CN104031876A - Method of inhibiting staphylococcus aureus virulence factor - Google Patents
Method of inhibiting staphylococcus aureus virulence factor Download PDFInfo
- Publication number
- CN104031876A CN104031876A CN201310748317.9A CN201310748317A CN104031876A CN 104031876 A CN104031876 A CN 104031876A CN 201310748317 A CN201310748317 A CN 201310748317A CN 104031876 A CN104031876 A CN 104031876A
- Authority
- CN
- China
- Prior art keywords
- add
- 5min
- pcr
- gel
- adds
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A method of inhibiting the staphylococcus aureus virulence factor is disclosed. The method includes performing pharmacological intervention, preparing agents, measuring the total protein concentrations, performing SDS-PAGE electrophoresis and measuring expression of hematoxin. Baicalin and baicalein in different concentrations are added into a culture medium containing the staphylococcus aureus. The total protein concentrations are separately measured. The SDS-PAGE electrophoresis is performed for analysis and the expression of the hematoxin is measured.
Description
Technical field
The invention belongs to biological and gene engineering field, be specifically related to a kind of method that suppresses streptococcus aureus virulence factor.
Background technology
Streptococcus aureus is the encountered pathogenic bacteria that causes severe infections, it is pathogenic except forming microbial film, also comprise the synthetic of the outer toxic product of a series of born of the same parents and discharge, the exocellular polysaccharide adhesin, autolysin, the phenol dissolubility that have wherein comprised participation biofilm formation regulate peptide etc., also comprise the distinctive strong virulence factor of streptococcus aureus, as enterotoxin, plasma-coagulase, leueocidin, hemolytic toxin, heat stable nuclease, toxic shock syndrome toxin-1 etc.They are playing the part of important role in the developing of the relative disease of infection of staphylococcus aureus.Be not all Secretion toxin of the same type of all streptococcus aureus, the difference of streptococcus aureus phenotype, its Type of toxin producing is also the same not to the utmost.
The pathogenic of streptococcus aureus is the complex process being determined by multiplefactor, and its virulence factor produces more, and it is pathogenic stronger.The generation of virulence factor is subject to the adjusting of the regulated and control network of bacterium own and controls, these regulated and control networks consist of many regulator control systems and control path, they are not only independently mutual but also influence each other, thereby make signals different in bacterium environment of accepting, and the change of environment is made to adaptive reaction.
Staphylococcus aureus enterotoxin is one of important superantigen, can cause food poisoning, Endotoxin Shock syndrome, anaphylactic disease etc., Symptoms is for feeling sick, vomit, suffer from abdominal pain and diarrhoea, the most common with enterotoxin A, B and D tri-types, it is a kind of heat-staple protein, within 30 minutes, is not decomposed at 100 ℃, and is difficult for being digested by stomach en-, very little dosage can cause food poisoning, once food is contaminated, is difficult to remove.The related infection that streptococcus aureus virulence factor causes has become a threat greatly that affects health of people, and control virulence factor regulation and control, is the greatest problem that face now.
Summary of the invention
The object of the invention is to suppress the regulation and control of streptococcus aureus virulence factor, the technical scheme that realizes the object of the invention use is: a kind of method that suppresses streptococcus aureus virulence factor, comprise the expression of drug intervention, reagent preparation, measurement total protein concentration, SDS-PAGE electrophoresis and mensuration hemolytic toxin, concrete steps are as follows
(1) drug intervention, is seeded to 3ml containing in the TSB liquid nutrient medium of 0.5% glucose by the streptococcus aureus after rejuvenation, and 35 ~ 37 ℃, 250rpm/min are cultivated 12h, after be inoculated into amplification culture in 300mlTSB liquid nutrient medium, be cultured to OD
600=0.3 is divided into N part, add respectively baicalin and scutellarin, the concentration that adds baicalin is 0 ~ 1/2MIC, the concentration that adds scutellarin is 0 ~ 1/2MIC, be placed in after 35 ~ 37 ℃, 250rpm/min are cultivated 5h and sample, the centrifugal 5min of 12000rpm/min, separating thallus and supernatant liquor, 0.22 μ m membrane filtration for supernatant liquor, standby;
Measure minimum inhibitory concentration MIC, the the 1st to the 10th hole at 96 aseptic porocyte culture plates adds step (3) bacterium liquid, the amount that adds bacterium liquid is 100 μ l, again by baicalin and scutellarin the 1st to the 10th hole that is placed in respectively two 96 aseptic porocyte culture plates, the 1st hole add-on is 50 μ l, 2nd ~ 10 holes are doubling dilution to two times final concentration successively, the 11st hole is the growth control hole of bacterium liquid, the 12nd hole is TSB-G substratum, be statically placed in 35 ~ 37 ℃ and cultivate 24h, obtain baicalin and scutellarin minimum inhibitory concentration MIC, the judgement of minimum inhibitory concentration (MIC): each hole of 96 culture plates fully mix after with growth control boring ratio, the corresponding lowest drug concentration of 100% growth-inhibiting is the MIC of medicine for this reason.
