MgCl ₂, dNTP, and PCR fragment generates primer pair used) in, by with sterilizing move liquid point picking, and the described liquid point that moves is rotated and adds single bacterium colony in reaction soln.Conventionally screened 7-10 bacterium colony.After PCR, reaction is analyzed by 1.0% agarose gel electrophoresis with tbe buffer liquid.Use spin Miniprep Kit (QIAGEN GmbH, Hilden, Germany) prepares plasmid DNA from showing the bacterium colony of the big or small inset with expectation.PGH10_ZY577198_20, pGH10_ZY577319_22, pGH10_ZY577226_23, pass through to use 3730XL DNA Analyzer (Applied Biosystems Inc. with the thermophilic capital spore GH10 xylanase gene inserting in pGH10_ZY577198_133, Foster City, CA, USA) DNA sequencing confirm.

Embodiment 5: from genomic dna cloning camphor tree suede branch trichoderma strain NN051564GH10 zytase encoding sequence

The cDNA information (SEQ ID NO:21) that gene trap based on assisting from transposon obtains, has designed the Oligonucleolide primers that time shows with the genomic dna amplification GH10 zytase encoding sequence (xyn13) from camphor tree suede branch trichoderma strain NN051564.Primer is by Invitrogen, Beijing, and China is synthetic.

Forward primer:

ACACAACTGGGGATCCACCatgcgcatatcactcgttcttc(SEQ?ID?NO:30)

Reverse primer:

GTCACCCTCTAGATCTctactgcaaggactgggcaacag(SEQ?ID?NO:31)

Lowercase represents the coding region of gene, and capitalization is the district with coming from the insertion point of plasmid pPFJO355.

By two primers of 20 picomole, for PCR reaction, described reaction is by the mould NN051564 genomic dna of camphor tree suede branch of 4 μ l, the 5X GC Buffer of 10 μ l, the DMSO of 1.5 μ l, the dATP of each 2.5mM, dTTP, dGTP and dCTP, the PHUSION of He0.6 unit ^tMhigh-Fidelity DNA Polymerase forms, and final volume is 50 μ l.Amplification is used Peltier Thermal Cycler to carry out, and its program is as follows: 94 ℃ of sex change 3 minutes, and 5 circulations, 94 ℃ of sex change 40 seconds, 63 ℃ of annealing 40 seconds, every circulation raise 1 ℃, and extended 90 seconds at 72 ℃; 24 circulations, each carries out 40 seconds at 94 ℃, and 68 ℃ are carried out 40 seconds, and 72 ℃ are carried out 90 seconds; With 72 ℃ of final extensions 10 minutes.Then heat block enters 10 ℃ of infusion.

The PCR reaction of three μ l, by using 1.0% agarose gel electrophoresis of tbe buffer liquid to analyze, is wherein observed to the single band of about 1.6kb.Remaining PCR reaction is used to ILLUSTRA ^tMgFX ^tMpCR DNA and Gel Band Purification Kit purifying.

By Bam HI and Bgl II digestion for plasmid pPFJO355, by using 1.0% agarose gel electrophoresis of tbe buffer liquid separated, and use ILLUSTRA ^tMgFX ^tMpCR DNA and Gel Band Purification Kit is according to manufacturer's indication purifying.The carrier of PCR product and digestion is used cF Dry-down PCR Cloning Kit links together, and obtains plasmid pxyn13 (Fig. 5), and wherein the mould GH10 zytase of camphor tree suede branch encoding sequence transcribes under the regulation and control in aspergillus oryzae Alpha-starch gene promoter.For ligation, the pPFJO355 by 30ng with Bam HI and Bgl II digestion, and the mould GH10 zytase of the camphor tree suede branch PCR product of 60ng purifying is added into reaction bottle, and by adding deionized water, be resuspended in the final volume of 10 μ l.To react 37 ℃ of incubations 15 minutes, then 50 ℃ of incubations 15 minutes.Use the reaction of three μ l to transform intestinal bacteria TOP10 competent cell.The intestinal bacteria transformant that contains expression construct detects as described in example 4 above by bacterium colony PCR, and uses spin Miniprep Kit prepares plasmid DNA.The mould GH10 zytase of camphor tree suede branch inserting in pxyn13 is by confirming with the DNA sequencing of 3730XL DNA Analyzer.The genomic dna sequence of the mould GH10 zytase of camphor tree suede branch encoding sequence and the aminoacid sequence of derivation are shown respectively SEQ ID NO:9 and 10.

Embodiment 6: from genomic dna cloning camphor tree suede branch trichoderma strain NN044758GH10 zytase encoding sequence

The DNA information that gene order-checking based on from camphor tree suede branch trichoderma strain NN044758 obtains, has designed the Oligonucleolide primers time showing and has come the genomic dna amplification GH10 zytase encoding sequence from the mould NN044758 of camphor tree suede branch, GH10_ZY582331_279.Primer is by Invitrogen, Beijing, and China is synthetic.

Forward primer:

ACACAACTGGGGATCCACCatggtgaagctactcccagtcatcg(SEQ?ID?NO:32)

Reverse primer:

GTCACCCTCTAGATCTcgccaacagatcctaatgggac(SEQ?ID?NO:33)

Lowercase represents the coding region of gene in forward primer, and in reverse primer, represents the flanking region of gene, and capitalization portion homologous is in the insertion point of pPFJO355 carrier.

Each forward of 20 picomole and reverse primer are reacted for PCR, described reaction is by the mould NN044758 genomic dna of camphor tree suede branch of 2 μ l, the 5X GC Buffer of 10 μ l, the DMSO of 1.5 μ l, the dATP of each 2.5mM, dTTP, dGTP and dCTP, the PHUSION of He0.6 unit ^tMhigh-Fidelity DNA Polymerase forms, and final volume is 50 μ l.Amplification is used Peltier Thermal Cycler to carry out, and its program was as follows: 94 ℃ of sex change 1 minute; 6 circulations, each was 94 ℃ of sex change 15 seconds, and 68 ℃ of annealing 30 seconds, every circulation reduced 1 ℃, and extended 100 seconds at 72 ℃; 23 circulations, each carries out 15 seconds at 94 ℃, and 63 ℃ are carried out 30 seconds, and carry out 100 seconds at 72 ℃; With 72 ℃ of final extensions 5 minutes.Then heat block enters 4 ℃ of submergence circulations.

PCR product, by using 1.0% agarose gel electrophoresis of tbe buffer liquid separated, is wherein observed the single product band of 1.4kb.Then PCR product is used to ILLUSTRA ^tMgFX ^tMpCR DNA and Gel Band Purification Kit according to manufacturer's indication from solution purification.

By Bam HI and Bgl II digestion for plasmid pPFJO355, by using 1.0% agarose gel electrophoresis of tbe buffer liquid separated, and use LLUSTRA ^tMgFX ^tMpCR DNA and Gel Band Purification Kit is according to manufacturer's indication purifying.Use cF Dry-down Cloning Kit enters expression vector pPFJO355 by fragment Direct Cloning, without restrictive diges-tion and connection.The carrier of PCR product and digestion is used cF Dry-down PCR Cloning Kit links together, and obtains plasmid pGH10_ZY582331_279 (Fig. 6), and wherein the mould GH10 zytase of camphor tree suede branch encoding sequence transcribes under the regulation and control in aspergillus oryzae alpha-amylase gene promotor.For ligation, the pPFJO355 by 30ng with Bam HI and Bgl II digestion, and the mould GH10 zytase of the camphor tree suede branch PCR product of 60ng purifying is added into reaction bottle, and by adding deionized water, be resuspended in the final volume of 10 μ l.To react 37 ℃ of incubations 15 minutes, then 50 ℃ of incubations 15 minutes.Use the reaction of three μ l to transform intestinal bacteria TOP10 competent cell.The intestinal bacteria transformant that contains expression construct detects as described in example 4 above by bacterium colony PCR, and uses spin Miniprep Kit prepares plasmid DNA.The mould GH10 zytase of the camphor tree suede branch encoding sequence inserting in pGH10_ZY582331_279 is by being used the DNA sequencing of 3730XL DNA Analyzer to confirm.

