CN104032026B - Polysomal method and application thereof in a kind of extraction plastosome - Google Patents
Polysomal method and application thereof in a kind of extraction plastosome Download PDFInfo
- Publication number
- CN104032026B CN104032026B CN201410296349.4A CN201410296349A CN104032026B CN 104032026 B CN104032026 B CN 104032026B CN 201410296349 A CN201410296349 A CN 201410296349A CN 104032026 B CN104032026 B CN 104032026B
- Authority
- CN
- China
- Prior art keywords
- plastosome
- component
- mitochondrial
- centrifugal
- polysomal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses polysomal method and application thereof in a kind of extraction plastosome.Extract the plastosome that polysomal method in plastosome comprises the steps: to extract with plastosome Extraction buffer target cell; The cracking of rrna Extraction buffer obtains mitochondrial ribosome suspension again; Mitochondrial ribosome suspension divides two equal portions, a copy of it RNA ferment treatment, and portion does not process in contrast in addition; Does is preparation 10-30% sucrose density gradient, layered on sucrose density gradient upper strata by mitochondrial ribosome suspension after balance, 4 DEG C? the centrifugal 2-4 hour of 180000 × g; Collect each centrifugal component from top to bottom, extract the RNA of each component and protein and carry out analysis and determine polyribosome place component.The present invention can be cheer and bright the polyribosome detected in plastosome, and quantitative analysis is carried out to the plastosome mRNA in polyribosome component, obtains the translation skill of chondriogen to be studied.
Description
Technical field
This technology relates to molecular biology, cytobiology and biological chemistry, is specifically related to polysomal method and application thereof in a kind of extraction plastosome.
Background technology
Eukaryotic plastosome is a kind of semi-autonomous organelle, and it has the genetic system of oneself uniqueness, i.e. plastosome double-strand closed hoop DNA, and DNA replication dna, transcribe and protein translation system.Mitochondrial ribosome is about 59S, is made up of large subunit and small subunit, and its function is very single-minded, is mainly used in the translation of the membranin of respiratory chain.When polyribosome refers to synthetic protein, multiple even tens rrna are connected on a mRNA, and this is that eukaryote ensures one of mechanism of efficient translation.Be sucrose density gradient centrifugation method to the classical way of separation and Extraction polysomal in tenuigenin.
Rrna is the classical biochemical method identifying machine translator component and translation efficiency with polysomal separation, also be the method that in research field, degree of recognition is very high, the different sedimentation section of rrna can reflect the translation efficiency of specific messenger RNA(mRNA) and the translational control factor and ribosomal interaction.
Because mitochondrial translation occurs on inner membrance, rrna and relevant cofactor are all connected with membrane structure, and this adds difficulty to polysomal separation.The polysomal research of existing successful separation and Extraction plastosome is actually rare.
Summary of the invention
The object of the invention is to overcome the shortcoming of prior art and deficiency, provide a kind of and extract polysomal method in plastosome.
Owing to producing 5-10 times that ability is ribosome monomer according to the polysomal polypeptide of generally acknowledging in field, in current detection line plastochondria, the method for translation efficiency can not effectively be separated rrna and polyribosome, causes translation efficiency analysis effectively can not reflect truth.The present invention also aims to the application that a kind of aforesaid method gene translation level in analytical line plastochondria is provided.
A kind of polysomal method in extraction plastosome, comprises following steps:
(1) plastosome of target cell is extracted with plastosome Extraction buffer.
(2) cracking of plastosome rrna Extraction buffer obtains mitochondrial ribosome suspension.
(3) mitochondrial ribosome suspension divides two equal portions, and a copy of it RNA ferment treatment, portion does not process in contrast in addition.
(4) prepare 10-30% sucrose density gradient, after balance, mitochondrial ribosome suspension is layered on sucrose density gradient upper strata, 4 DEG C of centrifugal 2-4 hour of 180000 × g.
(5) each centrifugal component is collected from top to bottom, extract RNA and the protein of each component, by reverse transcription quantitative PCR analysis mitochondrial ribosome large subunit RNA component and small subunit RNA component and immune-blotting method mitochondrial ribosomal protein subunit MRPS27, MRPL24, according to by the component of RNA ferment treatment with do not determine polyribosome place component by the difference of MRPS27, MRPL24 content in RNA ferment treatment component.
The formula optimization of the plastosome Extraction buffer described in step (1) is: 0.01MTris-MOPS, 0.01MEGTA/Tris, 0.2M sucrose, pH7.4, prepares with DEPC water.