(2) reagent preparation, preparation 10% ammonium persulphate, 12% separation gel, concentrated glue, confining liquid and developing fixing liquid;
(3) measure total protein concentration, get 10 μ l 5mg/ml bovine serum albumins and be diluted to 100 μ l with TSB liquid nutrient medium, by 0,1,2,4,8,12,16,20 μ l, be added to respectively 96 orifice plates afterwards, add TSB liquid nutrient medium that volume is complemented to 20 μ l, get again the supernatant liquor that 20 μ l steps (1) obtain, join in above-mentioned each hole, each hole adds 200 μ lBradford staining fluids afterwards, and concussion mixes 5min and measures A by microplate reader
595, according to standard substance, record numerical value drawing standard curve, then according to typical curve, calculate the total protein concentration of supernatant liquor;
(4) SDS-PAGE electrophoresis, comprises and prepares gel, electrophoresis loading, transferring film, seals, hatches antibody, luminous developing fixing and gel image analysis;
(5) measure the expression of hemolytic toxin,
1) design of primers, comprises upstream primer and downstream primer; Primer sequence is as follows
| Primer | Sequence | Product length |
| 16sRNA sense | CCATAAAGTTGTTCTCAGTT | 83bp |
| 16sRNA antisense | CATGTCGATCTACGATTACT | |
| Hla sense | ATGGCTCTATGAAAGCAGCAGA | 105bp |
| Hla antisense | AAGTCTGGTGAAAACCCTGAAGA |
2) extract RNA, step (1) is obtained to thalline and add 0.5mlDEPC water rinse, 10000rpm/min leaves heart 1min, after getting 10mg/ml N,O-Diacetylmuramidase, the molten staphylococcus enzyme of 5 μ l and the TE buffer that supernatant liquor adds 60 μ l, shake resuspended bacterium, be placed in 35 ~ 37 ℃, 40min cracking bacterium wall, latter 4 ℃, the centrifugal 3min of 12000rpm/min, obtains precipitated liquid; Add the 1mlTrizol 5min that homogenizes, then add 200 μ l chloroforms to shake 15s, mix and place after 3min, 4 ℃ of centrifugal 15min of 12000rpm/min; Upper water is moved in new EP pipe mutually, add 480 μ l Virahols, mix and be placed on-20 ℃ of 20min, 4 ℃ of centrifugal 15min of 12000rpm/min must precipitate, and abandon supernatant liquor; EP pipe adds 1ml75% alcohol, rocks and makes resolution of precipitate, and 4 ℃ of centrifugal 10min of 12000rpm/min must precipitate, and room temperature is dried; Add RNase-free water dissolution, survey RNA concentration;
3) RNA reverse transcription, take 2 μ g steps 2) RNA that obtains is template, detailed process and reaction system are as follows:
Reagent dosage
RNA xμl
Oligo（dT）
18 1μl
DEPC water is mended to 12 μ l
The first step reaction system is 12 μ l, and reaction conditions is 65 ℃ of 5min, 4 ℃ of 5min;
Reagent dosage
40mg/L 5 * reaction buffer 4 μ l
20U/ μ l RNA enzyme inhibitors 1 μ l
10mMdNTP Mix 2μl
200U/ μ l reversed transcriptive enzyme 1 μ l
The first step is wanted to add mentioned reagent in conjunction with after completing, and making reverse transcription system cumulative volume is 20 μ l, and second step reaction conditions is 42 ℃ of 60min, and 70 ℃ of 5min are finally down to 4 ℃; Be cDNA;
4) regular-PCR checking, take cDNA as template, carries out regular-PCR amplification, reaction conditions is 95 ℃ of preheating 5min, 94 ℃ of sex change 1min, 54 ℃ of annealing 1min, 72 ℃ are extended 1min, 35 circulations altogether, last 72 ℃ of incubation 5min, get 10 μ lPCR amplified productions, add in the 2% sepharose well that adds I type nucleic acid dye, in tbe buffer liquid, voltage is that 100V carries out electrophoresis 25min, observations taking pictures under gel imaging system; The reaction system of regular-PCR is as follows:
2×Taq PCR Master Mix 12.5μl
Sterilizing deionized water 9.5 μ l
Upstream primer 1 μ l
Downstream primer 1 μ l
cDNA 1μl
Amount to 25 μ l
5) the horizontal detection by quantitative of mRNA, PCR kit for fluorescence quantitative carries out reaction solution preparation, reaction solution is formulated on ice and carries out, real-time PCR carries out amplified reaction, the reaction conditions of quantitative fluorescent PCR: 95 ℃ of denaturation 10min, 95 ℃ of sex change 15s, 58 ℃ of annealing 60s, 40 circulations, read fluorescent signal in each circulation extension stage, finally generate amplification curve, product solubility curve; Reaction system is as follows:
2×Taq PCR Master Mix 12.5μl
Sterilizing deionized water 9.5 μ l
Upstream primer 1 μ l
Downstream primer 1 μ l
cDNA 1μl
Amount to 25 μ l.