The aminoacid sequence of genomic dna sequence and derivation is shown respectively SEQ ID NO:11 and SEQ ID NO:12.

Embodiment 7: from the thermophilic excellent softgel shell CBS174.70GH10 zytase encoding sequence of genomic dna cloning

Selected three the GH10 xylanase genes from thermophilic excellent softgel shell bacterial strain CBS174.70 that are shown in following table 4 to clone.

Table 4:GH10 xylanase gene

Gene title	DNA sequence dna	Protein sequence
			GH10_Mf4036	SEQ?ID?NO:13	SEQ?ID?NO:14
GH10_Mf2809	SEQ?ID?NO:15	SEQ?ID?NO:16
			GH10_Mf0530	SEQ?ID?NO:17	SEQ?ID?NO:18

The DNA information that gene order-checking based on from thermophilic excellent softgel shell bacterial strain CBS174.70 obtains, has designed the Oligonucleolide primers that time shows from the genomic dna amplification GH10 zytase encoding sequence of thermophilic excellent softgel shell bacterial strain CBS174.70.Primer is by Invitrogen, Beijing, and China is synthetic.

SEQ ID14_ forward:

ACACAACTGGGGATCCACCatgcggttttctgcgcctc(SEQ?ID?NO:34)

SEQ ID14_ is reverse:

GTCACCCTCTAGATCTaccgtccaccgttcctcttagag(SEQ?ID?NO:35)

SEQ ID16_ forward:

ACACAACTGGGGATCCACCatgcgactctccgcg(SEQ?ID?NO:36)

SEQ ID16_ is reverse:

GTCACCCTCTAGATCTcacaggttggggggatgag(SEQ?ID?NO:37)

SEQ ID18_ forward:

ACACAACTGGGGATCCACCatgcgtactctcgccttcg(SEQ?ID?NO:38)

SEQ ID18_ is reverse:

GTCACCCTCTAGATCTacccatccatcacaatcacac(SEQ?ID?NO:39)

Lowercase represents the encoding sequence of the gene in forward primer, and represents the flanking sequence in reverse primer, and capitalization portion homologous is in the insertion point of pPFJO355 carrier.

For each gene, each primer pair of 20 picomole (forward and reverse primer) is reacted for PCR, described reaction is by the thermophilic excellent softgel shell NN000308 genomic dna of 2 μ l, 5X HF/GC Buffer (the Finnzymes Oy of 10 μ l, Espoo, Finland), the DMSO of 1.5 μ l, the dATP of each 2.5mM, dTTP, dGTP and dCTP, the PHUSION of He0.6 unit ^tMhigh-Fidelity DNA Polymerase (Finnzymes Oy, Espoo, Finland) forms, and final volume is 50 μ l.

The amplification of GH10_Mf0530 is used Peltier Thermal Cycler to carry out, and its program was as follows: 98 ℃ of sex change 1 minute; 10 circulations, each was 98 ℃ of sex change 15 seconds, and 70 ℃ of annealing 30 seconds, every circulation declined 1 ℃, and extended 90 seconds at 72 ℃; 20 circulations, often circulate in 94 ℃ and carry out 30 seconds, carry out 30 seconds, and carry out 90 seconds at 72 ℃ at 60 ℃; With 72 ℃ of final extensions 5 minutes.Then heat block enters 4 ℃ of infusion.

The amplification of GH10_Mf4036 and GH10_Mf2809 is used Peltier Thermal Cycler to carry out, and its program was as follows: 98 ℃ of sex change 1 minute; 7 circulations, 65 ℃ of annealing 30 seconds, every circulation declined 1 ℃, and extended 2 minutes at 72 ℃; 25 circulations, often circulate in 94 ℃ and carry out 30 seconds, carry out 30 seconds, and carry out 2 minutes at 72 ℃ at 60 ℃; With 72 ℃ of final extensions 5 minutes.Then heat block enters 4 ℃ of infusion.

PCR product, by using 1.0% agarose gel electrophoresis of tbe buffer liquid separated, is wherein observed to the product band from each PCR reaction as shown in table 5.Then PCR product is used to ILLUSTRA ^tMgFX ^tMpCR DNA and Gel Band Purification Kit according to manufacturer's indication from solution purification.GH10_Mf4036 and GH10_Mf5030 are all presented at the PCR product of about 1.4kb, and GH10_Mf2809 is presented at the PCR product of about 1.5kb.

The size of table 5:PCR product

Gene title	The size of PCR product
		GH10_Mf4036	～1.4kb
GH10_Mf2809	～1.5kb
		GH10_Mf0530	～1.4kb

Table 6: plasmid

Gene title	Plasmid	DNA figure
			GH10_Mf4036	pGH10_Mf4036	Fig. 7
GH10_Mf2809	pGH10_Mf2809	Fig. 8
			GH10_Mf0530	pGH10_Mf0530	Fig. 9

The carrier of PCR product and digestion is used cF Dry-down PCR Cloning Kit links together, obtain plasmid (table 6) pGH10_Mf4036 (Fig. 7), pGH10_Mf2809 (Fig. 8), and pGH10_Mf0530 (Fig. 9), wherein thermophilic excellent softgel shell GH10 zytase encoding sequence transcribes under the regulation and control in aspergillus oryzae alpha-amylase gene promotor.In brief, for each ligation, pPFJO355 by 30ng with Bam HI and Bgl II digestion, and the thermophilic excellent softgel shell GH10 zytase PCR product of the purifying of each 60ng is added into else reaction bottle, and by adding deionized water, be resuspended in the final volume of 10 μ l.To react 37 ℃ of incubations 15 minutes, then 50 ℃ of incubations 15 minutes.Use each reaction of three μ l for transforming intestinal bacteria TOP10 competent cell (TIANGEN Biotech (Beijing) Co.Ltd., Beijing, China).The intestinal bacteria transformant that contains each expression construct detects as described in example 4 above by bacterium colony PCR.Insert pGH10_Mf4036, pGH10_Mf2809, and the thermophilic excellent softgel shell GH10 xylanase gene of pGH10_Mf0530 is by being used 3730XL DNA Analyzer (Applied BiosystemsInc, Foster City, CA, USA) DNA sequencing confirm.

Embodiment 8: from genomic dna cloning penicillium oxalicum bacterial strain NN051380GH10 zytase encoding sequence

The gene information that gene order-checking based on by penicillium oxalicum bacterial strain NN051380 is carried out obtains, design the Oligonucleolide primers time showing and come the genomic dna amplification GH10 zytase encoding sequence from penicillium oxalicum bacterial strain NN051380, GH10_ZY569164_676.

Forward primer:

ACACAACTGGGGATCCACCatgcgctccacgttcatgg(SEQ?ID?NO:40)

Reverse primer:

GTCACCCTCTAGATCTgaagcatcctctagtgaggcctatcaa(SEQ?ID?NO:41)

Lowercase represents the coding region of the gene in forward primer and in reverse primer, represents the flanking region of gene, and capitalization portion homologous is in the insertion point of pPFJO355 carrier.

Use cF Dry-down Cloning Kit enters expression vector pPFJO355 by fragment Direct Cloning, without restrictive diges-tion and connection.