The formula optimization of the rrna Extraction buffer described in step (2) is: 260mM sucrose, 100mMKCl, 20mMMgCl
2, 10mMTrispH7.5,1%TritonX-100,5mM beta-mercaptoethanol, 1 × Rocheproteaseinhibitor.
5U/ μ LRNA enzyme is preferably with RNA ferment treatment, 25 DEG C of process 40min in step (3).
Preferred, step (1) is: be incubated at by target cell in 4 15cm Tissue Culture Dishs, wash 2 times, scraped by cell with the PBS of precooling, and 4 DEG C of 200 × g collected by centrifugation are in centrifuge tube; With 3mL plastosome Extraction buffer gently outstanding cell precipitation, transfer in 1.5mL centrifuge tube by lysate after slurry about 100,4 DEG C of centrifugal 3min of 500 × g, transfer to supernatant in new centrifuge tube, repeated centrifugation; Collect supernatant in 4 DEG C of centrifugal 5min of 800 × g, repeated centrifugation; Collect supernatant in 4 DEG C of centrifugal 10min of 18000 × g, abandon supernatant, precipitation hanged with the plastosome Extraction buffer of precooling, in 4 DEG C of centrifugal 5min of 20000 × g, precipitation is plastosome.
Step (2) is: with the rrna Extraction buffer cracking mitochondrial pellet of 500 μ L precoolings, in placing 20min on ice, in 4 DEG C of centrifugal 45min of 9400 × g, collects supernatant, is mitochondrial ribosome lysate.
In said extracted plastosome, polysomal method can be used for gene translation level in analytical line plastochondria.Can rrna and polyribosome in effective differentiation plastosome by the inventive method, by rrna and polysomal translation efficiency in quantitative PCR Accurate Analysis plastosome; Can also identify to combine by mass spectrum and immunoblotting and analyze mitochondrial ribosome or polyribosome component understands the composition of mitochondrial translation machine and the regulatory factor of mitochondrial translation.
The present invention has following advantage and effect relative to prior art: the polyribosome detected in plastosome that the present invention can be cheer and bright, and quantitative analysis is carried out to the plastosome mRNA in polyribosome component, obtains the translation skill of chondriogen to be studied.With rrna popular at present in conjunction with compared with mRNA high-flux sequence method, analyze the translation efficiency of the mRNA in plastosome in polyribosome more accurately.
Accompanying drawing explanation
Fig. 1 is the quantitative PCR analysis result figure after sucrose density gradient centrifugation, each component being carried out to mt rRNA, and in figure, ordinate zou refers to the per-cent of summation shared by each component, and summation is the summation of 13 components.
Fig. 2 is the detected result figure after sucrose density gradient centrifugation, each component being carried out to polyribosome depolymerization effect after the immunoblotting assay of mitochondrial ribosomal protein subunit and nuclease process, and the 12nd, 13 components are plastosome polyribosome.
Fig. 3 is the quantitative PCR analysis result figure after sucrose density gradient centrifugation, each component being carried out to plastosome mRNA, and in figure, ordinate zou refers to the per-cent of summation shared by each component, and summation is the summation of 13 components.
Embodiment
Below in conjunction with specific embodiment, further detailed description is done to the present invention.Should be understood that the following examples are only not used in the scope limiting this technology for illustration of the present invention.
In following embodiment, all operations all carries out (namely carrying out on ice) answering under low temperature as far as possible.
Embodiment 1
(1) extraction of C2C12 cell mitochondrial
Cultivate C2C12 cell in 4 15cm Tissue Culture Dishs, PBS(0.01M, pH7.4 with precooling) wash 2 times, then scrape soft being scraped by cell with cell, 4 DEG C of 200 × g collected by centrifugation are in centrifuge tube.With about 3mL plastosome Extraction buffer IBc(0.01MTris-MOPS, 0.01MEGTA/Tris, 0.2M sucrose, pH7.4, all with the preparation of DEPC water) and gently hang cell precipitation, transfer in the homogenizer of precooling in advance, in upper and lower homogenate on ice about 100 times.Transferred to by lysate in 1.5mL centrifuge tube, 4 DEG C of centrifugal 3min of 500 × g, transfer to supernatant in new centrifuge tube, repeated centrifugation.Collect supernatant in 4 DEG C of centrifugal 5min of 800 × g, repeated centrifugation.Collect supernatant in 4 DEG C of centrifugal 10min of 18000 × g, abandon supernatant, will precipitate hang gently with the IBc of precooling, in 4 DEG C of centrifugal 5min of 20000 × g, precipitation is plastosome.