Described N is at least 2 parts.
Described MIC is the minimum inhibitory concentration of baicalin or scutellarin.
The compound method of 10% described ammonium persulphate is for to be dissolved in 0.1g ammonium persulphate in 1ml deionized water, 4 ℃ of storages of lucifuge; Described 12% separation gel comprises 3.3ml deionized water, 4.0ml 30% acrylamide soln, 2.5ml 1.5mol/LTris-HCl (PH8.8), 0.1ml 10%SDS, 0.1ml 10% ammonium persulphate and 0.004ml TEMED; Described concentrated glue comprises 2.7ml deionized water, 0.67ml30% acrylamide soln, 0.5ml1.0mol/LTris-HCl, 0.04ml10%SDS, 0.04ml10% ammonium persulphate and 0.004ml TEMED.
The described gel of preparing, by 12% separation gel implantation glass plate of step (2) preparation, Jiao Ding adds 1ml deionized water, after gelling to be separated is solid, upper water is poured out, wipe dry, then will concentrate between sol solution implantation glass plate until insert fixture behind top, vertical placement treats that solution solidifies removes fixture, gel glass plate is put into electrophoresis chamber, connect power supply, in groove, add 5 * SDS-PAGE electrophoretic buffer; The described antibody of hatching, is diluted to 1:5000 by SEA primary antibodie with TBST, and the pvdf membrane having sealed is put into, and room temperature is rocked and hatched after 1h, cultivates 8 ~ 12h for 4 ℃, washes three times, at every turn 10min with TBST on shaking table; Pvdf membrane being put into dilution is the anti-solution of SEA bis-of 1:4000 again, and room temperature is rocked and hatched after 1h, washes each 10 minutes with TBST on shaking table three times.
Substance progress and outstanding feature that the present invention gives prominence to are: baicalin provided by the invention and scutellarin, in appropriate concentration range in conjunction with test method of the present invention, can suppress streptococcus aureus virulence factor and produce, thereby reduce the related infection that streptococcus aureus causes.
Accompanying drawing explanation
Fig. 1 is embodiment 2 drug intervention results, and Staphylococcus aureus enterotoxin adds the Western Blot of baicalin and scutellarin to analyze.
Fig. 2 is the expression regular-PCR result that embodiment 2 measures hemolytic toxin, reference gene 16sRNA and hla pcr amplification PCR scanning result.
Fig. 3 is the expression regular-PCR result that embodiment 2 measures hemolytic toxin, the amplification curve of reference gene 16sRNA and hla (A), solubility curve (B), typical curve (C).
Embodiment 4 is results that embodiment 2 measures the quantitative fluorescent PCR of hemolytic toxin, adds baicalin and scutellarin hla relative expression quantity.
Embodiment
Embodiment 1
1. drug intervention, is seeded to 3ml containing in the TSB liquid nutrient medium of 0.5% glucose by the streptococcus aureus after rejuvenation, and 35 ~ 37 ℃, 250rpm/min are cultivated 12h, after be inoculated into amplification culture in 300mlTSB liquid nutrient medium, be cultured to OD
600=0.3 is divided into 9 parts, (following glycosides represents baicalin to add respectively baicalin and scutellarin, element represents scutellarin), make that drug level is respectively 0,1/2MIC glycosides, 1/4MIC glycosides, 1/8MIC glycosides, 1/16MIC glycosides, 1/2MIC element, 1/4MIC is plain, 1/8MIC is plain, 1/16MIC is plain, be placed in 35 ~ 37 ℃, 250rpm/min and sample after cultivating 5h, the centrifugal 5min of 12000rpm/min, separating thallus and supernatant liquor, 0.22 μ m membrane filtration for supernatant liquor, standby.
2. reagent preparation, preparation 10% ammonium persulphate, takes 0.1g ammonium persulphate and is dissolved in 1ml deionized water, and 4 ℃ of storages of lucifuge, were finished in 1 week;
2% separation gel:
Deionized water 3.3ml
30% acrylamide soln 4.0ml
1.5mol/LTris-HCl (PH8.8) 2.5ml
10%SDS 0.1ml
10% ammonium persulphate 0.1ml
TEMED 0.004ml
Concentrated glue:
Deionized water 2.7ml
30% acrylamide soln 0.67ml
1.0mol/LTris-HCl (PH6.8) 0.5ml
10%SDS 0.04ml
10% ammonium persulphate 0.04ml
TEMED 0.004ml
Confining liquid:
Skim-milk 5g, TBST100ml.