By each above-mentioned primer of 20 picomole, for PCR reaction, described reaction is by the penicillium oxalicum genomic dna of 2 μ l, the 5X GC Buffer of 10 μ l, the DMSO of 1.5 μ l, the dATP of each 2.5mM, dTTP, dGTP and dCTP, the PHUSION of He0.6 unit ^tMhigh-Fidelity DNA Polymerase forms, and final volume is 50 μ l.Amplification is used Peltier Thermal Cycler to carry out, and its program was as follows: 98 ℃ of sex change 1 minute; 6 circulations, each was 98 ℃ of sex change 15 seconds, and 65 ℃ of annealing 30 seconds, every circulation reduced by 1 ℃, and extended 70 seconds at 72 ℃; 25 circulations, each carries out 15 seconds at 98 ℃, carries out 30 seconds, and carry out 70 seconds at 72 ℃ at 62 ℃; With 72 ℃ of final extensions 5 minutes.Then heat block enters 4 ℃ of infusion.

Reaction product is by being used 1.0% agarose gel electrophoresis of tbe buffer liquid separated, and wherein approximately 1.2kb product band cuts out from gel, and uses ILLUSTRA ^tMgFX ^tMpCR DNA and Gel Band Purification Kit is according to manufacturer's indication purifying.

By Bam HI and Bgl II digestion for plasmid pPFJO355, by using 1.0% agarose gel electrophoresis of tbe buffer liquid separated, and use ILLUSTRA ^tMgFX ^tMpCR DNA and Gel Band Purification Kit is according to manufacturer's indication purifying.The carrier of PCR product and digestion is used cF Dry-down PCR Cloning Kit links together, and obtains pGH10_ZY569164_676 (Figure 10), and wherein penicillium oxalicum GH10 zytase encoding sequence transcribes under the regulation and control in aspergillus oryzae alpha-amylase gene promotor.For ligation, the pPFJO355 by 30ng with Bam HI and Bgl II digestion, and the penicillium oxalicum GH10 zytase purified pcr product of 60ng is added into reaction bottle, and by adding deionized water, be resuspended in the final volume of 10 μ l.To react 37 ℃ of incubations 15 minutes, then 50 ℃ of incubations 15 minutes.Use the reaction of three μ l to transform intestinal bacteria TOP10 competent cell.The intestinal bacteria transformant that contains pGH10_ZY569164_676 detects as described in example 4 above by bacterium colony PCR, and uses spin Miniprep Kit prepares plasmid DNA.The penicillium oxalicum GH10 xylanase gene inserting in pGH10_ZY569164_676 is confirmed by the DNA sequencing of use 3730XL DNA Analyzer.

The aminoacid sequence of genomic dna sequence and derivation is shown respectively SEQ ID NO:19 and SEQ ID NO:20.

Embodiment 9: the sign of the genomic dna of coding GH10 zytase

The genomic dna sequence of thermophilic capital spore GH10 zytase encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:1 (D822JR) and SEQ ID NO:2 (P244XT).Encoding sequence is 1314bp, comprises terminator codon, and its intron by a 89bp (Nucleotide 374 to 462) interrupts.The albumen of the prediction of coding is 406 amino acid.Use SignalP program (Nielsen etc., 1997, Protein Engineering10:1-6), predicted the signal peptide of 20 residues.The maturation protein of prediction contains 386 amino acid, has the molecular weight of the prediction of 42.38kDa, and the iso-electric point of 4.61 prediction.

Use Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, that J.Mol.Biol.48:443-453) with the open point penalty of 10 breach, 0.5 breach, extends that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the thermophilic capital spore genomic dna of comparison code displaying GH10 zytase has 54.62% identity (eliminating breach) with the aminoacid sequence (UNIPROT E3Q8L2) of the derivation of the GH10 zytase from the raw anthrax-bacilus of standing grain (Colletotrichum graminicola).

The genomic dna sequence of thermophilic capital spore GH10 zytase encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:3 (D822JT) and SEQ ID NO:4 (P244XW).Encoding sequence is 1350bp, comprise terminator codon, it is by 54bp (Nucleotide 84 to 137), 80bp (Nucleotide 542 to 621), 75bp (Nucleotide 669 to 743), and four introns of 58bp (Nucleotide 1158 to 1215) interrupt.The albumen of the prediction of coding is 360 amino acid.Use SignalP program (Nielsen etc., 1997, see above), predicted the signal peptide of 17 residues.The maturation protein of prediction contains 343 amino acid, has the molecular weight of prediction and the iso-electric point of 7.17 prediction of 38.93kDa.

That uses that Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, see above) the open point penalty of breach with 10,0.5 breach extend that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the thermophilic capital spore genomic dna of comparison code displaying GH10 zytase has 68.28% identity (eliminating breach) with the aminoacid sequence (UNIPROT B6DQK8) of the derivation of the GH10 zytase from the withered septoria musiva of grain husk (Phaeosphaeria nodorum).

The genomic dna sequence of thermophilic capital spore GH10 zytase encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:5 (D822JW) and SEQ ID NO:6 (P244Y1).Encoding sequence is 1199bp, comprises terminator codon, and its intron by 68bp (Nucleotide 265 to 332) interrupts.The albumen of the prediction of coding is 376 amino acid.Use SignalP program (Nielsen etc., 1997, see above), predicted the signal peptide of 18 residues.The maturation protein of prediction contains 358 amino acid, has the molecular weight of prediction and the iso-electric point of 6.30 prediction of 40.29kDa.

That uses that Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, see above) the open point penalty of breach with 10,0.5 breach extend that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the thermophilic capital spore genomic dna of comparison code displaying GH10 zytase has 78.59% identity (eliminating breach) with the aminoacid sequence (GENESEQP AEB00303) of the derivation of the GH10 zytase from Corynascus heterothallicus.

The genomic dna sequence of thermophilic capital spore GH10 zytase encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:7 (D822JX) and SEQ ID NO:8 (P244Y2).Encoding sequence is 1104bp, comprises terminator codon, without any intron.The albumen of the prediction of coding is 367 amino acid.Use SignalP program (Nielsen etc., 1997, see above), predicted the signal peptide of 22 residues.The maturation protein of prediction contains 345 amino acid, has the molecular weight of prediction and the iso-electric point of 5.42 prediction of 39.03kDa.

That uses that Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, see above) the open point penalty of breach with 10,0.5 breach extend that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the thermophilic capital spore genomic dna of comparison code displaying GH10 zytase has 77.98% identity (eliminating breach) with the aminoacid sequence (UNIPROT B2B789) of the derivation of the GH10 zytase from goose Podospora (Podospora anserina).

The genomic dna sequence of the mould GH10 zytase of camphor tree suede branch encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:9 (D6RM) and SEQ ID NO:10 (P23DM4).Encoding sequence is 1623bp, comprise terminator codon, it is by 76bp (Nucleotide 239 to 314), 59bp (Nucleotide 356 to 414), 68bp (Nucleotide 464 to 531), 63bp (Nucleotide 654 to 716), 62bp (Nucleotide 863 to 925), 60bp (Nucleotide 1015 to 1074), 68bp (Nucleotide 1094 to 1161), 56bp (Nucleotide 1189 to 1244), 73bp (Nucleotide 1334 to 1406), and ten introns of 58bp (Nucleotide 1473 to 1530) interrupt.The albumen of the prediction of coding is 326 amino acid.Use SignalP program (Nielsen etc., 1997, see above), predicted the signal peptide of 18 residues.The maturation protein of prediction contains 308 amino acid, has the molecular weight of prediction and the iso-electric point of 4.89 prediction of 33.52kDa.

That uses that Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, see above) the open point penalty of breach with 10,0.5 breach extend that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the mould genomic dna of camphor tree suede branch of comparison code displaying GH10 zytase has 66.88% identity (eliminating breach) with the aminoacid sequence (UNIPROT E3QSE3) of the derivation of the GH10 zytase from the raw anthrax-bacilus of standing grain.