(2) mitochondrial ribosome is extracted
With rrna Extraction buffer (260mM sucrose, 100mMKCl, the 20mMMgCl of 500 μ L precoolings
2, 10mMTrispH7.5,1%TritonX-100,5mM beta-mercaptoethanol, 1 × Rocheproteaseinhibitor) and cracking mitochondrial pellet gently, in placing 20min on ice.In 4 DEG C of centrifugal 45min of 9400 × g, removing membrane structure and insoluble protein, collect supernatant, be mitochondrial ribosome lysate.
(3) sucrose density 4 DEG C of gradient centrifugations
By gradients setup instrument preparation 8mL10-30% sucrose density gradient in 13mLBECKMAN centrifuge tube, 4 DEG C of equilibrate overnight.The mitochondrial ribosome lysate that (2) of about 500 μ L obtain carefully is layered on upper strata, in 4 DEG C of 180000 × g centrifugal 2 hours 30 minutes.Careful absorption density gradient from top to bottom, is divided into 13 components, for extracting RNA and protein.Each saccharose gradient component adds the TRIZOLLS reagent (LifeTechnologies) of 3 times of volumes, RNA wherein and albumen is extracted according to normal process, by the content of the Measures compare of reverse transcription quantitative PCR each component mitochondrial ribosome large subunit (16S) RNA component and small subunit (12S) RNA component, tentatively infer that last 12,13 two components are plastosome polyribosome (see figure 1).
Reverse transcription reaction condition is reverse transcription stdn flow process, and primer is random primer.
Quantitative PCR is standard SyBrGreen flow process, and PCR primer is as follows:
12SrRNA primer:
F：CAAACTGGGATTAGATACCCCACTAT，R：GAGGGTGACGGGCGGTGTGT；
16SrRNA primer:
F：ACCGCAAGGGAAAGATGAAA，R：GCCACATAGACGAGTTGATTC。
(4) RNA ferment treatment determination polyribosome component
In order to identify polysomal component in sucrose density gradient, the mitochondrial ribosome suspension (2) extracted used 5U/ μ LRNaseI(final concentration before carrying out density gradient centrifugation) in 25 DEG C of process 40min.Carry out centrifugation according to the method for (3) again, extract RNA and protein.The immunoblotting assay carrying out mitochondrial ribosomal protein subunit (MRPS27, MRPL24) to each component detects the effect of polyribosome depolymerization after nuclease process, and (western blotting method is normal process, please note that mitochondrial protein mostly is transmembrane protein, concussion before loading, should be noted).
MRPS27 is the component of mitochondrial ribosome small subunit, MRPL24 is the component of the large subunit of mitochondrial ribosome, by analyzing the distribution of these two albumen at sucrose density gradient different positions, mitochondrial ribosome subunit, ribosome monomer and polysomal distribution and abundance can be determined.RNaseI can cut mRNA, makes polyribosome depolymerization.Not with the mitochondrial ribosome suspension of RNaseI process, the 12nd, 13 two component has MRPS27 and MRPL24 that abundance is very high; Mitochondrial ribosome suspension after RNaseI process, the 12nd, 13 two component almost can't detect MRPS27 and MRPL24(and sees Fig. 2), result shows that 12,13 two components are plastosome polyribosome.
(5) mitochondrial COX 1 and ND1mRNA translation efficiency
By the strategy shown in the result of Fig. 1 and Fig. 2, analyze and show that the 10th and 11 components are rrna; 12nd and 13 components are polyribosome, by the quantitative PCR analysis of COX1 and ND1mRNA to ribosome components and polyribosome component, the relative abundance of mRNA in different components can be obtained, produce 5-10 times that ability is ribosome monomer according to the polysomal polypeptide of generally acknowledging in field.The translation efficiency of COX1 and ND1mRNA under different treatment condition can be analyzed.
Quantification PCR primer is as follows:
COX1 primer: F:TCCAACTCATCCCTTGACATC, R:TCCTGCTATGATAGCAAACACT;
ND1 primer: F:TTACCAGAACTCTACTCAACT, R:ATCGTAACGGAAGCGTGGATA.
The results are shown in Figure 3, the 3rd, 4,5 is the per-cent shared by mRNA that small subunit ribosome combines; 6,7 is the per-cent shared by mRNA that large ribosomal subunit combines; 9,10,11 is the per-cent shared by mRNA that ribosome monomer combines; 12,13 is the per-cent shared by mRNA that polyribosome combines.
Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
SEQUENCELISTING
<110> Wuhan University
<120> mono-kind extracts polysomal method and application thereof in plastosome
<130>1
<160>8
<170>PatentInversion3.5
<210>1
<211>26
<212>DNA
<213>ArtificialSequence
<220>
<223>12SrRNA primers F
<400>1
caaactgggattagataccccactat26
<210>2
<211>20
<212>DNA
<213>ArtificialSequence
<220>
<223>12SrRNA primer
<400>2
gagggtgacgggcggtgtgt20
<210>3
<211>20
<212>DNA
<213>ArtificialSequence
<220>
<223>16SrRNA primers F
<400>3
accgcaagggaaagatgaaa20
<210>4
<211>21
<212>DNA
<213>ArtificialSequence
<220>
<223>16SrRNA primer
<400>4
gccacatagacgagttgattc21
<210>5
<211>21
<212>DNA
<213>ArtificialSequence
<220>
<223>COX1 primers F
<400>5
tccaactcatcccttgacatc21
<210>6
<211>22
<212>DNA
<213>ArtificialSequence
<220>
<223>COX1 primer R
<400>6
tcctgctatgatagcaaacact22
<210>7
<211>21
<212>DNA
<213>ArtificialSequence
<220>
<223>ND1 primers F
<400>7
ttaccagaactctactcaact21
<210>8
<211>21
<212>DNA
<213>ArtificialSequence
<220>
<223>ND1 primer R
<400>8
atcgtaacggaagcgtggata21
Claims (4)
1. extract a polysomal method in plastosome, it is characterized in that comprising following steps:
(1) plastosome of target cell is extracted with plastosome Extraction buffer; The formula of described plastosome Extraction buffer is: 0.01MTris-MOPS, 0.01MEGTA/Tris, 0.2M sucrose, pH7.4, prepares with DEPC water;
(2) cracking of plastosome rrna Extraction buffer obtains mitochondrial ribosome suspension; The formula of described rrna Extraction buffer is: 260mM sucrose, 100mMKCl, 20mMMgCl
2, 10mMTrispH7.5,1%TritonX-100,5mM beta-mercaptoethanol, 1 × Rocheproteaseinhibitor;
(3) mitochondrial ribosome suspension divides two equal portions, a copy of it RNA ferment treatment, and portion does not process in contrast in addition;
(4) prepare 10-30% sucrose density gradient, after balance, mitochondrial ribosome suspension is layered on sucrose density gradient upper strata, 4 DEG C of centrifugal 2-4 hour of 180000 × g;
(5) each centrifugal component is collected from top to bottom, extract RNA and the protein of each component, by reverse transcription quantitative PCR analysis mitochondrial ribosome large subunit RNA component and small subunit RNA component and immune-blotting method mitochondrial ribosomal protein subunit MRPS27, MRPL24, according to by the component of RNA ferment treatment with do not determine polyribosome place component by the difference of MRPS27, MRPL24 content in RNA ferment treatment component.
2. polysomal method in extraction plastosome according to claim 1, is characterized in that: step (3) is middle is 5U/ μ LRNA enzyme with RNA ferment treatment, 25 DEG C of process 40min.
3. polysomal method in extraction plastosome according to claim 1, is characterized in that:
Step (1) is: be incubated at by target cell in 4 15cm Tissue Culture Dishs, wash 2 times, scraped by cell with the PBS of precooling, and 4 DEG C of 200 × g collected by centrifugation are in centrifuge tube; With 3mL plastosome Extraction buffer gently outstanding cell precipitation, transfer in 1.5mL centrifuge tube by lysate after homogenate 100 times, 4 DEG C of centrifugal 3min of 500 × g, transfer to supernatant in new centrifuge tube, repeated centrifugation; Collect supernatant in 4 DEG C of centrifugal 5min of 800 × g; Collect supernatant in 4 DEG C of centrifugal 10min of 18000 × g, abandon supernatant, precipitation hanged with the plastosome Extraction buffer of precooling, in 4 DEG C of centrifugal 5min of 20000 × g, precipitation is plastosome;
Step (2) is: with the rrna Extraction buffer cracking mitochondrial pellet of 500 μ L precoolings, in placing 20min on ice, in 4 DEG C of centrifugal 45min of 9400 × g, collects supernatant, is mitochondrial ribosome suspension.