Developing solution, stop bath:
Respectively get 500ml deionized water and be heated to 50 ℃, then add respective amount powder, glass stick is stirred to completely and dissolves, and is placed in the mid-4 ℃ of preservations of brown reagent bottle.
3. measure total protein concentration, getting 10 μ l 5mg/ml bovine serum albumins is diluted to 100 μ l with TSB liquid nutrient medium to make final concentration is 0.5mg/ml, by 0,1,2,4,8,12,16,20 μ l, be added to respectively 96 orifice plates afterwards, add TSB liquid nutrient medium that volume is complemented to 20 μ l, get again the supernatant liquor that 20 μ l steps 1 obtain, join in above-mentioned each hole, each hole adds 200 μ lBradford staining fluids afterwards, and concussion mixes 5min and measures A by microplate reader
595, according to standard substance, record numerical value drawing standard curve, then according to typical curve, calculate the total protein concentration of supernatant liquor;
4.SDS-PAGE electrophoresis,
Prepare gel: clean sheet glass, sealing is fixed on electrophoresis chamber; Configure as stated above 12% separation gel, account for volume 2/3, between implantation glass plate, Jiao Ding adds 1ml deionized water rapidly, after gelling to be separated is solid, upper water is poured out, with filter paper, blot superfluous water, again by between the 5% concentrated sol solution implantation glass plate configuring until plug comb behind top at once, vertically place and after it solidifies, carefully move comb, gel glass plate is put into electrophoresis chamber, connect power supply, and in groove, add electrophoretic buffer.
Electrophoresis loading: after mixing by 3:1 with 4 * SDS-PAGE Loading Buffer containing the bacterium liquid supernatant of 30mg total protein, heated and boiled makes protein denaturation for 5 minutes, with albumen Maker while loading one by one.90V voltage concentrates gel electrophoresis, uses 110V voltage electrophoresis after entering separation gel, until protein electrophoresis reaches separation gel bottom.
Transferring film: take off gel and steep in transferring film damping fluid, by Maker, cut the gel at place, the general place of target protein, and pvdf membrane is cut into the size identical with gel size, carry out after mark immerses methyl alcohol 5s left and right and be soaked in transferring film damping fluid with two filter paper that cut.After wearing gloves, by anode, filter paper, pvdf membrane, gel, filter paper, negative electrode order, place one by one, each layer can not leave bubble, clips in rear insertion transferring film groove, by electric current 0.1A is wet, turns 40 minutes.
Sealing: the pvdf membrane after transferring film is taken out and puts into the confining liquid that configured in advance is good, be placed on the shaking table shaking gently, 4 ℃ are spent the night.
Hatch antibody: SEA primary antibodie is diluted to 1:5000 with TBST, the pvdf membrane having sealed is put into, under room temperature, jog is hatched after 1 hour and to be crossed 4 ℃ and spend the night, and washes each 10 minutes with TBST on shaking table three times; Pvdf membrane is put into the dilution anti-solution of SEA bis-of (1:4000) well, room temperature jog is hatched after 1 hour and is continued with TBST, on shaking table, to wash three times, each 10 minutes again.
Luminous, development, photographic fixing: above-mentioned pvdf membrane is placed on preservative film, luminescent solution A and two kinds of reagent of B are pressed after 1:1 volume mixture, drop on pvdf membrane, then cover one deck preservative film.In darkroom, under red light, take out X-ray, be cut into suitable size, be placed on preservative film, shut X-ray folder, start timing, according to the Band signal strong and weak adjustment time shutter.The rear taking-up X-ray that exposed, immerses rapidly in developing solution, band after occurring, stop developing and immerse transparent to film in stop bath till, with distilled water, wash away after residual stop bath, dry.
Gel image analysis: film is scanned or taken pictures, with gel images treatment system evaluating objects band gray-scale value.