The genomic dna sequence of the mould GH10 zytase of camphor tree suede branch encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:11 (D82DB2) and SEQ ID NO:12 (P249XY).Encoding sequence is 1365bp, comprises terminator codon, and it is by 772bp (Nucleotide 78 to 149), 84bp (Nucleotide 319 to 402), and 66bp (Nucleotide 536 to 601), and four introns of 78bp (Nucleotide 716 to 793) interrupt.The albumen of the prediction of coding is 354 amino acid.Use SignalP program (Nielsen etc., 1997, see above), predicted the signal peptide of 20 residues.The maturation protein of prediction contains 334 amino acid, has the molecular weight of prediction and the iso-electric point of 6.17 prediction of 38.70kDa.

That uses that Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, see above) the open point penalty of breach with 10,0.5 breach extend that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the mould genomic dna of camphor tree suede branch of comparison code displaying GH10 zytase has 61.56% identity (eliminating breach) with the aminoacid sequence (UNIPROT AZI24748) of the derivation of the GH10 zytase from Aspergillus fumigatus.

The genomic dna sequence of thermophilic excellent softgel shell GH10 zytase encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:13 (D1316T) and SEQ ID NO:14 (P24MCW).Encoding sequence is 1513bp, comprises terminator codon, and it is by 120bp (Nucleotide 81 to 200), 182bp (Nucleotide 602 to 783), and three introns of 143bp (Nucleotide 1245 to 1387) interrupt.The albumen of the prediction of coding is 355 amino acid.Use SignalP program (Nielsen etc., 1997, see above), predicted the signal peptide of 17 residues.The maturation protein of prediction contains 338 amino acid, has the molecular weight of prediction and the iso-electric point of 5.08 prediction of 37.98kDa.

That uses that Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, see above) the open point penalty of breach with 10,0.5 breach extend that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the thermophilic excellent softgel shell genomic dna of comparison code displaying GH10 zytase has 70.25% identity (eliminating breach) with the aminoacid sequence (UNIPROT B6DQK8) of the derivation of the GH10 zytase from the withered septoria musiva of grain husk.

The genomic dna sequence of thermophilic excellent softgel shell GH10 zytase encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:15 (D1315U) and SEQ ID NO:16 (P24MCX).Encoding sequence is 1101bp, comprises terminator codon, intronless.The albumen of the prediction of coding is 366 amino acid.Use SignalP program (Nielsen etc., 1997, see above), predicted the signal peptide of 19 residues.The maturation protein of prediction contains 347 amino acid, has the molecular weight of prediction and the iso-electric point of 7.77 prediction of 39.58kDa.

That uses that Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, see above) the open point penalty of breach with 10,0.5 breach extend that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the thermophilic excellent softgel shell genomic dna of comparison code displaying GH10 zytase has 74.93% identity (eliminating breach) with the aminoacid sequence (UNIPROT B2B789) of the derivation of the GH10 zytase from goose Podospora.

The genomic dna sequence of thermophilic excellent softgel shell GH10 zytase encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:17 (D82PQC) and SEQ ID NO:18 (P24FVF).Encoding sequence is 1365bp, comprises terminator codon, and it is by 74bp (Nucleotide 74 to 147), 67bp (Nucleotide 212 to 278), and three introns of 78bp (Nucleotide 530 to 607) interrupt.The albumen of the prediction of coding is 381 amino acid.Use SignalP program (Nielsen etc., 1997, see above), predicted the signal peptide of 17 residues.The maturation protein of prediction contains 364 amino acid, has the molecular weight of prediction and the iso-electric point of 6.37 prediction of 39.42kDa.

That uses that Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, see above) the open point penalty of breach with 10,0.5 breach extend that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the thermophilic excellent softgel shell genomic dna of comparison code displaying GH10 zytase has 86.98% identity (eliminating breach) with the aminoacid sequence (GENESEQP ABB05060) of the derivation of the GH10 zytase from Chrysosporium kind (Chrysosporium sp.).

The genomic dna sequence of penicillium oxalicum GH10 zytase encoding sequence and the aminoacid sequence of derivation are shown in SEQ ID NO:19 (D72UED) and SEQ ID NO:20 (P241KU).Encoding sequence is 1168bp, comprises terminator codon, and its intron by 79bp (Nucleotide 235 to 313) interrupts.The albumen of the prediction of coding is 362 amino acid.Use SignalP program (Nielsen etc., 1997, see above), predicted the signal peptide of 17 residues.The maturation protein of prediction contains 345 amino acid, has the molecular weight of prediction and the iso-electric point of 5.73 prediction of 38.06kDa.

That uses that Needleman and Wunsch algorithm (Needleman and Wunsch, 1970, see above) the open point penalty of breach with 10,0.5 breach extend that point penalty and EBLOSUM62 matrix determined aminoacid sequence is comparative by overall comparison.The aminoacid sequence of the derivation of the penicillium oxalicum genomic dna of comparison code displaying GH10 zytase has 82.22% identity (eliminating breach) with the aminoacid sequence (UNIPROT C3VEV9) of derivation from turing the GH10 zytase of grey mould (Penicillium canescens).

Embodiment 10: the expression of thermophilic capital spore GH10 zytase encoding sequence

Aspergillus oryzae HowB101 (WO95/35385) protoplastis is according to Christensen etc., 1988, the method preparation of Bio/Technology6:1419-1422, and use respectively the pGH10_ZY577319_22 of 3 μ g, the pGH10_ZY577226_23 of 3 μ g, and the pGH10_ZY577198_133 of 3 μ g transforms.For each, transform, transform and produce about 50 transformant.Eight transformant from each conversion are separated to independent minimum medium dull and stereotyped.

To from four transformant of each conversion, inoculate respectively the YPM substratum of the 3ml in 24 orifice plates, and at 30 ℃ of incubations under 150rpm mixes.After incubation on the 3rd, the supernatant of the 20 μ l from each cultivation is had to MES's by use the SDS-PAGE of 4-12%Bis-Tris Gel (Invitrogen Corporation, Carlsbad, CA, USA) analyzes according to manufacturer's indication.By the gel INSTANTBLUE of gained ^tM(Expedeon Ltd., Babraham Cambridge, UK) dyeing.The SDS-PAGE general picture of cultivating shows the albumen shown in described three encoding sequences expression following table 7.Expression strain is named as shown in the second hurdle.

Table 7: the expression of thermophilic capital spore GH10 zytase encoding sequence

Plasmid	Expression strain	The size of recombinant protein (Kd)
			pGH10_ZY577319_22	O5KR9	40kDa
pGH10_ZY577226_23	O5KRD	Two bands at 45kDa (by force) and 40kDa (weak)
			pGH10_ZY577198_133	O5KRG	Two bands at 46kDa and 40kDa

Embodiment 11: the expression of the mould NN051564GH10 zytase of camphor tree suede branch encoding sequence

Aspergillus oryzae HowB101 protoplastis is according to Christensen etc., and 1988, the method preparation seeing above, and with the pxyn13 conversion of 3 μ g.Transform and produce approximately 50 transformant.Eight transformant are separated to single minimum medium dull and stereotyped.

Four transformant are inoculated respectively to the YPM substratum of the 3ml in 24 orifice plates, and at 30 ℃ of incubations under 150rpm mixes.After incubation on the 3rd, the supernatant of the 20 μ l from each cultivation is had to MES's by use the SDS-PAGE of 4-12%Bis-Tris Gel analyzes according to manufacturer's indication.By the gel INSTANTBLUE of gained ^tMdyeing.The SDS-PAGE general picture of culture shows 2 albumen of expressing about 34kDa in 4 transformant.By expression strain, transformant 4, called after aspergillus oryzae EXP02789.