4. the application of polysomal method in analytical line mitochondrial genes translation skill in the extraction plastosome described in any one of claim 1-3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410296349.4A CN104032026B (en) | 2014-06-27 | 2014-06-27 | Polysomal method and application thereof in a kind of extraction plastosome |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410296349.4A CN104032026B (en) | 2014-06-27 | 2014-06-27 | Polysomal method and application thereof in a kind of extraction plastosome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104032026A CN104032026A (en) | 2014-09-10 |
| CN104032026B true CN104032026B (en) | 2016-03-16 |
Family
ID=51463020
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410296349.4A Expired - Fee Related CN104032026B (en) | 2014-06-27 | 2014-06-27 | Polysomal method and application thereof in a kind of extraction plastosome |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104032026B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104374922A (en) * | 2014-11-26 | 2015-02-25 | 绍兴康知生物科技有限公司 | Method for preparing protein for detecting chloramphenicol |
| CN105021438A (en) * | 2015-08-05 | 2015-11-04 | 高向伟 | Sample preparation method used for protein translation initiation site system detection |
| CN107266521B (en) * | 2016-04-08 | 2020-07-14 | 中国农业大学 | Method for extracting cotton mitochondria and protein thereof |
| CN106868148B (en) * | 2017-03-08 | 2021-02-26 | 中国科学院苏州生物医学工程技术研究所 | Preparation method of cell nucleus with controllable aggregation state and long-term preservation |
| CN114908046B (en) * | 2022-06-16 | 2024-01-02 | 四川大学 | Preparation method of mitochondrial membrane vesicles |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150141274A1 (en) * | 2012-05-09 | 2015-05-21 | The Rockefeller University | Methods and Compositions for Activity Dependent Transcriptome Profiling |
-
2014
- 2014-06-27 CN CN201410296349.4A patent/CN104032026B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104032026A (en) | 2014-09-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104032026B (en) | Polysomal method and application thereof in a kind of extraction plastosome | |
| Porter et al. | Scaling up: A guide to high‐throughput genomic approaches for biodiversity analysis | |
| Bell et al. | An rbcL reference library to aid in the identification of plant species mixtures by DNA metabarcoding | |
| Xu | Fungal DNA barcoding | |
| Stepanauskas | Single cell genomics: an individual look at microbes | |
| Deiner et al. | Choice of capture and extraction methods affect detection of freshwater biodiversity from environmental DNA | |
| Edgcomb et al. | Comparison of Niskin vs. in situ approaches for analysis of gene expression in deep Mediterranean Sea water samples | |
| Roume et al. | Sequential isolation of metabolites, RNA, DNA, and proteins from the same unique sample | |
| US9855559B2 (en) | Microorganism nucleic acid purification from host samples | |
| Osburn et al. | Hydrogen-isotopic variability in fatty acids from Yellowstone National Park hot spring microbial communities | |
| CN105063192B (en) | Molecular labeling and its application for identifying Amur Sturgeon germplasm | |
| RU2014152244A (en) | METHOD FOR CARRYING OUT MULTI-ANALYSIS OF RARE CELLS EXTRACTED OR SEPARATED FROM BIOLOGICAL SAMPLES BY FILTRATION | |
| WO2007092916A3 (en) | Methods of extracting rna | |
| CN110184387B (en) | RT-LAMP detection primer for detecting ANSVV, application thereof, detection reagent and detection method | |
| Veillette et al. | Milne Fiord epishelf lake: a coastal Arctic ecosystem vulnerable to climate change | |
| CA3197514A1 (en) | Producing functional microbial consortia | |
| CN104611324A (en) | Whole blood sample fast pyrolysis kit and detection method thereof | |
| CN109136388A (en) | The microRNA label of Cynoglossus semilaevis differential expression and application | |
| Zhang et al. | Rickenella danxiashanensis, a new bryophilous agaric from China | |
| CN111057775A (en) | Specific novel molecular target for identifying salmonella and rapid detection method thereof | |
| Hu et al. | Targeted metatranscriptomics of soil microbial communities with stable isotope probing | |
| Yao et al. | Active microbiome structure and functional analyses of freshwater benthic biofilm samples influenced by RNA extraction methods | |
| Butts | Exploring DNA extraction efficiency | |
| Abate et al. | Microbiome single cell atlases generated with a commercial instrument | |
| Amin et al. | Extraction of HCV‐RNA from Plasma Samples: Development towards Semiautomation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160316 Termination date: 20170627 |