5. measure the expression of hemolytic toxin,
1) design of primers, according to what issue in Genebank
s.an315 gene template, take 16sRNA as standard internal reference, has designed the upstream and downstream primer of hla and reference gene, and primer is synthetic by the raw work in Shanghai, and primer sequence and amplified fragments size are in Table 1:
Table 1 quantitative fluorescent PCR the primer
| Primer | Sequence | Product length |
| 16sRNA sense | CCATAAAGTTGTTCTCAGTT | 83bp |
| 16sRNA antisense | CATGTCGATCTACGATTACT | |
| Hla sense | ATGGCTCTATGAAAGCAGCAGA | 105bp |
| Hla antisense | AAGTCTGGTGAAAACCCTGAAGA |
2) extract RNA, step (1) is obtained to thalline and add 0.5mlDEPC water rinse, 10000rpm/min leaves heart 1min, after getting 10mg/ml N,O-Diacetylmuramidase, the molten staphylococcus enzyme of 5 μ l and the TE buffer that supernatant liquor adds 60 μ l, shake resuspended bacterium, be placed in 35 ~ 37 ℃, 40min cracking bacterium wall, latter 4 ℃, the centrifugal 3min of 12000rpm/min, obtains precipitated liquid; Add the 1mlTrizol 5min that homogenizes, then add 200 μ l chloroforms to shake 15s, mix and place after 3min, 4 ℃ of centrifugal 15min of 12000rpm/min; Upper water is moved in new EP pipe mutually, add 480 μ l Virahols, mix and be placed on-20 ℃ of 20min, 4 ℃ of centrifugal 15min of 12000rpm/min must precipitate, and abandon supernatant liquor; EP pipe adds 1ml75% alcohol, rocks and makes resolution of precipitate, and 4 ℃ of centrifugal 10min of 12000rpm/min must precipitate, and room temperature is dried; Add RNase-free water dissolution, survey RNA concentration;
3) RNA reverse transcription, take 2 μ g steps 2) RNA that obtains is template, detailed process and reaction system are as follows:
Reagent dosage
RNA xμl
Oligo（dT）
18 1μl
DEPC water is mended to 12 μ l
The first step reaction system is 12 μ l, and reaction conditions is 65 ℃ of 5min, 4 ℃ of 5min;
Reagent dosage
40mg/L 5 * reaction buffer 4 μ l
20U/ μ l RNA enzyme inhibitors 1 μ l
10mMdNTP Mix 2μl
200U/ μ l reversed transcriptive enzyme 1 μ l
The first step is wanted to add mentioned reagent in conjunction with after completing, and making reverse transcription system cumulative volume is 20 μ l, and second step reaction conditions is 42 ℃ of 60min, and 70 ℃ of 5min are finally down to 4 ℃; Be cDNA;
4) regular-PCR checking, use sky, Beijing root Taq PCR Master Mix regular-PCR test kit, take cDNA as template, carry out regular-PCR amplification, reaction conditions is 95 ℃ of preheating 5min, 94 ℃ of sex change 1min, 54 ℃ of annealing 1min, 72 ℃ are extended 1min, 35 circulations altogether, last 72 ℃ of incubation 5min, get 10 μ lPCR amplified productions, add in the 2% sepharose well that adds I type nucleic acid dye, in tbe buffer liquid, voltage is that 100V carries out electrophoresis 25min, observations taking pictures under gel imaging system; The reaction system of regular-PCR is as follows:
2×Taq PCR Master Mix 12.5μl
Sterilizing deionized water 9.5 μ l
Upstream primer 1 μ l
Downstream primer 1 μ l
cDNA 1μl
Amount to 25 μ l
5) the horizontal detection by quantitative application of mRNA FastStart Universal SYBR Green Master(Roche) PCR kit for fluorescence quantitative, carry out reaction solution preparation, Setpone Plus ABI real-time fluorescence quantitative PCR instrument carries out amplified reaction, each drug level sample is all established three repetitions, parallel laboratory test three times, each reaction solution preparation all requires to carry out on ice, the reaction conditions of quantitative fluorescent PCR: 95 ℃ of denaturation 10min, 95 ℃ of sex change 15s, 58 ℃ of annealing 60s, 40 circulations, in each circulation extension stage, read fluorescent signal, finally generate amplification curve, product solubility curve, reaction system is as follows:
2×Taq PCR Master Mix 12.5μl
Sterilizing deionized water 9.5 μ l
Upstream primer 1 μ l
Downstream primer 1 μ l
cDNA 1μl
Amount to 25 μ l.
Embodiment 2
Embodiment 1 result.Drug intervention result, the Western Blot result of staphylococcus aureus toxin A shows that baicalin and the scutellarin of four concentration gradients all can suppress the generation of enterotoxin A albumen, band gray-scale value all more blank group obviously lower (
p< 0.05), and the baicalin of 1/2MIC or scutellarin during high density, can obviously suppress the generation of enterotoxin A albumen, and the baicalin of 1/4MIC, 1/8MIC, 1/16MIC or scutellarin weaken along with the reduction of concentration to the restraining effect of enterotoxin A, as shown in Figure 1.