Embodiment 12: the expression of thermophilic excellent softgel shell CBS174.70GH10 zytase encoding sequence

Aspergillus oryzae HowB101 protoplastis is according to Christensen etc., the method preparation of 1988, Bio/Technology6:1419-1422, and use respectively the pGH10_Mf4036 of 3 μ g, and the pGH10_Mf0530 of 3 μ g transforms.Each transforms and produces about 50 transformant.Eight transformant from each conversion are separated to independent minimum medium dull and stereotyped.

To from four transformant of each conversion, inoculate respectively the YPM substratum of the 3ml in 24 orifice plates, and at 30 ℃ of incubations under 150rpm mixes.After incubation on the 3rd, the supernatant of the 20 μ l from each cultivation is had to MES's by use the SDS-PAGE of 4-12%Bis-Tris Gel analyzes according to manufacturer's indication.By the gel INSTANTBLUE of gained ^tM(Expedeon Ltd., Babraham Cambridge, UK) dyeing.The SDS-PAGE general picture of cultivating shows the albumen shown in described three encoding sequences expression following table 8.Expression strain is named as shown in the second hurdle.

Table 8: the expression of thermophilic excellent softgel shell CBS174.70GH10 zytase encoding sequence

Plasmid	Expression strain	The size of recombinant protein
			pGH10_Mf4036	O7R3T	42kDa
pGH10_Mf0530	O7J26	40kDa

Embodiment 13: the expression of penicillium oxalicum GH10 xylanase gene

Aspergillus oryzae HowB101 protoplastis is according to Christensen etc., and 1988, the method preparation seeing above, and with the pGH10_ZY569164_676 conversion of 3 μ g.Transform and produce approximately 50 transformant.Four transformant are separated to single minimum medium dull and stereotyped.

Four transformant are inoculated respectively to the YPM substratum of the 3ml in 24 orifice plates, and at 30 ℃ of incubations under 150rpm mixes.After incubation on the 3rd, the supernatant of the 20 μ l from each cultivation is had to MES's by use the SDS-PAGE of 4-12%Bis-Tris Gel analyzes according to manufacturer's indication.By the gel INSTANTBLUE of gained ^tMdyeing.The SDS-PAGE general picture of culture shows that most transformant have main band at about 46kDa.By expression strain called after aspergillus oryzae O4S5C.

Embodiment 14: the fermentation of expression strain

Use the 2L shaking flask of 4 to 6 YPM that contain 400ml of inclined plane inoculating of each transformant.Total volume of culture of each expression strain is shown in table 9.Then by shaking flask at 30 ℃, 80rpm vibration 3 days.Culture was gathered in the crops on 3rd, and used 0.45 μ m membrane (Millipore, Bedford, MA, USA) filters.

Table 9: the fermentation of expression strain

Expression strain	Volume of culture (ml)
		O5KR9	2400
O5KRD	1600
		EXP02789	1600
O7R3T	3200
		O4S5C	2000

Embodiment 15: from aspergillus oryzae strain O5KR9, and O5KRD, EXP02789, the GH10 zytase of O4S5C and O7R3T purification of Recombinant

By the aspergillus oryzae O5KR9 of 2400ml volume ammonium sulfate (80% is saturated) precipitation for supernatant, be again dissolved in the 20mM sodium acetate pH5.5 of 50ml, for same damping fluid dialysis, and filter by 0.45 μ m strainer.Final volume is 80ml.Solution is imposed on to the 30ml SP by 20mM sodium acetate pH5.5 balance fast Flow post (GE Heathcare Life Sciences, Piscataway, NJ, USA), and albumen is used to linear 0-0.5M NaCl gradient elution.Collect fraction and impose on the Q by 20mM sodium acetate pH5.5 balance fast Flow post (GE Heathcare Life Sciences, Piscataway, NJ, USA).Collect fraction, and have MES's by use the SDS-PAGE of 4-12%Bis-Tris Gel analyzes.Collect the fraction containing at the band of about 40kDa, and pass through ultrafiltration and concentration.

By the aspergillus oryzae O5KRD of 1600ml volume ammonium sulfate (80% is saturated) precipitation for supernatant, be again dissolved in the 20mM sodium acetate pH5.5 of 50ml, for same damping fluid dialysis, and filter by 0.45 μ m strainer.Final volume is 60ml.Solution is imposed on to the 40ml Q by 20mM sodium acetate pH5.0 balance fast Flow post is also used linear 0-0.5M NaCl gradient elution by albumen.Collect fraction and impose on 40ml Phenyl 6Fast Flow post (GE Heathcare Life Sciences, Piscataway, NJ, USA).Collect fraction, and have MES's by use the SDS-PAGE of 4-12%Bis-Tris Gel analyzes.Collect the fraction containing at the band of about 40kDa, and pass through ultrafiltration and concentration.

By the aspergillus oryzae EXP02789 of 1600ml volume ammonium sulfate (80% is saturated) precipitation for supernatant, be again dissolved in the 25mM Bis-Tris pH6.0 of 50ml, for same damping fluid dialysis, and filter by 0.45 μ m strainer.Final volume is 60ml.Solution is imposed on to the 40ml Q by 25mM Bis-Tris pH6.0 balance fast Flow post is also used linear 0-0.5M NaCl gradient elution by albumen.Fraction is collected, collected, and for 25mM Bis-Tris pH5.5 dialysis, impose on the 40ml SP by 25mM Bis-Tris pH5.5 balance fast Flow post.Collect fraction, and have MES's by use the SDS-PAGE of 4-12%Bis-Tris Gel analyzes.Collect the fraction containing at the band of about 34kDa, and pass through ultrafiltration and concentration.

By the aspergillus oryzae O4S5C of 2000ml volume ammonium sulfate (80% is saturated) precipitation for supernatant, be again dissolved in the 20mM Tris-HCl pH7.5 of 50ml, for same damping fluid dialysis, and filter by 0.45 μ m strainer.Final volume is 80ml.Solution is imposed on to the 40ml Q by 20mM Tris-HCl pH7.5 balance fast Flow post is also used linear 0-0.5M NaCl gradient elution by albumen.Collect fraction and have MES's by use the SDS-PAGE of 4-12%Bis-Tris Gel analyzes.Collect the fraction containing at the band of about 46kDa, and pass through ultrafiltration and concentration.

By the aspergillus oryzae O7R3T of 3200ml volume ammonium sulfate (80% is saturated) precipitation for supernatant, be again dissolved in 50ml20mM Bis-Tris pH6.5, for same damping fluid dialysis, and filter by 0.45 μ m strainer.Final volume is 110ml.Solution is imposed on to the 40ml Q of balance in 20mM Bis-Tris pH6.5 fast Flow post is also used linear 0.0-0.2M NaCl gradient elution by albumen.Collect by the fraction of 0.1-0.2M wash-out and use 40ml Phenyl 6Fast Flow post is with linear 1.2-0M (NH ₄) ₂sO ₄gradient is further purified.By use, have MES's the SDS-PAGE of 4-12%Bis-Tris Gel evaluates fraction.Collect the fraction of the band that contains about 42kDa, and pass through ultrafiltration and concentration.