Measure the expression of hemolytic toxin, as shown in Figure 2, goal gene and the reference gene electrophoresis result after regular-PCR amplification shows that the amplified production of two pairs of primers is single band, without non-specific amplification band and primer dimer, produce, and amplified production size conforms to the size of default amplification.Each point of the typical curve of each gene amplification is all in view of same straight line as seen from Figure 3, illustrates that CT value all increases with the extension rate of template concentrations and raises, coefficient R
2all close to 1, and the equal >90% of amplification efficiency Eff%, illustrate that this primer can be used for quantitative fluorescent PCR.
Result by the real-time fluorescence quantitative PCR of Fig. 4 hla can find out, through the baicalin of 1/2MIC, 1/4MIC, 1/8MIC or the expression amount of respectively organizing hla after scutellarin intervention all more not intervention group blank group reduce (
p< 0.05), wherein the baicalin of 1/4MIC or the restraining effect of scutellarin are the strongest, next is followed successively by baicalin or the scutellarin of 1/2MIC and 1/8MIC, and the baicalin of 1/16MIC or scutellarin to the transcriptional expression of alpha hemolysis toxin do not play restraining effect (
p> 0.05).
Claims (5)
1. a method that suppresses streptococcus aureus virulence factor, comprises the expression of drug intervention, reagent preparation, measurement total protein concentration, SDS-PAGE electrophoresis and mensuration hemolytic toxin, it is characterized in that, concrete steps are as follows,
(1) drug intervention, is seeded to 3ml containing in the TSB liquid nutrient medium of 0.5% glucose by the streptococcus aureus after rejuvenation, and 35 ~ 37 ℃, 250rpm/min are cultivated after 12h, are inoculated into amplification culture in 300mlTSB liquid nutrient medium, are cultured to OD
600=0.3 is divided into N part, add respectively baicalin and scutellarin, the concentration that adds baicalin is 0 ~ 1/2MIC, the concentration that adds scutellarin is 0 ~ 1/2MIC, be placed in after 35 ~ 37 ℃, 250rpm/min are cultivated 5h and sample, the centrifugal 5min of 12000rpm/min, separating thallus and supernatant liquor, 0.22 μ m membrane filtration for supernatant liquor, standby;
(2) reagent preparation, preparation 10% ammonium persulphate, 12% separation gel, concentrated glue, confining liquid and developing fixing liquid;
(3) measure total protein concentration, get 10 μ l 5mg/ml bovine serum albumins and be diluted to 100 μ l with TSB liquid nutrient medium, by 0,1,2,4,8,12,16,20 μ l, be added to respectively 96 orifice plates afterwards, add TSB liquid nutrient medium that volume is complemented to 20 μ l, get again the supernatant liquor that 20 μ l steps (1) obtain, join in above-mentioned each hole, each hole adds 200 μ lBradford staining fluids afterwards, and concussion mixes 5min and measures A by microplate reader
595, according to standard substance, record numerical value drawing standard curve, then according to typical curve, calculate the total protein concentration of supernatant liquor;
(4) SDS-PAGE electrophoresis, comprises and prepares gel, electrophoresis loading, transferring film, seals, hatches antibody, luminous developing fixing and gel image analysis;
(5) measure the expression of hemolytic toxin,
1) design of primers, comprises upstream primer and downstream primer;
2) extract RNA, step (1) is obtained to thalline and add 0.5mlDEPC water rinse, 10000rpm/min leaves heart 1min, get after supernatant liquor adds 60 μ l 10mg/ml N,O-Diacetylmuramidases, the molten staphylococcus enzyme of 5 μ l and TE buffer and shake resuspended bacterium, be placed in after 35 ~ 37 ℃, 40min cracking bacterium wall, 4 ℃, the centrifugal 3min of 12000rpm/min, obtain precipitated liquid; Add the 1mlTrizol 5min that homogenizes, then add 200 μ l chloroforms to shake 15s, mix and place after 3min, 4 ℃, the centrifugal 15min of 12000rpm/min; Upper water is moved in new EP pipe mutually, add 480 μ l Virahols, mix and be placed on-20 ℃ of 20min, 4 ℃, the centrifugal 15min of 12000rpm/min must precipitate, and abandon supernatant liquor; EP pipe adds 1ml75% alcohol, rocks and makes resolution of precipitate, and 4 ℃, the centrifugal 10min of 12000rpm/min must precipitate, and room temperature is dried; Add RNase-free water dissolution, survey RNA concentration;
3) RNA reverse transcription, take 2 μ g steps 2) RNA that obtains is template, detailed process and reaction system are as follows:
Reagent dosage
RNA xμl
Oligo（dT）
18 1μl
DEPC water is mended to 12 μ l
The first step reaction system is 12 μ l, and reaction conditions is 65 ℃ of 5min, 4 ℃ of 5min;
Reagent dosage
40mg/L 5 * reaction buffer 4 μ l
20U/ μ l RNA enzyme inhibitors 1 μ l
10mMdNTP Mix 2μl
200U/ μ l reversed transcriptive enzyme 1 μ l
The first step is wanted to add mentioned reagent in conjunction with after completing, and making reverse transcription system cumulative volume is 20 μ l, and second step reaction conditions is 42 ℃ of 60min, and 70 ℃ of 5min are finally down to 4 ℃; Be cDNA;
4) regular-PCR checking, take cDNA as template, carries out regular-PCR amplification, reaction conditions is 95 ℃ of preheating 5min, 94 ℃ of sex change 1min, 54 ℃ of annealing 1min, 72 ℃ are extended 1min, 35 circulations altogether, last 72 ℃ of incubation 5min, get 10 μ lPCR amplified productions, add in the 2% sepharose well that adds I type nucleic acid dye, in tbe buffer liquid, voltage is that 100V carries out electrophoresis 25min, observations taking pictures under gel imaging system; The reaction system of regular-PCR is as follows:
2×Taq PCR Master Mix 12.5μl
Sterilizing deionized water 9.5 μ l
Upstream primer 1 μ l
Downstream primer 1 μ l
cDNA 1μl
Amount to 25 μ l
5) the horizontal detection by quantitative of mRNA, PCR kit for fluorescence quantitative carries out reaction solution preparation, reaction solution is formulated on ice and carries out, real-time PCR carries out amplified reaction, the reaction conditions of quantitative fluorescent PCR: 95 ℃ of denaturation 10min, 95 ℃ of sex change 15s, 58 ℃ of annealing 60s, 40 circulations, read fluorescent signal in each circulation extension stage, finally generate amplification curve, product solubility curve; Reaction system is as follows:
2×Taq PCR Master Mix 12.5μl
Sterilizing deionized water 9.5 μ l
Upstream primer 1 μ l
Downstream primer 1 μ l
cDNA 1μl
Amount to 25 μ l.
2. the method for inhibition streptococcus aureus virulence factor according to claim 1, is characterized in that, described N is at least 2 parts.
3. the method for inhibition streptococcus aureus virulence factor according to claim 1, is characterized in that, described MIC is the minimum inhibitory concentration of baicalin or scutellarin.
4. the method for inhibition according to claim 1 streptococcus aureus virulence factor, is characterized in that, the compound method of 10% described ammonium persulphate is for to be dissolved in 0.1g ammonium persulphate in 1ml deionized water, 4 ℃ of storages of lucifuge; Described 12% separation gel comprises 3.3ml deionized water, 4.0ml 30% acrylamide soln, 2.5ml 1.5mol/LTris-HCl (PH8.8), 0.1ml 10%SDS, 0.1ml 10% ammonium persulphate and 0.004ml TEMED; Described concentrated glue comprises 2.7ml deionized water, 0.67ml30% acrylamide soln, 0.5ml1.0mol/LTris-HCl, 0.04ml10%SDS, 0.04ml10% ammonium persulphate and 0.004ml TEMED.
5. the method for inhibition according to claim 1 streptococcus aureus virulence factor, it is characterized in that, the described gel of preparing, by 12% separation gel implantation glass plate of step (2) preparation, Jiao Ding adds 1ml deionized water, after gelling to be separated is solid, upper water is poured out, wipe dry, to concentrate again between sol solution implantation glass plate until insert fixture behind top, vertical placement treats that solution solidifies removes fixture, gel glass plate is put into electrophoresis chamber, connect power supply, in groove, add 5 * SDS-PAGE electrophoretic buffer; The described antibody of hatching, is diluted to 1:5000 by SEA primary antibodie with TBST, and the pvdf membrane having sealed is put into, and room temperature is rocked and hatched after 1h, cultivates 8 ~ 12h for 4 ℃, washes three times, at every turn 10min with TBST on shaking table; Pvdf membrane being put into dilution is the anti-solution of SEA bis-of 1:4000 again, and room temperature is rocked and hatched after 1h, washes each 10 minutes with TBST on shaking table three times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310748317.9A CN104031876A (en) | 2013-12-31 | 2013-12-31 | Method of inhibiting staphylococcus aureus virulence factor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310748317.9A CN104031876A (en) | 2013-12-31 | 2013-12-31 | Method of inhibiting staphylococcus aureus virulence factor |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104031876A true CN104031876A (en) | 2014-09-10 |
Family
ID=51462874