Embodiment 16: the sign of the mould P23DM4GH10 zytase of camphor tree suede branch

specific activity: the specific activity of the mould P23DM4GH10 zytase of camphor tree suede branch is used birch xylan (Sigma Chemical Co., St.Louis, MO, USA) to determine as substrate.The liquid storage of birch xylan passes through every liter of 50mM sodium acetate pH5.0 of the birch xylan of 2g and 0.01% prepared by 20 mixing.To the birch xylan liquid storage of 190 μ l, add the mould GH10 zytase of camphor tree suede branch (with different albumen heap(ed) capacities) of 10 μ l.Protein concentration is used Microplate BCA ^tMprotein Assay Kit (Thermo Fischer Scientific, Waltham, MA, USA) determines, wherein uses bovine serum albumin as standard protein sample.Substrate contrast and enzyme contrast have been comprised.To react 50 ℃ of incubations 30 minutes, then add the 0.5M NaOH of 50 μ l with termination reaction.The reducing sugar producing is used as described below para hydroxybenzene formyl hydrazine (PHBAH, Sigma Chemical Co., St.Louis, MO, the USA) assay method of adjusting in 96 hole microwell plate forms to determine.In brief, the 100 μ l aliquots containigs of sample of suitably dilution are placed in to titer plate at the bottom of 96 hole cones.Reaction is initial by 1.5% (w/v) PHBAH of 50 μ l in interpolation 2%NaOH.Flat board is not covered to heating 10 minutes at 95 ℃, then allow it to be cooled to room temperature (RT), then the distilled water of 50 μ l is added into each hole.The 100 μ l aliquots containigs from each hole are transferred to flat 96 orifice plates, and use microplate Reader (Molecular Devices, Sunnyvale, CA, USA) measures the absorbancy at 410nm.Use glucose standard specimen (with the 0.1-0.0125mg/ml of 0.4% sodium hydroxide dilution) preparation standard curve by the A obtaining _410nmvalue is scaled glucose equivalent.Enzyme heap(ed) capacity is mapped to the reducing sugar producing, and by linearity range, calculate the specific activity of M.cinnamomea P23DM4GH10 zytase, be expressed as micromole's number of the glucose equivalent of every mg enzyme per minute generation, or IU/mg.M.cinnamomea P23DM4GH10 zytase is measured as 53.2IU/mg enzyme to the specific activity of birch xylan.

thermostability: M.cinnamomea P23DM4GH10 zytase is diluted in and contains 0.01% every liter of 20 50mM sodium acetate pH5 to 1g, then 50 ℃ of incubations 3 days, and 60 ℃ of incubations 3 hours and 24 hours.By identical sample storage in 4 ℃ of served as control.After incubation, measured the activity of sample to birch xylan, measure and follow the above-mentioned Dosimetry for definite specific activity, but only use one in specific activity is measured, to provide the enzyme heap(ed) capacity that <5% transforms.Sample is normalized to 100% the activity of 4 ℃, and the activity of sample under other incubation conditions is compared with 4 ℃ of activity.The definite result of thermostability is as follows.

Incubation conditions	Remaining activity to birch xylan
		4℃	100％
50 ℃, 3 days	97％
		60 ℃, 3 hours	6％
60 ℃, 24 hours	0％

pH general picture: the active general picture of pH of M.cinnamomea P23DM4GH10 zytase is determined by the above-mentioned identical rules for definite specific activity, but this is determined at five different pH (4,5,6,7, with 8) carry out, and only use one in specific activity is measured, to provide the enzyme heap(ed) capacity that <5% transforms.Used Britton Robinson damping fluid, its preparation as follows: preparation 100mM liquid storage, it contains 0.1 mole of boric acid, 0.1 mole of acetic acid, and 0.1 mole of phosphoric acid in 1 liter of deionized water.Then use 5M NaOH to be titrated to 4,5,6,7 100mM liquid storage, or 8, be then diluted to 40mM.Birch xylan is prepared in same buffer, and at 50 ℃, measured active.High reactivity is normalized to 100%, and the activity in other pH values is compared with high reactivity, and be expressed as % activity.The definite result of pH general picture is as follows.

PH value	% is active
		4.0	1％
5.0	81％
		6.0	100％
7.0	78％
		8.0	37％

Embodiment 17: the measurement of xylanase activity

Xylanase activity is used AZCL-xylan (Megazyme, Bray, Ireland) to measure as substrate.0.2%AZCL-xylan suspension passes through gently to stir and add 0.01% in 20mM sodium acetate pH5.0 damping fluid prepared by X-100.Then the 0.2%AZCL-xylan suspension of 100 μ l is mixed in titer plate with the zytase sample of 20 μ l, and be placed on ice before reaction.Mensuration is by being transferred to titer plate hot mixed instrument comes initial, and described hot mixed instrument is set to the temperature of 50 ℃.By flat board on hot mixed instrument at 700rpm for titer plate incubation 15-30 minute.Reaction stops by flat board is transferred back to ice bath.Then by flat board in ice-cold whizzer with 1000g centrifugal several minutes, and the supernatant of 100 μ l is transferred to titer plate.Read in absorbancy the measuring as xylanase activity of 595nm.Institute responds and carries out the same form three times, also carries out the damping fluid contrast without zytase.

To aspergillus oryzae expression strain O5KR9, O5KRD, O4S5C, and the zytase of the purifying of O7R3T (referring to embodiment 15) is measured xylanase activity as mentioned above.Result is as follows.

Albumen	OD ₅₉₅
		Contrast	0.1354
O5KR9	1.539
		O5KRD	0.9219
O4S5C	1.4541
		O7R3T	1.2844

By following numbering paragraph, further describe the present invention:

[1] have an isolated polypeptide for xylanase activity, it is selected from lower group:

(e) (a), (b), (c) or polypeptide (d) have the fragment of xylanase activity.

[2] section 1 polypeptide, the mature polypeptide of itself and SEQ ID NO:2 has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 65%, at least 70%, at least 75%, at least 80% with the mature polypeptide of SEQ ID NO:12, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 70%, at least 75%, at least 80%, at least 81% with the mature polypeptide of SEQ ID NO:4 or SEQ ID NO:10, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 75%, at least 80%, at least 81%, at least 82% with the mature polypeptide of SEQ ID NO:14 or SEQ ID NO:16, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 80%, at least 81%, at least 82%, at least 83% with the mature polypeptide of SEQ ID NO:6 or SEQ ID NO:8, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 85%, at least 86%, at least 87% with the mature polypeptide of SEQ ID NO:20, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; Have at least 90%, at least 91% with the mature polypeptide of SEQ ID NO:18, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.

[3] polypeptide of section 1 or 2, it is by polynucleotide encoding, described polynucleotide are hybridized with following under medium-Gao, height or very high stringent condition: (i) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9, or the mature polypeptide encoded sequence of SEQ ID NO:11, (ii) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:9, or the cDNA sequence of SEQ ID NO:11, or (iii) (i) or total length complementary strand (ii); Or hybridize with following under at least high or very high stringent condition: (i) SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or the mature polypeptide encoded sequence of SEQ ID NO:19, (ii) SEQ ID NO:5, SEQ ID NO:13, SEQ ID NO:17, or the cDNA sequence of SEQ ID NO:19, or (iii) (i) or total length complementary strand (ii).

[4] polypeptide of section 1-3 any one, it is by polynucleotide encoding, the mature polypeptide encoded sequence of described polynucleotide and SEQ ID NO:1 or its cDNA sequence have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 65%, at least 70%, at least 75%, at least 80% with mature polypeptide encoded sequence or its cDNA sequence of SEQ ID NO:11, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 70%, at least 75%, at least 80% with the mature polypeptide encoded sequence of SEQ ID NO:3 or mature polypeptide encoded sequence or its cDNA sequence of its cDNA sequence or SEQ ID NO:9, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 75%, at least 80%, at least 81%, at least 82% with the mature polypeptide encoded sequence of SEQ ID NO:13 or the mature polypeptide encoded sequence of its cDNA sequence or SEQ ID NO:15, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 80%, at least 81%, at least 82%, at least 83% with the mature polypeptide encoded sequence of SEQ ID NO:5 or the mature polypeptide encoded sequence of its cDNA sequence or SEQ ID NO:7, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, have at least 85%, at least 86%, at least 87% with mature polypeptide encoded sequence or its cDNA sequence of SEQ ID NO:19, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or have at least 90%, at least 91%, at least 92%, at least 93% with mature polypeptide encoded sequence or its cDNA sequence of SEQ ID NO:17, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.