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310748317.9A Pending CN104031876A (en) | 2013-12-31 | 2013-12-31 | Method of inhibiting staphylococcus aureus virulence factor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104031876A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102336773A (en) * | 2011-03-21 | 2012-02-01 | 北京华牧伟业科技有限公司 | Baicalin-copper complexes and preparation methods thereof |
| CN102516341A (en) * | 2011-11-16 | 2012-06-27 | 西南大学 | Baicalin metal complex and preparation method and application thereof |
| CN103028001A (en) * | 2011-09-29 | 2013-04-10 | 中国中医科学院西苑医院 | Traditional Chinese medicine prescription for relieving asthma, relieving cough and resisting inflammatory, preparation method and application thereof |
-
2013
- 2013-12-31 CN CN201310748317.9A patent/CN104031876A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102336773A (en) * | 2011-03-21 | 2012-02-01 | 北京华牧伟业科技有限公司 | Baicalin-copper complexes and preparation methods thereof |
| CN103028001A (en) * | 2011-09-29 | 2013-04-10 | 中国中医科学院西苑医院 | Traditional Chinese medicine prescription for relieving asthma, relieving cough and resisting inflammatory, preparation method and application thereof |
| CN102516341A (en) * | 2011-11-16 | 2012-06-27 | 西南大学 | Baicalin metal complex and preparation method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| PAVEL NOVY ,ET AL: "In vitro synergistic effects of baicalin with oxytetracycline and tetracycline against Staphylococcus aureus", 《J ANTIMICROB CHEMOTHER》 * |
| 邱家章: "黄芩苷抗金黄色葡萄球菌ａ-溶血酶作用靶位点的确证", 《中国博士学位论文全文数据库，农业科学辑》 * |
| 黄莹莹，等: "黄芩苷及联合左氧氟沙星对金黄色葡萄球菌早期生物膜的体外影响", 《中国现代医学杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Seto et al. | A key role for leukemia inhibitory factor in C26 cancer cachexia | |
| Moghadamrad et al. | Attenuated portal hypertension in germ‐free mice: function of bacterial flora on the development of mesenteric lymphatic and blood vessels | |
| Sepahi et al. | Symbiont-derived sphingolipids modulate mucosal homeostasis and B cells in teleost fish | |
| Kelly et al. | Effect of cortisol on the physiology of cultured pavement cell epithelia from freshwater trout gills | |
| Dong et al. | Ethyl pyruvate inhibits LPS induced IPEC-J2 inflammation and apoptosis through p38 and ERK1/2 pathways | |
| CN108883088A (en) | Using the Epithelial and stromal of chromone derivative conversion inhibitory activity as fibrosis prevention and the new application for the treatment of pharmaceutical composition | |
| Yang et al. | Latent cytomegalovirus infection in female mice increases breast cancer metastasis | |
| CN104531700B (en) | Suppress shRNA sequences and its application of mouse MACF1 gene expressions | |
| CN105147663A (en) | Application of luteolin in bacterial quorum sensing inhibition system | |
| CN103667441A (en) | Hsa-miR-145-5p kit and use of mature body analogy of Hsa-miR-145-5p | |
| CN102382800A (en) | Method for inducing formation of porcine fat cells by cell signal channel inhibitor | |
| Kim et al. | The role of autophagy in breast cancer metastasis | |
| Zhao et al. | Activation of TRPA1 in bladder suburothelial myofibroblasts counteracts TGF-β1-induced fibrotic changes | |
| CN102552935B (en) | Use of hepatocyte nuclear factor-1alpha in treatment of chronic liver disease | |
| Li et al. | Combination therapy with DHA and BMSCs suppressed podocyte injury and attenuated renal fibrosis by modulating the TGF-β 1/Smad pathway in MN mice | |
| CN109055496A (en) | Utilize the variation of gene microarray analysis lipopolysaccharides stimulation cow mammary gland epithelial cells express spectra | |
| CN104031876A (en) | Method of inhibiting staphylococcus aureus virulence factor | |
| Wang et al. | Sphingosylphosphorylcholine induces α-smooth muscle actin expression in human lung fibroblasts and fibroblast-mediated gel contraction via S1P2 receptor and Rho/Rho-kinase pathway | |
| CN105457028B (en) | The stress sensitivity microRNA of regulating and controlling effect is played in bon e formation | |
| Shimada et al. | Improved methods for immunohistochemical detection of BrdU in hard tissue | |
| CN108144061B (en) | Application of the microRNA-210 inhibitor on preparation treatment inflammatory skin medicine | |
| Xu et al. | Sinisan ameliorates colonic injury induced by water immersion restraint stress by enhancing intestinal barrier function and the gut microbiota structure | |
| CN102816792A (en) | Method for regulating expression, quantity and activity of heat shock protein 70 and application thereof | |
| Horvat et al. | Herpesvirus in harbour seals (Phoca vitulina): transmission in homologous host | |
| CN106243224A (en) | One utilizes Agkistrodon acutus venom differential protein to prepare sero-fast method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140910 |