[5] polypeptide of section 1-4 any one, it comprises or consists of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or SEQ ID NO:20 or SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the mature polypeptide of SEQ ID NO:20.

[6] polypeptide of section 5, wherein said mature polypeptide is the amino acid 21 to 406 of SEQ ID NO:2, the amino acid/11 8 to 360 of SEQ ID NO:4, the amino acid/11 9 to 376 of SEQ ID NO:6, the amino acid 23 to 367 of SEQ ID NO:8, the amino acid/11 9 to 326 of SEQ ID NO:10, the amino acid 21 to 354 of SEQ ID NO:12, the amino acid/11 8 to 355 of SEQ ID NO:14, the amino acid 20 to 366 of SEQ ID NO:16, the amino acid/11 8 to 381 of SEQ ID NO:18, or the amino acid/11 8 to 362 of SEQ ID NO:20.

[7] polypeptide of section 1-4 any one, it is SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the mature polypeptide of SEQ ID NO:20 comprises the variant of replacement, disappearance and/or insertion in one or more positions.

[8] polypeptide of section 1-7 any one, it is SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the fragment of SEQ ID NO:20, wherein said fragment has xylanase activity.

[9] composition, the polypeptide of its section of comprising 1-8 any one.

[10] polynucleotide for separation, the polypeptide of its coding section 1-8 any one.

[11] nucleic acid construct or an expression vector, the polynucleotide of its section of comprising 10, described polynucleotide are operably connected to one or more regulating and controlling sequences, and described regulating and controlling sequence instructs the generation of described polypeptide in expressive host.

[12] recombinant host cell, the polynucleotide of its section of comprising 10, described polynucleotide are operably connected to one or more regulating and controlling sequences, and described regulating and controlling sequence instructs the generation of polypeptide.

[13] method for the polypeptide of any one in the section of generation 1-8, it comprises: culturing cell under the condition that contributes to described polypeptide to produce, described cell produces described polypeptide with its wild-type form.

[14] method of section 13, it also comprises the described polypeptide of recovery.

[15] generation has a method for the polypeptide of xylanase activity, and it comprises: the host cell of cultivating section 12 under the condition that contributes to described polypeptide to produce.

[16] method of section 15, it also comprises the described polypeptide of recovery.

[17] transgenic plant, plant part or a vegetable cell, the polynucleotide of the polypeptide of its encoded section of 1-8 any one transform.

[18] generation has a method for the polypeptide of xylanase activity, and it comprises: transgenic plant or the vegetable cell of under the condition that contributes to described polypeptide to produce, cultivating section 17.

[19] method of section 18, it also comprises the described polypeptide of recovery.

[20] produce a method for the mutant of parental cell, described method comprises the polynucleotide inactivation of the polypeptide that makes any one in coding section 1-8, causes mutant to compare generation described polypeptide still less with parental cell.

[21] mutant cell being produced by the method for section 20.

[22] mutant cell of section 21, it further comprises the gene of encode natural or heterologous protein.

[23] produce a protedogenous method, it comprises: the mutant cell of cultivating section 21 or 22 under the condition that contributes to described albumen to produce.

[24] method of section 23, it also comprises the described polypeptide of recovery.

[25] double-stranded inhibitory RNA (dsRNA) molecule, the subsequence of the polynucleotide of its section of comprising 10, wherein optionally this dsRNA is siRNA or miRNA molecule.

[26] double-stranded inhibitory RNA (dsRNA) molecule of section 25, its length is approximately 15,16,17,18,19,20,21,22,23,24,25 or more duplex Nucleotide.

[27] method for the expression of the polypeptide that inhibition has a zytase in cell, it comprises uses or at double-stranded inhibitory RNA (dsRNA) molecule of cells section 25 or 26 cell.

[28] cell being produced by the method for section 27.

[29] cell of section 28, it further comprises the gene of encode natural or heterologous protein.

[30] produce a protedogenous method, it comprises: the cell of cultivating section 28 or 29 under the condition that contributes to described albumen to produce.

[31] method of section 30, it also comprises the described polypeptide of recovery.

[32] a kind of polynucleotide of separation, its coded signal peptide, described signal peptide comprises or consists of the amino acid/11 to 20 of SEQ ID NO:2, the amino acid/11 to 17 of SEQ ID NO:4, the amino acid/11 to 18 of SEQ ID NO:6, the amino acid/11 to 22 of SEQ ID NO:8, the amino acid/11 to 18 of SEQ ID NO:10, the amino acid/11 to 20 of SEQ ID NO:12, the amino acid/11 to 17 of SEQ ID NO:14, the amino acid/11 to 19 of SEQ ID NO:16, the amino acid/11 to 17 of SEQ ID NO:18, or the amino acid/11 to 17 of SEQ ID NO:20.

[33] nucleic acid construct or an expression vector, the gene of the proteins encoded of the polynucleotide that it comprises the section of being operably connected to 32, wherein said gene is external source for the polynucleotide of the described signal peptide of coding.

[34] recombinant host cell, the gene of the proteins encoded of the polynucleotide that it comprises the section of being operably connected to 32, wherein said gene is external source for the polynucleotide of the described signal peptide of coding.

[35] a kind of protedogenous method of product, it comprises: under the condition that contributes to described albumen to produce, cultivate recombinant host cell, the gene of the proteins encoded of the polynucleotide that described recombinant host cell comprises the section of being operably connected to 32, wherein said gene is external source for the polynucleotide of the described signal peptide of coding.

[36] method of section 35, it also comprises the described polypeptide of recovery.

[37] degradation of fibers cellulosic material or containing the method for xylan material, it comprises: the polypeptide with xylan activity of any one is processed described cellulose materials or containing xylan material with enzyme composition under existing in section 1-8.

[38] section 37 method, wherein said cellulose materials or containing xylan material through pre-treatment.

[39] method of section 37 or 38 any one, wherein said enzyme composition comprises one or more enzymes that is selected from lower group: cellulase, the polypeptide with cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.

[40] method of section 39, wherein said cellulase is that one or more are selected from the enzyme of lower group: endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.

[41] method of section 39, wherein said hemicellulase is that one or more are selected from the enzyme of lower group: zytase, acetyl xylan esterase, feruloyl esterase, arabinofuranosidase, xylosidase and glucuronidase.

[42] method of any one in section 37-41, also comprises and reclaiming through the cellulose materials of degraded or containing xylan material.

[43] section 42 method, wherein through the cellulose materials of degraded or be sugar containing xylan material.

[44] method of section 43, wherein said sugar is selected from lower group: glucose, wood sugar, seminose, semi-lactosi, and pectinose.

[45] produce a method for tunning, it comprises: under (a) in section 1-8, the polypeptide with xylanase activity of any one exists, by enzyme composition diastatic fiber cellulosic material or containing xylan material; (b) with the fermentation of one or more organism of fermentation through the cellulose materials of saccharification or containing xylan material to produce tunning; (c) from fermentation, reclaim tunning.

[46] section 45 method, wherein said cellulose materials or be pretreated containing xylan material.

[47] method of section 45 or 46, wherein said enzyme composition comprises one or more enzymes that is selected from lower group: cellulase, the polypeptide with cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.

[48] method of section 47, wherein said cellulase is that one or more are selected from the enzyme of lower group: endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.

[49] method of section 47, wherein said hemicellulase is that one or more are selected from the enzyme of lower group: zytase, acetyl xylan esterase, feruloyl esterase, arabinofuranosidase, xylosidase and glucuronidase.

[50] method of any one in section 45-49, wherein step (a) and (b) at the same time saccharification and ferment in carry out simultaneously.

[51] method of any one in section 45-50, wherein tunning is alcohol, alkane, naphthenic hydrocarbon, alkene, amino acid, gas, isoprene, ketone, organic acid or polyketide.

[52] a kind of fermented cellulose material or containing the method for xylan material, it comprises: with one or more organism of fermentation fermented cellulose materials or containing xylan material, and wherein said cellulose materials or be with enzyme composition saccharification containing xylan material under the existence of the polypeptide with xylanase activity of any one in section 1-8.

[53] section 52 method, wherein said cellulose materials or produce tunning containing the fermentation of xylan material.

[54] method of section 53, also comprises from fermentation and reclaims tunning.

[55] method of section 53 or 54, wherein tunning is alcohol, alkane, naphthenic hydrocarbon, alkene, amino acid, gas, isoprene, ketone, organic acid or polyketide.

[56] method of section 52-55 any one, wherein said cellulose materials or containing xylan material before saccharification through pre-treatment.

[57] method of section 52-56 any one, wherein said enzyme composition comprises one or more enzymes that is selected from lower group: cellulase, the polypeptide with cellulolytic enhancing activity, hemicellulase, esterase, claviformin, laccase, lignin decomposition enzyme, polygalacturonase, peroxidase, proteolytic enzyme and swollenin.

[58] method of section 57, wherein said cellulase is that one or more are selected from the enzyme of lower group: endoglucanase, cellobiohydrolase and beta-glucosidase enzyme.

[59] method of section 57, wherein said hemicellulase is that one or more are selected from the enzyme of lower group: zytase, acetyl xylan esterase, feruloyl esterase, arabinofuranosidase, xylosidase and glucuronidase.

[60] full nutrient solution formulation or a cell culture compositions, the polypeptide of its section of comprising 1-8 any one.

Description and claimed the present invention is herein not limited in the scope of concrete aspect disclosed herein, because these aspects are intended to the explanation as the several aspects of the present invention.Be intended to any aspect being equal to be contained in scope of the present invention.In fact, from the foregoing description, except herein shown and described, multiple modification of the present invention is apparent for a person skilled in the art.These modifications are also intended to fall in the scope of appended claim.In conflict in the situation that, by comprise that the disclosure of definitional part is as the criterion.

Claims

1. an isolated polypeptide with xylanase activity, it is selected from lower group:

(e) (a), (b), (c) or polypeptide (d) have the fragment of xylanase activity.

2. the polypeptide of claim 1-4 any one, it comprises SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20, or SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, the mature polypeptide of SEQ ID NO:18 or SEQ ID NO:20; Or by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or SEQ ID NO:20 or SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, or the mature polypeptide of SEQ ID NO:20 forms.

3. the polypeptide of claim 5, wherein said mature polypeptide is the amino acid 21 to 406 of SEQ ID NO:2, the amino acid/11 8 to 360 of SEQ ID NO:4, the amino acid/11 9 to 376 of SEQ ID NO:6, the amino acid 23 to 367 of SEQ ID NO:8, the amino acid/11 9 to 326 of SEQ ID NO:10, the amino acid 21 to 354 of SEQ ID NO:12, the amino acid/11 8 to 355 of SEQ ID NO:14, the amino acid 20 to 366 of SEQ ID NO:16, the amino acid/11 8 to 381 of SEQ ID NO:18, or the amino acid/11 8 to 362 of SEQ ID NO:20.

4. separated polynucleotide, the polypeptide of its coding claim 1-3 any one.

5. a recombinant host cell, the polynucleotide that it comprises claim 4, described polynucleotide are operably connected to one or more regulating and controlling sequences that instruct the generation of polypeptide.

6. a method that produces the polypeptide of any one in claim 1-3, it comprises:

(a) culturing cell under the condition that contributes to described polypeptide to produce, described cell produces described polypeptide with its wild-type form; Optionally

(b) reclaim described polypeptide.

7. generation has a method for the polypeptide of xylanase activity, and it comprises:

(a) under the condition that contributes to described polypeptide to produce, cultivate the host cell of claim 5; Optionally

(b) reclaim described polypeptide.

8. transgenic plant, plant part or a vegetable cell, its polynucleotide with the polypeptide of any one in coding claim 1-3 transform.

9. generation has a method for the polypeptide of xylanase activity, and it comprises:

(a) under the condition that contributes to described polypeptide to produce, cultivate transgenic plant or the vegetable cell of claim 8; Optionally

(b) reclaim described polypeptide.

10. produce a method for the mutant of parental cell, described method comprises the polynucleotide inactivation of the polypeptide of any one in the claim 1-3 that makes to encode, and it causes mutant to compare generation described polypeptide still less with parental cell.

Double-stranded inhibitory RNA (dsRNA) molecule of the subsequence of 11. 1 kinds of polynucleotide that comprise claim 4, wherein optionally described dsRNA is siRNA or miRNA molecule.

12. 1 kinds of separated polynucleotide, its coded signal peptide, the amino acid/11 to 20 that described signal peptide comprises SEQ ID NO:2, the amino acid/11 to 17 of SEQ ID NO:4, the amino acid/11 to 18 of SEQ ID NO:6, the amino acid/11 to 22 of SEQ ID NO:8, the amino acid/11 to 18 of SEQ ID NO:10, the amino acid/11 to 20 of SEQ ID NO:12, the amino acid/11 to 17 of SEQ ID NO:14, the amino acid/11 to 19 of SEQ ID NO:16, the amino acid/11 to 17 of SEQ ID NO:18, or the amino acid/11 to 17 of SEQ ID NO:20; Or by the amino acid/11 to 20 of SEQ ID NO:2, the amino acid/11 to 17 of SEQ ID NO:4, the amino acid/11 to 18 of SEQ ID NO:6, the amino acid/11 to 22 of SEQ ID NO:8, the amino acid/11 to 18 of SEQ ID NO:10, the amino acid/11 to 20 of SEQ ID NO:12, the amino acid/11 to 17 of SEQ ID NO:14, the amino acid/11 to 19 of SEQ ID NO:16, the amino acid/11 to 17 of SEQ ID NO:18, or amino acid/11 to 17 composition of SEQ ID NO:20.

13. 1 kinds produce method of protein, and it comprises:

(a) under the condition that contributes to described protein to produce, cultivate recombinant host cell, the gene that described recombinant host cell comprises the coded protein that the polynucleotide with claim 4 are operatively connected, wherein said gene is external source for the polynucleotide of coded signal peptide; Optionally

(b) reclaim described protein.

14. degradation of fibers cellulosic material or containing the method for xylan material, it comprises: the polypeptide with xylanase activity of any one is processed cellulose materials or containing xylan material with enzyme composition under existing in claim 1-3.

15. 1 kinds of methods that produce tunning, it comprises:

(a) under in claim 1-3, the polypeptide with xylanase activity of any one exists, by enzyme composition diastatic fiber cellulosic material or containing xylan material;

(b) with the fermentation of one or more organism of fermentation through the cellulose materials of saccharification or containing xylan material to produce tunning; With

(c) from described fermentation, reclaim described tunning.

16. 1 kinds of fermented cellulose materials or containing the method for xylan material, it comprises: with one or more organism of fermentation fermented cellulose materials or containing xylan material, and wherein said cellulose materials or be with enzyme composition saccharification containing xylan material under the existence of the polypeptide with xylanase activity of any one in claim 1-3.

17. full nutrient solution formulation or a cell culture compositions, the polypeptide that it comprises claim 1-3 any one.